GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-17 19:43:00, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       NM_011701               1834 bp    mRNA    linear   ROD 12-JUN-2025
DEFINITION  Mus musculus vimentin (Vim), mRNA.
ACCESSION   NM_011701
VERSION     NM_011701.4
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1834)
  AUTHORS   Jasmine, Baraiya,D.H., Kavya,T.T., Mandal,A., Chakraborty,S.,
            Sathish,N., Francis,C.M.R. and Binoy Joseph,D.
  TITLE     Epithelial and mesenchymal compartments of the developing bladder
            and urethra display spatially distinct gene expression patterns
  JOURNAL   Dev Biol 520, 155-170 (2025)
   PUBMED   39798644
REFERENCE   2  (bases 1 to 1834)
  AUTHORS   Zhang,H., Papiernik,T., Tian,S., Yaghmour,A., Alzein,A.,
            Lennon,J.B., Maini,R., Tan,X., Niazi,A., Park,J., Park,S.,
            Richter,C.P. and Ebeid,M.
  TITLE     Kolliker's Organ Functions as a Developmental Hub in Mouse Cochlea
            Regulating Spiral Limbus and Tectorial Membrane Development
  JOURNAL   J Neurosci 45 (13), e0721242025 (2025)
   PUBMED   39909560
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1834)
  AUTHORS   McKinsey,G.L., Santander,N., Zhang,X., Kleemann,K.L., Tran,L.,
            Katewa,A., Conant,K., Barraza,M., Waddell,K., Lizama,C.O., La
            Russa,M., Koo,J.H., Lee,H., Mukherjee,D., Paidassi,H., Anton,E.S.,
            Atabai,K., Sheppard,D., Butovsky,O. and Arnold,T.D.
  TITLE     Radial glia integrin avb8 regulates cell autonomous microglial
            TGFbeta1 signaling that is necessary for microglial identity
  JOURNAL   Nat Commun 16 (1), 2840 (2025)
   PUBMED   40121230
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1834)
  AUTHORS   Lahti,L., Volakakis,N., Gillberg,L., Yaghmaeian Salmani,B.,
            Tiklova,K., Kee,N., Lunden-Miguel,H., Werkman,M., Piper,M.,
            Gronostajski,R. and Perlmann,T.
  TITLE     Sox9 and nuclear factor I transcription factors regulate the timing
            of neurogenesis and ependymal maturation in dopamine progenitors
  JOURNAL   Development 152 (6) (2025)
   PUBMED   39995267
REFERENCE   5  (bases 1 to 1834)
  AUTHORS   Cocito,C., Xiang,C., Huang,M., Gongora,T., Surana,P., Davuluri,R.,
            Dahmane,N. and Greenfield,J.P.
  TITLE     Immunoglobulin superfamily 3 (Igsf3) function is dispensable for
            brain development
  JOURNAL   Sci Rep 15 (1), 6526 (2025)
   PUBMED   39988603
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1834)
  AUTHORS   Salier,J.P., Simon,D., Rouet,P., Raguenez,G., Muscatelli,F.,
            Gebhard,W., Guenet,J.L. and Mattei,M.G.
  TITLE     Homologous chromosomal locations of the four genes for
            inter-alpha-inhibitor and pre-alpha-inhibitor family in human and
            mouse: assignment of the ancestral gene for the lipocalin
            superfamily
  JOURNAL   Genomics 14 (1), 83-88 (1992)
   PUBMED   1385302
REFERENCE   7  (bases 1 to 1834)
  AUTHORS   Pilz,A., Moseley,H., Peters,J. and Abbott,C.
  TITLE     Comparative mapping of mouse chromosome 2 and human chromosome 9q:
            the genes for gelsolin and dopamine beta-hydroxylase map to mouse
            chromosome 2
  JOURNAL   Genomics 12 (4), 715-719 (1992)
   PUBMED   1315305
REFERENCE   8  (bases 1 to 1834)
  AUTHORS   Porteus,M.H., Brice,A.E., Bulfone,A., Usdin,T.B., Ciaranello,R.D.
            and Rubenstein,J.L.
  TITLE     Isolation and characterization of a library of cDNA clones that are
            preferentially expressed in the embryonic telencephalon
  JOURNAL   Brain Res Mol Brain Res 12 (1-3), 7-22 (1992)
   PUBMED   1372074
REFERENCE   9  (bases 1 to 1834)
  AUTHORS   Bastian,H., Gruss,P., Duboule,D. and Izpisua-Belmonte,J.C.
