2025-09-13 16:41:23, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_001317729 5156 bp mRNA linear ROD 07-JAN-2025 DEFINITION Mus musculus aquaporin 4 (Aqp4), transcript variant 1, mRNA. ACCESSION NM_001317729 VERSION NM_001317729.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 5156) AUTHORS Ide,H., Miike,K., Ohmori,T., Maruyama,K., Izumi,Y., Tanigawa,S. and Nishinakamura,R. TITLE Mouse embryonic kidney transplantation identifies maturation defects in the medulla JOURNAL Sci Rep 14 (1), 30293 (2024) PUBMED 39639083 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 5156) AUTHORS Xing,X. and Zhang,S. TITLE Neuroprotective Role of AQP4 Knockdown in Astrocytes After Oxygen-Glucose Deprivation JOURNAL Brain Behav 14 (10), e70107 (2024) PUBMED 39444081 REMARK GeneRIF: Neuroprotective Role of AQP4 Knockdown in Astrocytes After Oxygen-Glucose Deprivation. REFERENCE 3 (bases 1 to 5156) AUTHORS Loughran,G., Chou,M.Y., Ivanov,I.P., Jungreis,I., Kellis,M., Kiran,A.M., Baranov,P.V. and Atkins,J.F. TITLE Evidence of efficient stop codon readthrough in four mammalian genes JOURNAL Nucleic Acids Res 42 (14), 8928-8938 (2014) PUBMED 25013167 REFERENCE 4 (bases 1 to 5156) AUTHORS Badaut,J., Ashwal,S., Adami,A., Tone,B., Recker,R., Spagnoli,D., Ternon,B. and Obenaus,A. TITLE Brain water mobility decreases after astrocytic aquaporin-4 inhibition using RNA interference JOURNAL J Cereb Blood Flow Metab 31 (3), 819-831 (2011) PUBMED 20877385 REMARK GeneRIF: results demonstrate that apparent diffusion coefficient values in normal brain are modulated by astrocytic AQP4; suggest imaging changes seen in acute neurologic disorders such as stroke and trauma are in part due to changes in tissue AQP4 levels REFERENCE 5 (bases 1 to 5156) AUTHORS Beier,H. and Grimm,M. TITLE Misreading of termination codons in eukaryotes by natural nonsense suppressor tRNAs JOURNAL Nucleic Acids Res 29 (23), 4767-4782 (2001) PUBMED 11726686 REMARK Review article REFERENCE 6 (bases 1 to 5156) AUTHORS Zelenin,S., Gunnarson,E., Alikina,T., Bondar,A. and Aperia,A. TITLE Identification of a new form of AQP4 mRNA that is developmentally expressed in mouse brain JOURNAL Pediatr Res 48 (3), 335-339 (2000) PUBMED 10960499 REFERENCE 7 (bases 1 to 5156) AUTHORS Ishida,N., Hirai,S.I. and Mita,S. TITLE Immunolocalization of aquaporin homologs in mouse lacrimal glands JOURNAL Biochem Biophys Res Commun 238 (3), 891-895 (1997) PUBMED 9325187 REFERENCE 8 (bases 1 to 5156) AUTHORS Ma,T., Yang,B., Gillespie,A., Carlson,E.J., Epstein,C.J. and Verkman,A.S. TITLE Generation and phenotype of a transgenic knockout mouse lacking the mercurial-insensitive water channel aquaporin-4 JOURNAL J Clin Invest 100 (5), 957-962 (1997) PUBMED 9276712 REFERENCE 9 (bases 1 to 5156) AUTHORS Turtzo,L.C., Lee,M.D., Lu,M., Smith,B.L., Copeland,N.G., Gilbert,D.J., Jenkins,N.A. and Agre,P. TITLE Cloning and chromosomal localization of mouse aquaporin 4: exclusion of a candidate mutant phenotype, ataxia JOURNAL Genomics 41 (2), 267-270 (1997) PUBMED 9143504 REFERENCE 10 (bases 1 to 5156) AUTHORS Ma,T., Yang,B. and