GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-14 06:05:07, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_001439459            2174 bp    mRNA    linear   ROD 05-MAY-2025
DEFINITION  Mus musculus growth differentiation factor 9 (Gdf9), transcript
            variant 3, mRNA.
ACCESSION   NM_001439459 XM_030245570
VERSION     NM_001439459.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2174)
  AUTHORS   Song,C., Qin,Y., Li,Y., Yang,B., Guo,T., Ma,W., Xu,D., Xu,K.,
            Fu,F., Jin,L., Wu,Y., Tang,S., Chen,X. and Zhang,F.
  TITLE     Deleterious variants in RNF111 impair female fertility and induce
            premature ovarian insufficiency in humans and mice
  JOURNAL   Sci China Life Sci 67 (7), 1325-1337 (2024)
   PUBMED   38874713
REFERENCE   2  (bases 1 to 2174)
  AUTHORS   Hughes,C.H.K., Smith,O.E., Meinsohn,M.C., Brunelle,M., Gevry,N. and
            Murphy,B.D.
  TITLE     Steroidogenic factor 1 (SF-1; Nr5a1) regulates the formation of the
            ovarian reserve
  JOURNAL   Proc Natl Acad Sci U S A 120 (32), e2220849120 (2023)
   PUBMED   37494420
REFERENCE   3  (bases 1 to 2174)
  AUTHORS   Ito,H., Emori,C., Kobayashi,M., Maruyama,N., Fujii,W., Naito,K. and
            Sugiura,K.
  TITLE     Cooperative effects of oocytes and estrogen on the forkhead box L2
            expression in mural granulosa cells in mice
  JOURNAL   Sci Rep 12 (1), 20158 (2022)
   PUBMED   36424497
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2174)
  AUTHORS   Gindi,N., Grossman,H., Bar-Joseph,H., Miller,I., Nemerovsky,L.,
            Hadas,R., Nevo,N., Galiani,D., Dekel,N. and Shalgi,R.
  TITLE     Fyn and argonaute 2 participate in maternal-mRNA degradation during
            mouse oocyte maturation
  JOURNAL   Cell Cycle 21 (8), 792-804 (2022)
   PUBMED   35104175
REFERENCE   5  (bases 1 to 2174)
  AUTHORS   Prokopuk,L., Jarred,E.G., Blucher,R.O., McLaughlin,E.A.,
            Stringer,J.M. and Western,P.S.
  TITLE     An essential role for Polycomb Repressive Complex 2 in the mouse
            ovary
  JOURNAL   Reproduction 163 (3), 167-182 (2022)
   PUBMED   35084365
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2174)
  AUTHORS   Watkins-Chow,D.E., Buckwalter,M.S., Newhouse,M.M., Lossie,A.C.,
            Brinkmeier,M.L. and Camper,S.A.
  TITLE     Genetic mapping of 21 genes on mouse chromosome 11 reveals
            disruptions in linkage conservation with human chromosome 5
  JOURNAL   Genomics 40 (1), 114-122 (1997)
   PUBMED   9070927
REFERENCE   7  (bases 1 to 2174)
  AUTHORS   Dong,J., Albertini,D.F., Nishimori,K., Kumar,T.R., Lu,N. and
            Matzuk,M.M.
  TITLE     Growth differentiation factor-9 is required during early ovarian
            folliculogenesis
  JOURNAL   Nature 383 (6600), 531-535 (1996)
   PUBMED   8849725
REFERENCE   8  (bases 1 to 2174)
  AUTHORS   McGrath,S.A., Esquela,A.F. and Lee,S.J.
  TITLE     Oocyte-specific expression of growth/differentiation factor-9
  JOURNAL   Mol Endocrinol 9 (1), 131-136 (1995)
   PUBMED   7760846
REFERENCE   9  (bases 1 to 2174)
  AUTHORS   Incerti,B., Dong,J., Borsani,G. and Matzuk,M.M.
  TITLE     Structure of the mouse growth/differentiation factor 9 gene
  JOURNAL   Biochim Biophys Acta 1222 (1), 125-128 (1994)
   PUBMED   8186260
REFERENCE   10 (bases 1 to 2174)
  AUTHORS   McPherron,A.C. and Lee,S.J.
  TITLE     GDF-3 and GDF-9: two new members of the transforming growth
            factor-beta superfamily containing a novel pattern of cysteines
  JOURNAL   J Biol Chem 268 (5), 3444-3449 (1993)
   PUBMED   8429021
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL592489.13.
            
            On May 5, 2025 this sequence version replaced XM_030245570.2.