  TITLE     The murine even-skipped-like gene Evx-2 is closely linked to the
            Hox-4 complex, but is transcribed in the opposite direction
  JOURNAL   Mamm Genome 3 (4), 241-243 (1992)
   PUBMED   1611218
REFERENCE   10 (bases 1 to 1834)
  AUTHORS   Threadgill,D.S. and Womack,J.E.
  TITLE     Mapping HSA10 homologous loci in cattle
  JOURNAL   Cytogenet Cell Genet 57 (2-3), 123-126 (1991)
   PUBMED   1655359
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK133726.1.
            
            On Apr 23, 2009 this sequence version replaced NM_011701.3.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK133726.1, AK153019.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849375
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1834              AK133726.1         2-1835
FEATURES             Location/Qualifiers
     source          1..1834
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="2"
                     /map="2 10.04 cM"
     gene            1..1834
                     /gene="Vim"
                     /note="vimentin"
                     /db_xref="GeneID:22352"
                     /db_xref="MGI:MGI:98932"
     exon            1..684
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     CDS             122..1522
                     /gene="Vim"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="NP_035831.2"
                     /db_xref="CCDS:CCDS15696.1"
                     /db_xref="GeneID:22352"
                     /db_xref="MGI:MGI:98932"
                     /translation="
MSTRSVSSSSYRRMFGGSGTSSRPSSNRSYVTTSTRTYSLGSALRPSTSRSLYSSSPGGAYVTRSSAVRLRSSVPGVRLLQDSVDFSLADAINTEFKNTRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGQGKSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLAEDIMRLREKLQEEMLQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIAFLKKLHDEEIQELQAQIQEQHVQIDVDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQESNEYRRQVQSLTCEVDALKGTNESLERQMREMEENFALEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRISLPLPTFSSLNLRETNLESLPLVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
     misc_feature    122..220
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    125..406
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Head"
     misc_feature    125..127
                     /gene="Vim"
                     /note="N-acetylserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    134..136
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    140..142
                     /gene="Vim"
                     /note="O-linked (GlcNAc) serine, alternate.
                     /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); glycosylation site"
     misc_feature    140..142
                     /gene="Vim"
                     /note="Phosphoserine, by PKA and PKC, alternate.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    143..145
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    146..148
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    149..151
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    161..424
                     /gene="Vim"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:461414"
     misc_feature    179..181
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    182..184
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    194..196
                     /gene="Vim"
                     /note="Phosphoserine, by PKA and PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    197..199
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    218..220
                     /gene="Vim"
                     /note="O-linked (GlcNAc) threonine. /evidence=ECO:0000250;
                     propagated from UniProtKB/Swiss-Prot (P20152.3);
                     glycosylation site"
     misc_feature    221..223
                     /gene="Vim"
                     /note="O-linked (GlcNAc) serine, alternate.
                     /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); glycosylation site"
     misc_feature    221..223
                     /gene="Vim"
                     /note="Phosphoserine, by PKC, alternate.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    236..238
                     /gene="Vim"
                     /note="Phosphoserine, by CaMK2, PKA, PKC and ROCK2.
                     /evidence=ECO:0000269|PubMed:1850997,
                     ECO:0000269|PubMed:2500966, ECO:0000269|PubMed:9565595,
                     ECO:0007744|PubMed:19131326; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    245..247
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    260..262
                     /gene="Vim"
                     /note="Phosphoserine, by PKA.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    266..268
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:19131326; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    272..274
                     /gene="Vim"
                     /note="Phosphoserine, by PKA and PKC.
                     /evidence=ECO:0000269|PubMed:2500966,
                     ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    278..280
                     /gene="Vim"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0007744|PubMed:17947660; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    284..286
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P31000; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    287..289
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:17242355,
                     ECO:0007744|PubMed:19131326, ECO:0007744|PubMed:19144319,
                     ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    302..304
                     /gene="Vim"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0007744|PubMed:17947660; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    317..319
                     /gene="Vim"
                     /note="Phosphoserine, by PKA and PKC.
                     /evidence=ECO:0000269|PubMed:2500966,
                     ECO:0007744|PubMed:19131326; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    335..337
                     /gene="Vim"
                     /note="Phosphoserine, by AURKB and ROCK2.
                     /evidence=ECO:0000269|PubMed:9565595; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    338..340
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    368..370
                     /gene="Vim"
                     /note="Phosphoserine, by CaMK2.
