GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-01-18 09:42:36, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_001308643            5218 bp    mRNA    linear   ROD 12-AUG-2025
DEFINITION  Mus musculus aquaporin 4 (Aqp4), transcript variant 5, mRNA.
ACCESSION   NM_001308643 XM_011246815
VERSION     NM_001308643.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 5218)
  AUTHORS   Lin,S., Dieterich,C., Britto-Borges,T., Gunther,S., Kreher,S.,
            Eibach,Y., Kuenne,C., Schneider,A. and Braun,T.
  TITLE     Rbpms2 prevents major cardiac defects in cardiomyocyte-specific
            Rbpms-deficient mice
  JOURNAL   Dev Cell (2025) In press
   PUBMED   40602408
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 5218)
  AUTHORS   Parvez,R.K., Csipan,R.L., Liu,J., Gevorgyan,A., Rutledge,E.A.,
            Guo,J., Kim,D.K. and McMahon,A.P.
  TITLE     Developmental and Cell Fate Analyses Support a Postnatal Origin for
            the Cortical Collecting System in the Mouse Kidney
  JOURNAL   J Am Soc Nephrol 36 (5), 812-824 (2025)
   PUBMED   39665296
REFERENCE   3  (bases 1 to 5218)
  AUTHORS   Loughran,G., Chou,M.Y., Ivanov,I.P., Jungreis,I., Kellis,M.,
            Kiran,A.M., Baranov,P.V. and Atkins,J.F.
  TITLE     Evidence of efficient stop codon readthrough in four mammalian
            genes
  JOURNAL   Nucleic Acids Res 42 (14), 8928-8938 (2014)
   PUBMED   25013167
REFERENCE   4  (bases 1 to 5218)
  AUTHORS   Badaut,J., Ashwal,S., Adami,A., Tone,B., Recker,R., Spagnoli,D.,
            Ternon,B. and Obenaus,A.
  TITLE     Brain water mobility decreases after astrocytic aquaporin-4
            inhibition using RNA interference
  JOURNAL   J Cereb Blood Flow Metab 31 (3), 819-831 (2011)
   PUBMED   20877385
  REMARK    GeneRIF: results demonstrate that apparent diffusion coefficient
            values in normal brain are modulated by astrocytic AQP4; suggest
            imaging changes seen in acute neurologic disorders such as stroke
            and trauma are in part due to changes in tissue AQP4 levels
REFERENCE   5  (bases 1 to 5218)
  AUTHORS   Beier,H. and Grimm,M.
  TITLE     Misreading of termination codons in eukaryotes by natural nonsense
            suppressor tRNAs
  JOURNAL   Nucleic Acids Res 29 (23), 4767-4782 (2001)
   PUBMED   11726686
  REMARK    Review article
REFERENCE   6  (bases 1 to 5218)
  AUTHORS   Zelenin,S., Gunnarson,E., Alikina,T., Bondar,A. and Aperia,A.
  TITLE     Identification of a new form of AQP4 mRNA that is developmentally
            expressed in mouse brain
  JOURNAL   Pediatr Res 48 (3), 335-339 (2000)
   PUBMED   10960499
REFERENCE   7  (bases 1 to 5218)
  AUTHORS   Ishida,N., Hirai,S.I. and Mita,S.
  TITLE     Immunolocalization of aquaporin homologs in mouse lacrimal glands
  JOURNAL   Biochem Biophys Res Commun 238 (3), 891-895 (1997)
   PUBMED   9325187
REFERENCE   8  (bases 1 to 5218)
  AUTHORS   Ma,T., Yang,B., Gillespie,A., Carlson,E.J., Epstein,C.J. and
            Verkman,A.S.
  TITLE     Generation and phenotype of a transgenic knockout mouse lacking the
            mercurial-insensitive water channel aquaporin-4
  JOURNAL   J Clin Invest 100 (5), 957-962 (1997)
   PUBMED   9276712
REFERENCE   9  (bases 1 to 5218)
  AUTHORS   Turtzo,L.C., Lee,M.D., Lu,M., Smith,B.L., Copeland,N.G.,
            Gilbert,D.J., Jenkins,N.A. and Agre,P.
