LOCUS       NM_001362272            1997 bp    mRNA    linear   ROD 25-FEB-2025
DEFINITION  Mus musculus sine oculis-related homeobox 4 (Six4), transcript
            variant 2, mRNA.
ACCESSION   NM_001362272
VERSION     NM_001362272.2
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1997)
  AUTHORS   Wang,Y., Zhao,T., Chen,W.C., Zheng,Y., Xu,W. and Huang,S.
  TITLE     miR-540-3p partially recovers the locomotor function of spinal cord
            injury mice by targeting SIX4/Yap1 and inactivation of astrocytes
  JOURNAL   Neurol Res 46 (9), 823-834 (2024)
   PUBMED   38920017
  REMARK    GeneRIF: miR-540-3p partially recovers the locomotor function of
            spinal cord injury mice by targeting SIX4/Yap1 and inactivation of
            astrocytes.
REFERENCE   2  (bases 1 to 1997)
  AUTHORS   Racedo,S.E., Liu,Y., Shi,L., Zheng,D. and Morrow,B.E.
  TITLE     Dgcr8 functions in the secondary heart field for outflow tract and
            right ventricle development in mammals
  JOURNAL   Dev Biol 506, 72-84 (2024)
   PUBMED   38110169
REFERENCE   3  (bases 1 to 1997)
  AUTHORS   Wurmser,M., Madani,R., Chaverot,N., Backer,S., Borok,M., Dos
            Santos,M., Comai,G., Tajbakhsh,S., Relaix,F., Santolini,M.,
            Sambasivan,R., Jiang,R. and Maire,P.
  TITLE     Overlapping functions of SIX homeoproteins during embryonic
            myogenesis
  JOURNAL   PLoS Genet 19 (6), e1010781 (2023)
   PUBMED   37267426
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1997)
  AUTHORS   Prokopuk,L., Jarred,E.G., Blucher,R.O., McLaughlin,E.A.,
            Stringer,J.M. and Western,P.S.
  TITLE     An essential role for Polycomb Repressive Complex 2 in the mouse
            ovary
  JOURNAL   Reproduction 163 (3), 167-182 (2022)
   PUBMED   35084365
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1997)
  AUTHORS   Camolotto,S.A., Belova,V.K., Torre-Healy,L., Vahrenkamp,J.M.,
            Berrett,K.C., Conway,H., Shea,J., Stubben,C., Moffitt,R., Gertz,J.
            and Snyder,E.L.
  TITLE     Reciprocal regulation of pancreatic ductal adenocarcinoma growth
            and molecular subtype by HNF4alpha and SIX1/4
  JOURNAL   Gut 70 (5), 900-914 (2021)
   PUBMED   32826305
  REMARK    GeneRIF: Reciprocal regulation of pancreatic ductal adenocarcinoma
            growth and molecular subtype by HNF4alpha and SIX1/4.
REFERENCE   6  (bases 1 to 1997)
  AUTHORS   Niiya,A., Ohto,H., Kawakami,K. and Araki,M.
  TITLE     Localization of Six4/AREC3 in the developing mouse retina;
            implications in mammalian retinal development
  JOURNAL   Exp Eye Res 67 (6), 699-707 (1998)
   PUBMED   9990334
REFERENCE   7  (bases 1 to 1997)
  AUTHORS   Spitz,F., Demignon,J., Porteu,A., Kahn,A., Concordet,J.P.,
            Daegelen,D. and Maire,P.
  TITLE     Expression of myogenin during embryogenesis is controlled by
            Six/sine oculis homeoproteins through a conserved MEF3 binding site
  JOURNAL   Proc Natl Acad Sci U S A 95 (24), 14220-14225 (1998)
   PUBMED   9826681
REFERENCE   8  (bases 1 to 1997)
  AUTHORS   Ohto,H., Takizawa,T., Saito,T., Kobayashi,M., Ikeda,K. and
            Kawakami,K.
  TITLE     Tissue and developmental distribution of Six family gene products
  JOURNAL   Int J Dev Biol 42 (2), 141-148 (1998)
   PUBMED   9551859
REFERENCE   9  (bases 1 to 1997)
  AUTHORS   Kawakami,K., Ohto,H., Takizawa,T. and Saito,T.
  TITLE     Identification and expression of six family genes in mouse retina
  JOURNAL   FEBS Lett 393 (2-3), 259-263 (1996)
   PUBMED   8814301
REFERENCE   10 (bases 1 to 1997)
  AUTHORS   Kawakami,K., Ohto,H., Ikeda,K. and Roeder,R.G.
  TITLE     Structure, function and expression of a murine homeobox protein
            AREC3, a homologue of Drosophila sine oculis gene product, and
            implication in development
  JOURNAL   Nucleic Acids Res 24 (2), 303-310 (1996)
   PUBMED   8628654
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC159274.2.
            
            On Jul 25, 2022 this sequence version replaced NM_001362272.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR13948564.419894.1,
                                           SRR7345562.4176476.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849380
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-64                AC159274.2         103922-103985       c
            65-879              AC159274.2         102901-103715       c
            880-1997            AC159274.2         98790-99907         c
FEATURES             Location/Qualifiers
     source          1..1997
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="12"
                     /map="12 30.36 cM"
     gene            1..1997
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /note="sine oculis-related homeobox 4"
                     /db_xref="GeneID:20474"
                     /db_xref="MGI:MGI:106034"
     exon            1..64
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /inference="alignment:Splign:2.1.0"
     CDS             62..1618
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /note="isoform 2 is encoded by transcript variant 2;
                     homeobox protein SIX4; skeletal muscle-specific
                     ARE-binding protein AREC3; sine oculis-related homeobox 4
                     homolog"
                     /codon_start=1
                     /product="homeobox protein SIX4 isoform 2"
                     /protein_id="NP_001349201.1"
                     /db_xref="CCDS:CCDS88351.1"
                     /db_xref="GeneID:20474"
                     /db_xref="MGI:MGI:106034"
                     /translation="

MIASAADIKQENGMESASEGQEAHREVAGGAAAGLSPPAPAPFPLEPGDAAAASRVSREEGAAAAGAADQVQLHSELLGRHQHAAAAQPPLAFSPDHVACVCEALQQGGNLDRLARFLWSLPQSDLLRGNESLLKARALVAFHQGIYPELYSILESHSFESANHPLLQQLWYKARYTEAERARGRPLGAVDKYRLRRKFPLPRTIWDGEETVYCFKEKSRNALKELYKQNRYPSPAEKRHLAKITGLSLTQVSNWFKNRRQRDRNPSETQSKSESDGNPSTEDESSKGHEDLSPHPLSGASDGVTNLSLSSHVEPVYMQQIGNAKISLSSSGVLLNGSLVPASTSPVFLNGNSFIQGHNGVILNGLNVGNTQTVSLNPPKMSSNIVGNGIAMTDILGSTSQDVKEFKVLQSSAVNSAATTSYSPSAPVSFPGLIPCTEVKREGIQTVASQDGGSVVTFTTPVQINQYGIVQIPNSGANGQFLNGSIGFSPLQLPPVSVAASQGKSFIWYQQCTRACVG"

     misc_feature    338..667
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /note="Transcriptional regulator, SIX1, N-terminal SD
                     domain; Region: SIX1_SD; pfam16878"
                     /db_xref="CDD:465293"
     misc_feature    698..862
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(701..703,821..823,830..835,842..844)
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            65..879
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /inference="alignment:Splign:2.1.0"
     exon            880..1997
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1907..1912
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /note="hexamer: AATAAA"
     polyA_site      1930
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
     regulatory      1975..1980
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /note="hexamer: AATAAA"
     polyA_site      1997
                     /gene="Six4"
                     /gene_synonym="AREC3; TrexBF"
                     /note="major polyA site"
ORIGIN      

gttgggggaacggcagaaagcagctatccgtttacactactttgctctagcagctatcttaatgattgcaagtgcggcggacatcaagcaggagaatgggatggaaagcgcctcggaaggacaggaggcgcaccgagaagtggcggggggcgcggcggctgggctgagccccccggctccagctcctttccccctggagccgggggacgccgcggctgcctccagggtaagccgggaggaaggggcagcggcggcgggagcggcagatcaggtacaactccactcggaacttctgggcaggcaccagcacgcagccgccgcgcagcccccactggccttctcgccggaccatgtcgcctgcgtgtgcgaggcgttgcagcaggggggcaacctggaccgcctggcccggtttctttggtccctgccccagagcgatctgctacgtggcaacgagagccttctgaaggcgcgagcgctcgtggccttccaccagggcatctaccctgagttgtacagcatcctcgagagccacagcttcgagtcggccaaccatccgctgctgcagcagctctggtacaaggcgcgctacaccgaggccgagcgagcgcgcggccggccgctgggcgccgtggacaagtaccggctgcgcaggaaattccccttgccccgcaccatctgggacggcgaggagacggtgtattgtttcaaggagaagtcgcgcaacgcgctcaaggagctctacaagcagaatcgctacccctcgccggctgagaagcggcacctggccaagatcaccggcctctccctcacccaggtcagcaactggttcaagaaccggcggcagcgtgaccgaaacccctccgagacccagtccaaaagcgaatcggatggcaaccccagtaccgaggatgaatccagcaagggacatgaggatttgtctcctcatccactttcaggcgcatctgatggcgtcaccaacctcagcctctctagccacgtggagccagtatatatgcaacaaattggaaatgctaagatatcactaagctcgtctggagttttgttgaatggaagcttagtacctgcaagtacttcacctgtcttccttaatggcaattcttttattcagggacacaatggagttatccttaatggactgaatgtgggaaatacacagacagtgtcactgaacccacccaaaatgtcttcaaacattgtgggcaatggcatagccatgacagacatcctgggatctacctcccaggatgtgaaagaattcaaagtcctccagagttctgctgtgaactcagcagccaccacctcctacagccctagtgcccctgtgtcattcccagggctgataccctgcactgaagtgaaaagagaaggcattcagacagtggcctcccaggacggtggctctgtggtgacttttactacacccgtgcaaattaaccagtatggcattgtccagatccctaattctggagccaacggccagttccttaatgggagcattggattctctccactgcagctgcctcctgtctcagtagcagcttcacaaggtaaaagcttcatttggtaccagcaatgcaccagggcatgtgttggttagttgctgtaaatgacaggtttagtgaaagctatagatccgtgttattgtccagatacatcattggtttacacagttacagaacagccgtgatgtgtttcccagtacctaaatactatccagcttgcctgactttcttacatcctggggaatggcgttttatcttcccccaaacagaatggaaaagtaccgtttctagcagaccttgccaactctacaattataggaatatggcaagtcaatcagtgcttataaaataacccagtacttgacgttttaaaattaaaaattaataaaattgctaggaacataaaattagtcaagcagttctttatttgaccagaagacgttttaaaaagaataaactaaaagacagaatgta

//