                     /evidence=ECO:0000269|PubMed:1850997,
                     ECO:0007744|PubMed:15345747, ECO:0007744|PubMed:21183079;
                     propagated from UniProtKB/Swiss-Prot (P20152.3);
                     phosphorylation site"
     misc_feature    380..382
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    407..514
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Coil 1A"
     misc_feature    425..1351
                     /gene="Vim"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:459643"
     misc_feature    470..472
                     /gene="Vim"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    479..481
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    506..508
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    515..580
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Linker 1"
     misc_feature    536..538
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    551..553
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    581..856
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Coil 1B"
     misc_feature    623..625
                     /gene="Vim"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    683..685
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    761..763
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:19144319; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    788..790
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    797..799
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    824..826
                     /gene="Vim"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    857..925
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Linker 12"
     misc_feature    926..1342
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Coil 2"
     misc_feature    1001..1003
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    1016..1018
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1094..1096
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1097..1108
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: [IL]-x-C-x-x-[DE] motif.
                     /evidence=ECO:0000250|UniProtKB:P08670"
     misc_feature    1172..1174
                     /gene="Vim"
                     /note="Stutter. /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); other site"
     misc_feature    1238..1240
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    1343..1519
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Tail"
     misc_feature    1346..1348
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1355..1357
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P84198; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1376..1378
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1379..1381
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:19131326,
                     ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1397..1399
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1409..1411
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:19131326; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1427..1429
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1433..1435
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1454..1456
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    1457..1459
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1493..1495
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1496..1498
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:19144319,
                     ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     exon            685..745
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            746..841
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            842..1003
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1004..1129
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1130..1350
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1351..1394
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1395..1480
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1481..1834
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1816..1821
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Vim"
                     /note="hexamer: AATAAA"
     polyA_site      1834
                     /gene="Vim"
                     /note="major polyA site"
ORIGIN      
ctctgccactcttgctccgggaccccagagaccccagcgctcctacgattcacagccaccgcgccctcattcccttgttgcagtttttccagccgcagcaagccagcccaccttcgaagccatgtctaccaggtctgtgtcctcgtcctcctaccgcaggatgttcggtggctccggcacatcgagccggcccagctccaaccggagctatgtgaccacgtccacacgcacctacagtctgggcagcgcactgcgccccagcactagccgcagcctctattcctcatcccccggtggcgcctatgtgacccggtcctcggcagtgcgcctgcggagcagcgtgccgggcgtgcggctgcttcaagactcggtggacttctcgctggccgacgccatcaacactgagttcaagaacacccgcaccaacgagaaggtagaactgcaggagctgaatgaccgctttgccaactacatcgacaaggtgcgcttcctcgagcagcagaacaaaatcctgctggctgagctcgagcagctcaagggccagggcaagtcgcgcctgggcgacctgtacgaggaggagatgcgggagctgcgccggcaggtggatcagctcaccaacgacaaggcccgtgtcgaggtggagcgggacaacctggccgaggacatcatgcggctgcgagagaaattgcaggaggagatgctccagagagaggaagccgaaagcaccctgcagtcattcagacaggatgttgacaatgcttctctggcacgtcttgaccttgaacggaaagtggaatccttgcaggaagaaattgcctttttgaagaaactgcacgatgaagagatccaggagctgcaggcccagattcaggaacagcatgtccagatcgatgtggacgtttccaagcctgacctcactgctgccctgcgtgatgtgcgccagcagtatgaaagcgtggctgccaagaacctccaggaggccgaggaatggtacaagtccaagtttgctgacctctctgaggctgccaaccggaacaacgatgccctgcgccaggccaagcaggagtcaaacgagtaccggagacaggtgcagtcactcacctgtgaagtggatgcccttaaaggcactaacgagtccctggagcgccagatgcgtgagatggaagagaattttgcccttgaagctgctaactaccaggacactattggccgcctgcaggatgagatccaaaacatgaaggaagagatggctcgtcaccttcgtgaataccaagatctgctcaatgttaagatggccctggacattgagatcgccacctacaggaagctgctggaaggcgaggagagcaggatttctctgcctctgccaaccttttcttccctgaacctgagagaaactaacctggagtcacttcctctggttgacacccactcaaaaagaacactcctgattaagacggttgagaccagagatggacaggtgatcaatgagacttctcagcatcacgatgaccttgaataaaaattgcacacacttggtgcaacagtgcagtaccagcaagaaggaaaaaaaaatcgtatcttaggaaaacagctttcaagtgcctttactgcagtttttcaggagcgcaagatagatttggaatagaaagaagctcagcacttaacaactgacaccccaaaagacgtagaaaaggtttacaaaataatctagtttacgaagaaatcttgtgctagaatactttttaaagtatttttgaataccattaaaactgcttttttccagtaaatatctgaccaacttgttactgcttcaataaatcttcaaaaatac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]