  TITLE     Cloning and chromosomal localization of mouse aquaporin 4:
            exclusion of a candidate mutant phenotype, ataxia
  JOURNAL   Genomics 41 (2), 267-270 (1997)
   PUBMED   9143504
REFERENCE   10 (bases 1 to 5218)
  AUTHORS   Ma,T., Yang,B. and Verkman,A.S.
  TITLE     Gene structure, cDNA cloning, and expression of a mouse
            mercurial-insensitive water channel
  JOURNAL   Genomics 33 (3), 382-388 (1996)
   PUBMED   8660998
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC133525.2.
            
            On May 15, 2015 this sequence version replaced XM_011246815.1.
            
            Summary: This gene encodes a member of the aquaporin family of
            intrinsic membrane proteins that function as water-selective
            channels in the plasma membranes of many cells. This protein is the
            predominant aquaporin found in brain and has an important role in
            brain water homeostasis. Alternatively spliced transcript variants
            encoding different isoforms have been described for this gene. A
            recent study provided evidence for translational readthrough in
            this gene and expression of an additional C-terminally extended
            isoform via the use of an alternative in-frame translation
            termination codon. [provided by RefSeq, Dec 2015].
            
            Transcript Variant: This variant (5, also known as ab/1) contains
            alternate exons at the 5' end, which cause translation initiation
            from an in-frame, downstream start codon, compared to variant 1.
            The resulting isoform (M23, also known as M23A) has a shorter
            N-terminus compared to isoform 1. Variants 2-8 encode the same
            isoform.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY484966.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMN00849374,
                                           SAMN00849375 [ECO:0006172]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-91                AC133525.2         202417-202507       c
            92-221              AC133525.2         200803-200932       c
            222-636             AC133525.2         191113-191527       c
            637-801             AC133525.2         189616-189780       c
            802-882             AC133525.2         189104-189184       c
            883-5218            AC133525.2         180919-185254       c
FEATURES             Location/Qualifiers
     source          1..5218
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="18"
                     /map="18 8.74 cM"
     gene            1..5218
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="aquaporin 4"
                     /db_xref="GeneID:11829"
                     /db_xref="MGI:MGI:107387"
     exon            1..91
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     exon            92..221
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    172..174
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="upstream in-frame stop codon"
     exon            222..636
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     CDS             256..1161
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="isoform M23 is encoded by transcript variant 5;
                     mercurial-insensitive water channel"
                     /codon_start=1
                     /product="aquaporin-4 isoform M23"