Verkman,A.S. TITLE Gene structure, cDNA cloning, and expression of a mouse mercurial-insensitive water channel JOURNAL Genomics 33 (3), 382-388 (1996) PUBMED 8660998 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF469168.1, U88623.1, AK045357.1, BX633380.1, AK079614.1, BB750519.1 and AC133525.2. Summary: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]. Transcript Variant: This variant (1, also known as AQP4.M1 or mMIWC2) represents the predominant transcript and encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (M1) results from translation termination at the upstream UGA stop codon, while the longer isoform (M1x) results from UGA stop codon readthrough to the downstream UAA termination codon. This RefSeq represents the longer, C-terminally extended isoform (M1x). As the UGA stop codon has been reported to specify several alternative amino acids (tryptophan, cysteine, arginine and serine), its location in the longer isoform is denoted by an 'X'. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF469168.1, SRR11927938.3735963.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN01164131 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## stop codon readthrough :: inferred from conservation ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-261 AF469168.1 1-261 262-1174 U88623.1 189-1101 1175-2024 AK045357.1 752-1601 2025-2025 BX633380.1 202-202 c 2026-3897 AK045357.1 1602-3473 3898-5054 AK079614.1 167-1323 5055-5150 BB750519.1 317-412 5151-5156 AC133525.2 180919-180924 c FEATURES Location/Qualifiers source 1..5156 /organism="Mus musculus" /mol_type="mRNA" /db_xref="taxon:10090" /chromosome="18" /map="18 8.74 cM" gene 1..5156 /gene="Aqp4" /gene_synonym="WCH4" /note="aquaporin 4" /db_xref="GeneID:11829" /db_xref="MGI:MGI:107387" exon 1..159 /gene="Aqp4" /gene_synonym="WCH4" /inference="alignment:Splign:2.1.0" misc_feature 62..64 /gene="Aqp4" /gene_synonym="WCH4" /note="upstream in-frame stop codon" CDS 128..1186 /gene="Aqp4" /gene_synonym="WCH4" /note="isoform M1x is encoded by transcript variant 1; mercurial-insensitive water channel" /codon_start=1 /transl_except=(pos:1097..1099,aa:OTHER) /product="aquaporin-4 isoform M1x" /protein_id="NP_001304658.1" /db_xref="GeneID:11829" /db_xref="MGI:MGI:107387" /translation="
MSDRAAARRWGKCGHSCSRESIMVAFKGVWTQAFWKAVSAEFLATLIFVLLGVGSTINWGGSENPLPVDMVLISLCFGLSIATMVQCFGHISGGHINPAVTVAMVCTRKISIAKSVFYIIAQCLGAIIGAGILYLVTPPSVVGGLGVTTVHGNLTAGHGLLVELIITFQLVFTIFASCDSKRTDVTGSIALAIGFSVAIGHLFAINYTGASMNPARSFGPAVIMGNWANHWIYWVGPIMGAVLAGALYEYVFCPDVELKRRLKEAFSKAAQQTKGSYMEVEDNRSQVETEDLILKPGVVHVIDIDRGEEKKGKDSSGEVLSSVXLEDSTEGRRDSLDLASDFLPPIKETDLL"
