2024-05-03 05:59:56, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001382482 1527 bp mRNA linear ROD 19-NOV-2023 DEFINITION Mus musculus AKT1 substrate 1 (Akt1s1), transcript variant 7, mRNA. ACCESSION NM_001382482 XM_006541120 VERSION NM_001382482.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1527) AUTHORS Cai S, Yang Q, Cao Y, Li Y, Liu J, Wang J, Zhang X, Liu L, Li X and Zhang Y. TITLE PF4 antagonizes retinal neovascularization via inhibiting PRAS40 phosphorylation in a mouse model of oxygen-induced retinopathy JOURNAL Biochim Biophys Acta Mol Basis Dis 1866 (3), 165604 (2020) PUBMED 31740404 REMARK GeneRIF: This study, for the first time, links PF4's anti-RNV function to an intracellular signaling molecule PRAS40 and its phosphorylation. REFERENCE 2 (bases 1 to 1527) AUTHORS Figlia G, Norrmen C, Pereira JA, Gerber D and Suter U. TITLE Dual function of the PI3K-Akt-mTORC1 axis in myelination of the peripheral nervous system JOURNAL Elife 6, e29241 (2017) PUBMED 28880149 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1527) AUTHORS Yang W, Yang LF, Song ZQ, Shah SZA, Cui YY, Li CS, Zhao HF, Gao HL, Zhou XM and Zhao DM. TITLE PRAS40 alleviates neurotoxic prion peptide-induced apoptosis via mTOR-AKT signaling JOURNAL CNS Neurosci Ther 23 (5), 416-427 (2017) PUBMED 28294542 REMARK GeneRIF: PRAS40 inhibits mTORC1 hyperactivation and plays a key role in protecting cells against neurotoxic prion peptide-induced apoptosis. Thus, PRAS40 is a potential therapeutic target for prion disease. REFERENCE 4 (bases 1 to 1527) AUTHORS Cordon-Barris L, Pascual-Guiral S, Yang S, Gimenez-Llort L, Lope-Piedrafita S, Niemeyer C, Claro E, Lizcano JM and Bayascas JR. TITLE Mutation of the 3-Phosphoinositide-Dependent Protein Kinase 1 (PDK1) Substrate-Docking Site in the Developing Brain Causes Microcephaly with Abnormal Brain Morphogenesis Independently of Akt, Leading to Impaired Cognition and Disruptive Behaviors JOURNAL Mol Cell Biol 36 (23), 2967-2982 (2016) PUBMED 27644329 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 1527) AUTHORS Rho O, Srivastava J, Cho J and DiGiovanni J. TITLE Overexpression of PRAS40(T246A) in the Proliferative Compartment Suppresses mTORC1 Signaling, Keratinocyte Migration, and Skin Tumor Development JOURNAL J Invest Dermatol 136 (10), 2070-2079 (2016) PUBMED 27349859 REMARK GeneRIF: Overexpression of PRAS40(T246A) in the Proliferative Compartment Suppresses mTORC1 Signaling, Keratinocyte Migration, and Skin Tumor Development REFERENCE 6 (bases 1 to 1527) AUTHORS Saito A, Hayashi T, Okuno S, Nishi T and Chan PH. TITLE Modulation of proline-rich akt substrate survival signaling pathways by oxidative stress in mouse brains after transient focal cerebral ischemia JOURNAL Stroke 37 (2), 513-517 (2006) PUBMED 16397181 REMARK GeneRIF: overexpression of SOD1 may affect the PRAS pathway after transient focal cerebral ischemia by reducing the direct oxidative reaction to pPRAS after reperfusion injury REFERENCE 7 (bases 1 to 1527) AUTHORS Ballif BA, Villen J, Beausoleil SA, Schwartz D and Gygi SP. TITLE Phosphoproteomic analysis of the developing mouse brain JOURNAL Mol Cell Proteomics 3 (11), 1093-1101 (2004) PUBMED 15345747 REFERENCE 8 (bases 1 to 1527) AUTHORS Saito A, Narasimhan P, Hayashi T, Okuno S, Ferrand-Drake M and Chan PH. TITLE Neuroprotective role of a proline-rich Akt substrate in apoptotic neuronal cell death after stroke: relationships with nerve growth factor JOURNAL J Neurosci 24 (7), 1584-1593 (2004) PUBMED 14973226 REMARK GeneRIF: PRAS phosphorylation and its interaction with pAkt and 14-3-3 might play an important role in neuroprotection mediated by NGF in apoptotic neuronal cell death after transient focal cerebral ischemia REFERENCE 9 (bases 1 to 1527) AUTHORS Kovacina KS, Park GY, Bae SS, Guzzetta AW, Schaefer E, Birnbaum MJ and Roth RA. TITLE Identification of a proline-rich Akt substrate as a 14-3-3 binding partner JOURNAL J Biol Chem 278 (12), 10189-10194 (2003) PUBMED 12524439 REMARK GeneRIF: The protein product encoded by 1110012J22 gene is proline-rich substrate of Akt which also binds to 14-3-3. A proposed name for this protein is thus PRAS40, for proline-rich substrate of Akt of 40 kDa. REFERENCE 10 (bases 1 to 1527) AUTHORS Chern JJ and Choi KW. TITLE Lobe mediates Notch signaling to control domain-specific growth in the Drosophila eye disc JOURNAL Development 129 (17), 4005-4013 (2002) PUBMED 12163404 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC158231.2. On May 12, 2020 this sequence version replaced XM_006541120.4. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR7345562.1662454.1, SRR11927937.4663882.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN00849375 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-63 AC158231.2 123071-123133 64-452 AC158231.2 125270-125658 453-530 AC158231.2 126479-126556 531-700 AC158231.2 126638-126807 701-1527 AC158231.2 127291-128117 FEATURES Location/Qualifiers source 1..1527 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7" gene 1..1527 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="AKT1 substrate 1" /db_xref="GeneID:67605" /db_xref="MGI:MGI:1914855" exon 1..63 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /inference="alignment:Splign:2.1.0" misc_feature 35..37 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="upstream in-frame stop codon" exon 64..452 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /inference="alignment:Splign:2.1.0" CDS 71..844 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="isoform b is encoded by transcript variant 7; proline-rich AKT1 substrate 1; proline-rich AKT substrate; AKT1 substrate 1 (proline-rich)" /codon_start=1 /product="proline-rich AKT1 substrate 1 isoform b" /protein_id="NP_001369411.1" /db_xref="GeneID:67605" /db_xref="MGI:MGI:1914855" /translation="