                     /protein_id="NP_001295572.1"
                     /db_xref="CCDS:CCDS89196.1"
                     /db_xref="GeneID:11829"
                     /db_xref="MGI:MGI:107387"
                     /translation="
MVAFKGVWTQAFWKAVSAEFLATLIFVLLGVGSTINWGGSENPLPVDMVLISLCFGLSIATMVQCFGHISGGHINPAVTVAMVCTRKISIAKSVFYIIAQCLGAIIGAGILYLVTPPSVVGGLGVTTVHGNLTAGHGLLVELIITFQLVFTIFASCDSKRTDVTGSIALAIGFSVAIGHLFAINYTGASMNPARSFGPAVIMGNWANHWIYWVGPIMGAVLAGALYEYVFCPDVELKRRLKEAFSKAAQQTKGSYMEVEDNRSQVETEDLILKPGVVHVIDIDRGEEKKGKDSSGEVLSSV"
     misc_feature    280..933
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="Major intrinsic protein; Region: MIP; pfam00230"
                     /db_xref="CDD:395174"
     misc_feature    order(418..420,472..480,814..819,826..828,835..837)
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="amphipathic channel [active]"
                     /db_xref="CDD:238204"
     misc_feature    order(478..486,826..834)
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="Asn-Pro-Ala signature motifs; other site"
                     /db_xref="CDD:238204"
     exon            637..801
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     exon            802..882
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     exon            883..5218
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /inference="alignment:Splign:2.1.0"
     regulatory      5098..5103
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="hexamer: ATTAAA"
     polyA_site      5116
                     /gene="Aqp4"
                     /gene_synonym="WCH4"
                     /note="major polyA site"
ORIGIN      
cacaagacctttgctctgggcatcctgtcacaacacacaacatcagcacacactgcccaacgttagctcacgtggaggattatactgtgtcctgccgaaggagctcaacagcaataatactgagcatgtgcaccagcgggcttcttcactcacacttgcaccattcagaaataggctgctacctcaaactcctttttgcctgtttccagcgtattaacaagtaagtgtggacattcctgcagtagagagagcatcatggtggctttcaaaggagtctggactcaggctttctggaaggcagtctcagcagaatttctggccacgcttatctttgttttgctcggtgtgggatccaccataaactggggtggctcagaaaaccccttacctgtggacatggtcctcatctccctttgctttggactcagcattgctaccatggtgcagtgctttggccacatcagtggtggccacatcaatcccgctgtgactgtagccatggtgtgcacacgaaagatcagcatcgctaagtccgtcttctacatcattgcacagtgcctgggggccatcattggagccggcatcctctacctggtcacacctcccagtgtggttggaggattgggagtcaccacggttcatggaaacctcaccgctggccatgggctcctggtggagttaataatcactttccagttggtgttcactatttttgccagctgtgattccaaacgaactgatgttactggttcaatagctttagcaattggattttccgttgcaattggacatttgtttgcaatcaattatactggagccagcatgaatccagctcgatcttttggacccgcagttatcatgggaaactgggcaaaccactggatatattgggttggaccaatcatgggcgctgtgctggcaggtgccctttatgagtatgtcttctgtcctgatgtggagctcaaacgtcgccttaaggaagccttcagcaaagccgcgcagcagacaaaagggagctacatggaggtggaggacaaccggagccaagtggagacggaagacttgatcctgaagcccggagtggtgcatgtgattgacattgaccgtggagaagagaagaaggggaaagactcttcgggagaggtattgtcttccgtatgactagaggacagcactgaaggcagaagagactccctagacctggcctcagatttcctgccacccattaaggaaacagatttgttataaattagacacttgcgggtttcttgcttcacaccttgttacacagtttaaataacacatattttactattatcaatggggggggtgagaaaaagcctataatggatataaaattttaaaacagaaatctttttgaatgtatccccaaagcaactatgcaactagtgtattggcttccctttcattaataactgaaattatgaaccaagatctggtcaagttttgccgtgcagagcatatggacacctctgtgaggaagctggcattgtccatcgtcttgactattgacttcattggattgatttaaaaatgacaaaatgcagtatgtcacagaatcatgtgcattcaggagaagacatgcagtaacttcttccacgagctattccttatttataaactacctcggagggggaaaacattagcaagggccattgctaatacatcatttgtatttatatatctgactgtcagaacctaactctaattcactataatcctctccccctcagaatccaagaacccatagggctaaaagtaaaaaaaaaataggaaaaaatattaatttctgtccatgtgttagttccatcaaatgaaagctatacatgggacacccattgaggttcaggacagccagacttgggagtctggtgggaggtggaacaaggtgtgctactgccttgcatccatcacacggagagggaaacctctgttatcaaatgattggtctgttttcagtgcacactcttaaatgtaccacaaaccattaaccacctaagcttttaactatttcactgactttttaaagcttatttgcaaaactggggaatttgtttgccattttgatccctaaatactagcagagacattttagaccagaacttgactagtcgagtcctgacttttagttggtgtctaaatcctgcttactctagctggtataaaccagtcctgccccatcttagctgctgatgctgttttgattcccacgatatgcatcgacaatcggcattgtgagtgtaattatacccatttgtgtgaattaaaatatatgcagacaaggtgcaacgtggttgccaaataaaggggtgagcacacagcctctgtgcaaagctcctagttaccccatctgcacatagcttaccatcatgcttttaaggtatttacctcctgcttggtttatttgttaaaaccatttatttctcccatactgctttgccttccgcccatcgaatgctctgtggaaaccccagtttctatgatcataacagtctagcatagcatttatcttagacaatgtgctgcaaatgtcgatttcagtaaacaaaagttagtagtggaagagagaagagccatttcttcaaggactagcttgtaaatagctggtaatggagggctttcttctcccaagcacaattccaactgtgtgtgacttcttattgttaatggcagttttgtgtctgtggcagcgagataatggaccactattaaacctgattctcttcggtgctaggaaactgatgtgtgagttcccagaaaggcacgagggcagcatatgcctctcggtgccatggtcatgttctgaggcagatgctgggagcatgggccacatttcagggctttgaatatactacaccagagacataagcttcctctctgagcagatcacgcagaaccagggcatagacctcccaggggaggtttctgccgattctttcaaatgttttcacaatataccacgcagacttaagatcagagcgcttcagttcggaaggtgatatcaaccatcaacaaatatgtcgggtcaaaaataaatttacttaacaaggaatagttaagcacatttctgattactctttcaaaatcctggcctgtgattatttttattatgctagacagcttgcttcgtttgtgctcactttaacagtcatttccagtgacagcattcagtatggtacaaactgaaaaacagggaatcatagcttagtgatttgtttgctagcagctggcagagtgccaggcacacagtaggcaatcaaaacaagcatgttgtttgaatatatatacatatatacatatatacatatatacatatatacatatatgtgtatatatgattcttatttgggatttaaaataccaataatctcctctaatttttaattttgcccaatatttagtgaaaacataatttttagtgtcatcaataaaagcaacatggacttggaaacaaagagcatatttttacattctactgtttgaaggcagagagtgactacttcacactcttcgtctttgcaatatgtcttgcatttcactcacggctctgccagtaaaaaatgtaatgaaattgtccctttctaatgacatcgatgcagcaggggtctattgccttgtggatgacaccaaattatacaacatattaggagatcggggattttccctttaatcccttcttattaatgaagtgcatagtgccgttcccaagagacagctactgacagatacaccgcacagagatcagagaggaaaaatcaggaagacataaaagatttatacgagccatgaaacaatgccaactgtctgttccctcaggaggagaacacagacacaccacaaatttcaaggtggtccatacactggaaatgtacatacatagtctgtcaaaggagaacagaaggaaatcttttttttttaattttgagcattttttttttcaaatcagagactctgatttttaaatgtgtgtttccattttcttccaaatgttctacccttttatactacaagaaactgtttcctgtagcctaagtcactggtaattttacaacttgttcctgtgatttgccactatcatgagtcctcttccgttcgatcttcagaggggtgtcccaccacagctcggacactgctggccacagctgctccctgatgaagatttcataaggagttggtagtctctgggaaatgggctgatatattagaggtcaatttcaaaaactgcaacatttctcctaggagaatccaggcaatgtgtgcactgctctaaccccactgagaaccctgacatctcaaaatgaagggactaattaaaatggtggcattggtccttgcctggcctttgttgtgtgatgttgacaccttcctcatagatcagaaatctcacagagacactgcctctgtgacaattgaagccagagagccaaacagacaatcttacaaaagccatgagacgctctaatcactaaactacaggatacgtgaacttggaattgtgcaagcatggcctctacttgaaagtggactataacaaaagaaactttatttacctcaacttttctgagttcatgtccaggtgtcaatacttttcagcacaccttaactaacacaaatatttgaaatccaaaattctcagaaagaaatgttaagacgcttaacttcaaaaatcaaaaattgcggatattcacttttggcacataacttccctgaaaacacacaccaaacaaatattaaacaacacatacagtgaacactacatttaagagcagttatattgttactgttttaagtcaaaattcaagagcttaaaaaatgcccaacatatatattccattgcaatgtattcttagattgttttcaggcttgatcaaataaacatggaatttgtggaaatatattttaaaaatctatttatcattttctctcccaattcacaattaacttgcgacttatgaggaactaaaaaaataaaatgaatgcctggttatattcacatttattaactaaatattattccaactttagagttaatgttaaatggatttgaactgtaatggctaatatttggaaaaatctattaaaagtattagcagtgtggctgggttctgtttcttgtgttatatgtcatactattagtatcatacaattaagtcttcaaatgttttaaaaataaaccatatatttgatggtgtttaag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]