misc_feature 194..196 /gene="Aqp4" /gene_synonym="WCH4" /note="Region: alternative AUG translation initiation site" misc_feature 218..871 /gene="Aqp4" /gene_synonym="WCH4" /note="Major intrinsic protein; Region: MIP; pfam00230" /db_xref="CDD:395174" misc_feature order(356..358,410..418,752..757,764..766,773..775) /gene="Aqp4" /gene_synonym="WCH4" /note="amphipathic channel [active]" /db_xref="CDD:238204" misc_feature order(416..424,764..772) /gene="Aqp4" /gene_synonym="WCH4" /note="Asn-Pro-Ala signature motifs; other site" /db_xref="CDD:238204" exon 160..574 /gene="Aqp4" /gene_synonym="WCH4" /inference="alignment:Splign:2.1.0" exon 575..739 /gene="Aqp4" /gene_synonym="WCH4" /inference="alignment:Splign:2.1.0" exon 740..820 /gene="Aqp4" /gene_synonym="WCH4" /inference="alignment:Splign:2.1.0" exon 821..5156 /gene="Aqp4" /gene_synonym="WCH4" /inference="alignment:Splign:2.1.0" misc_feature 1097..1099 /gene="Aqp4" /gene_synonym="WCH4" /note="upstream translation termination codon, use of which results in the shorter isoform M1" regulatory 1100..1103 /regulatory_class="recoding_stimulatory_region" /gene="Aqp4" /gene_synonym="WCH4" /note="stop_codon_readthrough_signal" /function="stimulates stop codon readthrough" regulatory 5036..5041 /regulatory_class="polyA_signal_sequence" /gene="Aqp4" /gene_synonym="WCH4" /note="hexamer: ATTAAA" polyA_site 5054 /gene="Aqp4" /gene_synonym="WCH4" /note="major polyA site" ORIGIN
gccacatggtgcagaatctttccacccctactctccaaaaacccaatcagacaagtgcccgtaatctgactcccagtgtactggagcccgggggcaggcactgagctgcactctggccagggaaggcatgagtgacagagctgcggcaaggcggtggggtaagtgtggacattcctgcagtagagagagcatcatggtggctttcaaaggagtctggactcaggctttctggaaggcagtctcagcagaatttctggccacgcttatctttgttttgctcggtgtgggatccaccataaactggggtggctcagaaaaccccttacctgtggacatggtcctcatctccctttgctttggactcagcattgctaccatggtgcagtgctttggccacatcagtggtggccacatcaatcccgctgtgactgtagccatggtgtgcacacgaaagatcagcatcgctaagtccgtcttctacatcattgcacagtgcctgggggccatcattggagccggcatcctctacctggtcacacctcccagtgtggttggaggattgggagtcaccacggttcatggaaacctcaccgctggccatgggctcctggtggagttaataatcactttccagttggtgttcactatttttgccagctgtgattccaaacgaactgatgttactggttcaatagctttagcaattggattttccgttgcaattggacatttgtttgcaatcaattatactggagccagcatgaatccagctcgatcttttggacccgcagttatcatgggaaactgggcaaaccactggatatattgggttggaccaatcatgggcgctgtgctggcaggtgccctttatgagtatgtcttctgtcctgatgtggagctcaaacgtcgccttaaggaagccttcagcaaagccgcgcagcagacaaaagggagctacatggaggtggaggacaaccggagccaagtggagacggaagacttgatcctgaagcccggagtggtgcatgtgattgacattgaccgtggagaagagaagaaggggaaagactcttcgggagaggtattgtcttccgtatgactagaggacagcactgaaggcagaagagactccctagacctggcctcagatttcctgccacccattaaggaaacagatttgttataaattagacacttgcgggtttcttgcttcacaccttgttacacagtttaaataacacatattttactattatcaatggggggggtgagaaaaagcctataatggatataaaattttaaaacagaaatctttttgaatgtatccccaaagcaactatgcaactagtgtattggcttccctttcattaataactgaaattatgaaccaagatctggtcaagttttgccgtgcagagcatatggacacctctgtgaggaagctggcattgtccatcgtcttgactattgacttcattggattgatttaaaaatgacaaaatgcagtatgtcacagaatcatgtgcattcaggagaagacatgcagtaacttcttccacgagctattccttatttataaactacctcggagggggaaaacattagcaagggccattgctaatacatcatttgtatttatatatctgactgtcagaacctaactctaattcactataatcctctccccctcagaatccaagaacccatagggctaaaagtaaaaaaaaaataggaaaaaatattaatttctgtccatgtgttagttccatcaaatgaaagctatacatgggacacccattgaggttcaggacagccagacttgggagtctggtgggaggtggaacaaggtgtgctactgccttgcatccatcacacggagagggaaacctctgttatcaaatgattggtctgttttcagtgcacactcttaaatgtaccacaaaccattaaccacctaagcttttaactatttcactgactttttaaagcttatttgcaaaactggggaatttgtttgccattttgatccctaaatactagcagagacattttagaccagaacttgactagtcgagtcctgacttttagttggtgtctaaatcctgcttactctagctggtataaaccagtcctgccccatcttagctgctgatgctgttttgattcccacgatatgcatcgacaatcggcattgtgagtgtaattatacccatttgtgtgaattaaaatatatgcagacaaggtgcaacgtggttgccaaataaaggggtgagcacacagcctctgtgcaaagctcctagttaccccatctgcacatagcttaccatcatgcttttaaggtatttacctcctgcttggtttatttgttaaaaccatttatttctcccatactgctttgccttccgcccatcgaatgctctgtggaaaccccagtttctatgatcataacagtctagcatagcatttatcttagacaatgtgctgcaaatgtcgatttcagtaaacaaaagttagtagtggaagagagaagagccatttcttcaaggactagcttgtaaatagctggtaatggagggctttcttctcccaagcacaattccaactgtgtgtgacttcttattgttaatggcagttttgtgtctgtggcagcgagataatggaccactattaaacctgattctcttcggtgctaggaaactgatgtgtgagttcccagaaaggcacgagggcagcatatgcctctcggtgccatggtcatgttctgaggcagatgctgggagcatgggccacatttcagggctttgaatatactacaccagagacataagcttcctctctgagcagatcacgcagaaccagggcatagacctcccaggggaggtttctgccgattctttcaaatgttttcacaatataccacgcagacttaagatcagagcgcttcagttcggaaggtgatatcaaccatcaacaaatatgtcgggtcaaaaataaatttacttaacaaggaatagttaagcacatttctgattactctttcaaaatcctggcctgtgattatttttattatgctagacagcttgcttcgtttgtgctcactttaacagtcatttccagtgacagcattcagtatggtacaaactgaaaaacagggaatcatagcttagtgatttgtttgctagcagctggcagagtgccaggcacacagtaggcaatcaaaacaagcatgttgtttgaatatatatacatatatacatatatacatatatacatatatacatatatgtgtatatatgattcttatttgggatttaaaataccaataatctcctctaatttttaattttgcccaatatttagtgaaaacataatttttagtgtcatcaataaaagcaacatggacttggaaacaaagagcatatttttacattctactgtttgaaggcagagagtgactacttcacactcttcgtctttgcaatatgtcttgcatttcactcacggctctgccagtaaaaaatgtaatgaaattgtccctttctaatgacatcgatgcagcaggggtctattgccttgtggatgacaccaaattatacaacatattaggagatcggggattttccctttaatcccttcttattaatgaagtgcatagtgccgttcccaagagacagctactgacagatacaccgcacagagatcagagaggaaaaatcaggaagacataaaagatttatacgagccatgaaacaatgccaactgtctgttccctcaggaggagaacacagacacaccacaaatttcaaggtggtccatacactggaaatgtacatacatagtctgtcaaaggagaacagaaggaaatcttttttttttaattttgagcattttttttttcaaatcagagactctgatttttaaatgtgtgtttccattttcttccaaatgttctacccttttatactacaagaaactgtttcctgtagcctaagtcactggtaattttacaacttgttcctgtgatttgccactatcatgagtcctcttccgttcgatcttcagaggggtgtcccaccacagctcggacactgctggccacagctgctccctgatgaagatttcataaggagttggtagtctctgggaaatgggctgatatattagaggtcaatttcaaaaactgcaacatttctcctaggagaatccaggcaatgtgtgcactgctctaaccccactgagaaccctgacatctcaaaatgaagggactaattaaaatggtggcattggtccttgcctggcctttgttgtgtgatgttgacaccttcctcatagatcagaaatctcacagagacactgcctctgtgacaattgaagccagagagccaaacagacaatcttacaaaagccatgagacgctctaatcactaaactacaggatacgtgaacttggaattgtgcaagcatggcctctacttgaaagtggactataacaaaagaaactttatttacctcaacttttctgagttcatgtccaggtgtcaatacttttcagcacaccttaactaacacaaatatttgaaatccaaaattctcagaaagaaatgttaagacgcttaacttcaaaaatcaaaaattgcggatattcacttttggcacataacttccctgaaaacacacaccaaacaaatattaaacaacacatacagtgaacactacatttaagagcagttatattgttactgttttaagtcaaaattcaagagcttaaaaaatgcccaacatatatattccattgcaatgtattcttagattgttttcaggcttgatcaaataaacatggaatttgtggaaatatattttaaaaatctatttatcattttctctcccaattcacaattaacttgcgacttatgaggaactaaaaaaataaaatgaatgcctggttatattcacatttattaactaaatattattccaactttagagttaatgttaaatggatttgaactgtaatggctaatatttggaaaaatctattaaaagtattagcagtgtggctgggttctgtttcttgtgttatatgtcatactattagtatcatacaattaagtcttcaaatgttttaaaaataaaccatatatttgatggtgtttaag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]