            
            Summary: This gene encodes a secreted ligand of the TGF-beta
            (transforming growth factor-beta) superfamily of proteins. Ligands
            of this family bind various TGF-beta receptors leading to
            recruitment and activation of SMAD family transcription factors
            that regulate gene expression. The encoded preproprotein is
            proteolytically processed to generate each subunit of the
            disulfide-linked homodimer. This protein regulates ovarian
            function. Female mice that are homozygous null for this gene are
            sterile with impaired folliculogenesis. [provided by RefSeq, Jul
            2016].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR5189670.143599.1,
                                           SRR7345562.479045.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849382, SAMN00849384
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-21                AL592489.13        140286-140306
            22-886              AL592489.13        142192-143056
            887-2174            AL592489.13        145870-147157
FEATURES             Location/Qualifiers
     source          1..2174
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="11"
                     /map="11 31.94 cM"
     gene            1..2174
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /note="growth differentiation factor 9"
                     /db_xref="GeneID:14566"
                     /db_xref="MGI:MGI:95692"
     exon            1..21
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /inference="alignment:Splign:2.1.0"
     exon            22..886
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    475..477
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /note="upstream in-frame stop codon"
     CDS             490..1815
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 3"
                     /codon_start=1
                     /product="growth/differentiation factor 9 isoform 1
                     precursor"
                     /protein_id="NP_001426388.1"
                     /db_xref="GeneID:14566"
                     /db_xref="MGI:MGI:95692"
                     /translation="
MALPSNFLLGVCCFAWLCFLSSLSSQASTEESQSGASENVESEADPWSLLLPVDGTDRSGLLPPLFKVLSDRRGETPKLQPDSRALYYMKKLYKTYATKEGVPKPSRSHLYNTVRLFSPCAQQEQAPSNQVTGPLPMVDLLFNLDRVTAMEHLLKSVLLYTLNNSASSSSTVTCMCDLVVKEAMSSGRAPPRAPYSFTLKKHRWIEIDVTSLLQPLVTSSERSIHLSVNFTCTKDQVPEDGVFSMPLSVPPSLILYLNDTSTQAYHSWQSLQSTWRPLQHPGQAGVAARPVKEEAIEVERSPRRRRGQKAIRSEAKGPLLTASFNLSEYFKQFLFPQNECELHDFRLSFSQLKWDNWIVAPHRYNPRYCKGDCPRAVRHRYGSPVHTMVQNIIYEKLDPSVPRPSCVPGKYSPLSVLTIEPDGSIAYKEYEDMIATRCTCR"
     sig_peptide     490..570
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     misc_feature    976..978
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q07105.2); glycosylation site"
     misc_feature    1174..1176
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q07105.2); glycosylation site"
     misc_feature    1261..1263
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q07105.2); glycosylation site"
     misc_feature    1462..1464
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q07105.2); glycosylation site"
     exon            887..2174
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2153..2158
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /note="hexamer: AATAAA"
     polyA_site      2174
                     /gene="Gdf9"
                     /gene_synonym="Gdf-9"
                     /note="major polyA site"
ORIGIN      
agaggtgcttgtgggcttacgtaagccatcagttattctaaccacctggacgtgggagctgtggagatagacgatgaatcaagaggaaaaaataaacctaatacttctgcagtcacatctccagccctaagaggttttgttttataattccttgggtttctgttgggctctcacctatataagtagtccactagggtgacgatacttggtgggtttgaaataaatgtccaggagaaacagggaaagaaagccaaataagtagataaatctgtatctaatgagaacaaattggataaaaccgtgttgtcagctgactgctgtagagctgataagaaacaatgtacagctaggcatgcttgaggtctgattacagaagtgaagtcagtcttccacacctagattttatttaaggaccacgccagggcctccccgacctttagaaagaagactggcacgaggagatgcgttccttcttagttctcccaagtcatggcacttcccagcaacttcctgttgggggtttgctgctttgcctggctgtgttttcttagtagccttagctctcaggcttctactgaagaatcccagagtggagccagtgaaaatgtggagtctgaggcagacccctggtccttgctgctgcctgtagatgggactgacaggtctggcctcttgccccccctctttaaggttctatctgataggcgaggtgagacccctaagctgcagcctgactccagagcactctactacatgaaaaagctctataagacgtatgctaccaaagagggggttcccaaacccagcagaagtcacctctacaataccgtccggctcttcagtccctgtgcccagcaagagcaggcacccagcaaccaggtgacaggaccgctgccgatggtggacctgctgtttaacctggaccgggtgactgccatggaacacttgctcaaatcggtcttgctatacactctgaacaactctgcctcttcctcctccactgtgacctgtatgtgtgaccttgtggtaaaggaggccatgtcttctggcagggcacccccaagagcaccgtactcattcaccctgaagaaacacagatggattgagattgatgtgacctccctccttcagcccctagtgacctccagcgagaggagcattcacctgtctgtcaattttacatgcacaaaagaccaggtgccagaggacggagtgtttagcatgcctctctcagtgcctccttccctcatcttgtatctcaacgacacaagcacccaggcctaccactcttggcagtctcttcagtccacctggaggcctttacagcatcccggccaggccggtgtggctgcccgtcccgtgaaagaggaagctattgaggtggaaagatctccccggcgccgtcgagggcagaaagccatccgctccgaagcgaaggggccacttcttacagcatccttcaacctcagcgaatacttcaaacagtttcttttcccccaaaacgagtgtgaactccatgacttcagactgagttttagtcagctcaaatgggacaactggatcgtggccccgcacaggtacaaccctaggtactgtaaaggggactgtcctagggcggtcaggcatcggtacggctctcctgtgcacaccatggtccagaatataatctatgagaagctggacccttcagtgccaaggccttcgtgtgtgccgggcaagtacagccccctgagtgtgttgaccattgaacccgacggctccatcgcttacaaagagtacgaagacatgatagctacgaggtgcacctgtcgttagcatgggggccacttcaacaagcctgcctggcagagcaatgctgtgggccttagagtgcctgggcagagagcttcctgtgaccagtctctccgtgctgctcagtgcacactgtgtgagcgggggaagtgtgtgtgtggatgagcacatcgagtgcagtgtccgtaggtgtaaagggcacactcactggtcgttgccataaaccaagtgaaatgtaactcatttggagagctctttctccccacgagtgtagttttcagtggacagatttgttagcataagtctcgagtagaatgtagctgtgaacatgtcagagtgctgtggttttatgtgacggaagaataaactgttgatggcataaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]