MASGRPEELWEAVVGAAERFQARTGTELVLLTAAPPPPPRPGPCAYAAHGRGALAEAARRCLHDIAQAHRAATATRPPGPPPAPQPPSPAPSPPPRPALAREDEEEDEDEPTETETSGERLGGSDNGGLFMMDEDATLQDLPPFCESDPESTDDGSLSEETPAGPTACPQPPATALPTQQYAKSLPVSVPVWAFKEKRTEARSSDEENGPPSSPDLDRIAASMRALVLREAEDTQVFGDLPRPRLNTSDFQKLKRKY"
misc_feature 221..223 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Omega-N-methylarginine. /evidence=ECO:0007744|PubMed:24129315; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); methylation site" misc_feature 260..613 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 332..334 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:21183079; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); phosphorylation site" misc_feature 344..346 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:21183079; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); phosphorylation site" misc_feature 419..421 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:21183079; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); phosphorylation site" misc_feature 452..826 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Proline-rich AKT1 substrate 1; Region: PRAS; pfam15798" /db_xref="CDD:406279" misc_feature 458..472 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); Region: TOS motif. /evidence=ECO:0000250|UniProtKB:Q96B36" misc_feature 620..622 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:21183079; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); phosphorylation site" misc_feature 659..721 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 677..679 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:17242355, ECO:0007744|PubMed:21183079; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); phosphorylation site" misc_feature 680..682 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:17242355, ECO:0007744|PubMed:21183079; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); phosphorylation site" misc_feature 704..706 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:17242355, ECO:0007744|PubMed:21183079; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); phosphorylation site" misc_feature 707..709 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:17242355, ECO:0007744|PubMed:21183079; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); phosphorylation site" misc_feature 734..736 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q96B36; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); phosphorylation site" misc_feature 809..811 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /note="Phosphothreonine. /evidence=ECO:0007744|PubMed:21183079; propagated from UniProtKB/Swiss-Prot (Q9D1F4.1); phosphorylation site" exon 453..530 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /inference="alignment:Splign:2.1.0" exon 531..700 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /inference="alignment:Splign:2.1.0" exon 701..1527 /gene="Akt1s1" /gene_synonym="1110012J22Rik; Lobe; Lobel; PRAS40" /inference="alignment:Splign:2.1.0" ORIGIN
agagcaggggcctctctgggctgcgggcgtggtgtagccctggtcggcggcctcacttcggtgggctcggatggcgtctgggcggccagaggaactgtgggaagccgtcgtgggggccgccgagcgctttcaggcccgcactggcacagagctggtattactgactgcagcgccaccgccgccgccccgccctggaccctgtgcctatgccgcccatggccgcggagccctggcagaggcggcccgacgctgcctccacgacatcgcacaggcgcacagggctgccactgccacccgacctcctggtcccccaccagcaccacagccgcccagccctgctcctagtccaccacctcggccagccctggccagggaggatgaggaggaagatgaggacgagcccactgaaacagagacatctggggagcggctgggcggtagcgataatggaggtctcttcatgatggatgaggatgccaccctccaggacctgccccccttctgcgagtcagacccggagagcacagacgacggcagcctgagcgaggagacgcccgccggtcccacagcctgtccccagcccccggccacagccctgcctacccagcagtatgccaagtctctgcccgtgtcggtgccagtgtgggccttcaaggagaagaggacagaagcccgatcgtcagatgaggagaatggcccgccctcctcgcccgacctagaccgaatagcggccagcatgcgcgcgctggtgctgcgggaggctgaggacacccaggtcttcggggatcttccgcggccgcggctcaataccagcgacttccagaagctgaagcggaaatattaagcgaacagaaagccttggcctgcgagaggccactgcctctcggcccagcaagagaacaattctttccgggattggctggctcaggttgggcggggccggttctaaacgctccaagggtcaactctgtttcttgcctagcaaacgaagctttgcccgcacagccttgactcgcggccccagggcggagcccagctgcgggagctgccgctgctcagccagtgtcgggaagagttgcccgccagccttccagagttcccctacccgattggtcccggcctcctgggagtgtggccaagccctccctaacccagaattggcccgaggcctttaatttcttacactactagggctgttaatcaattgtttttgtttttgttgttttctttgcctgagtcctgacaattgtatcccggttccccaggggacagtctgggtccctctctggtctgacgctccctataggttccaccgcacgacagcctgtccatcaaaacttgtcctgtacccaggacagtaccagcttcctgtcccccgaccctaacaggtgccttaaaaggccctctcccacccaaggtgggggggccaggggggcctcactttccggccctagacttgggtgcgggagagtgggatgggggtagggaggggcgctctgagattaaagttttacctctgactagtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]