LOCUS       NM_001033922            1730 bp    mRNA    linear   ROD 12-NOV-2023
DEFINITION  Mus musculus triggering receptor expressed on myeloid cells-like 4
            (Treml4), transcript variant 1, mRNA.
ACCESSION   NM_001033922
VERSION     NM_001033922.2
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1730)
  AUTHORS   Nedeva C, Menassa J, Duan M, Liu C, Doerflinger M, Kueh AJ, Herold
            MJ, Fonseka P, Phan TK, Faou P, Rajapaksha H, Chen W, Hulett MD and
            Puthalakath H.
  TITLE     TREML4 receptor regulates inflammation and innate immune cell death
            during polymicrobial sepsis
  JOURNAL   Nat Immunol 21 (12), 1585-1596 (2020)
   PUBMED   33020659
REFERENCE   2  (bases 1 to 1730)
  AUTHORS   Gonzalez-Cotto M, Guo L, Karwan M, Sen SK, Barb J, Collado CJ,
            Elloumi F, Palmieri EM, Boelte K, Kolodgie FD, Finn AV, Biesecker
            LG and McVicar DW.
  TITLE     TREML4 Promotes Inflammatory Programs in Human and Murine
            Macrophages and Alters Atherosclerosis Lesion Composition in the
            Apolipoprotein E Deficient Mouse
  JOURNAL   Front Immunol 11, 397 (2020)
   PUBMED   32292401
  REMARK    GeneRIF: TREML4 Promotes Inflammatory Programs in Human and Murine
            Macrophages and Alters Atherosclerosis Lesion Composition in the
            Apolipoprotein E Deficient Mouse.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1730)
  AUTHORS   Ramirez-Ortiz ZG, Prasad A, Griffith JW, Pendergraft WF 3rd, Cowley
            GS, Root DE, Tai M, Luster AD, El Khoury J, Hacohen N and Means TK.
  TITLE     The receptor TREML4 amplifies TLR7-mediated signaling during
            antiviral responses and autoimmunity
  JOURNAL   Nat Immunol 16 (5), 495-504 (2015)
   PUBMED   25848864
  REMARK    GeneRIF: positive regulator of TLR7 signaling that controls
            antiviral immunity and the development of autoimmunity
REFERENCE   4  (bases 1 to 1730)
  AUTHORS   Hemmi H, Zaidi N, Wang B, Matos I, Fiorese C, Lubkin A, Zbytnuik L,
            Suda K, Zhang K, Noda M, Kaisho T, Steinman RM and Idoyaga J.
  TITLE     Treml4, an Ig superfamily member, mediates presentation of several
            antigens to T cells in vivo, including protective immunity to HER2
            protein
  JOURNAL   J Immunol 188 (3), 1147-1155 (2012)
   PUBMED   22210914
  REMARK    GeneRIF: Treml4 participates in Ag presentation in vivo
REFERENCE   5  (bases 1 to 1730)
  AUTHORS   Hemmi H, Idoyaga J, Suda K, Suda N, Kennedy K, Noda M, Aderem A and
            Steinman RM.
  TITLE     A new triggering receptor expressed on myeloid cells (Trem) family
            member, Trem-like 4, binds to dead cells and is a DNAX activation
            protein 12-linked marker for subsets of mouse macrophages and
            dendritic cells
  JOURNAL   J Immunol 182 (3), 1278-1286 (2009)
   PUBMED   19155473
  REMARK    GeneRIF: Treml4 associates with adaptor molecule DNAX activation
            protein 12 kDa (DAP12) and serves as a marker for select groups of
            both dendritic cells and macrophages.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK077228.1, AC241601.3 and DQ186654.1.
            
            On Aug 1, 2009 this sequence version replaced NM_001033922.1.
            
            Transcript Variant: This variant (1) uses alternate in-frame splice
            junctions at the 5' ends of two exons compared to variant 3. The
            resulting isoform (1) has the same N- and C-termini but is shorter
            compared to isoform 3.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY557629.1, DQ186654.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849375, SAMN00849380
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-10                AK077228.1         1-10
            11-11               AC241601.3         44689-44689         c
            12-46               AK077228.1         12-46
            47-881              DQ186654.1         1-835
            882-1730            AK077228.1         894-1742
FEATURES             Location/Qualifiers
     source          1..1730
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="17"
                     /map="17 23.99 cM"
     gene            1..1730
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="triggering receptor expressed on myeloid cells-like
                     4"
                     /db_xref="GeneID:224840"
                     /db_xref="MGI:MGI:1923239"
     exon            1..146
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    14..16
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="upstream in-frame stop codon"
     CDS             86..865
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="isoform 1 precursor is encoded by transcript
                     variant 1; IG-like domain containing protein IDCP1c;
                     triggering receptor expressed on myeloid cells-like 3;
                     triggering receptor expressed on myeloid cells-like 3b;
                     triggering receptor expressed on myeloid cells-like
                     protein 3; triggering receptor expressed on myeloid
                     cells-like protein 4; trem-like transcript 4 protein"
                     /codon_start=1
                     /product="trem-like transcript 4 protein isoform 1
                     precursor"
                     /protein_id="NP_001029094.1"
                     /db_xref="CCDS:CCDS50141.1"
                     /db_xref="GeneID:224840"
                     /db_xref="MGI:MGI:1923239"
                     /translation="

MAWRYSQLLLVPVQLVFLASGVWGSTVSEELHRMVGQSLSVQCQYKPKEESYVLKTWCRQTAPSKCTRVVTTSEPRKAARELQHTIWDDPEAGFFNITMTQLTEDDSAFYWCGPYYPSLREVTVLRNISLVVSPAPSTLPSQTIAPLPESTATIFMPFPVLTTSPEETTDSSINGTGHRNQSSSSPGWTSPGLLVSVQYGLLLLKALMLSVFCVLLCWRSGQGREYMAETMELSKLPHISKSLDTVSHISGYEKKANWY"

     sig_peptide     86..157
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     158..862
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /product="Trem-like transcript 4 protein.
                     /id=PRO_0000418835"
                     /note="propagated from UniProtKB/Swiss-Prot (Q3LRV9.1)"
     misc_feature    158..457
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="Immunoglobulin (Ig)-like domain in the polymeric Ig
                     receptor (pIgR) and similar proteins; Region:
                     IgV_pIgR_like; cd05716"
                     /db_xref="CDD:409381"
     misc_feature    158..214
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="FR1 [structural motif]; Region: FR1"
                     /db_xref="CDD:409381"
     misc_feature    158..166
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409381"
     misc_feature    173..190
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409381"
     misc_feature    194..217
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409381"
     misc_feature    215..241
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="CDR1 [structural motif]; Region: CDR1"
                     /db_xref="CDD:409381"
     misc_feature    239..259
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409381"
     misc_feature    order(239..241,245..250)
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="CDR1-dIgA binding residues [polypeptide binding];
                     other site"
                     /db_xref="CDD:409381"
     misc_feature    245..259
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="FR2 [structural motif]; Region: FR2"
                     /db_xref="CDD:409381"
     misc_feature    260..316
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="CDR2 [structural motif]; Region: CDR2"
                     /db_xref="CDD:409381"
     misc_feature    284..298
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409381"
     misc_feature    308..316
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409381"
     misc_feature    323..427
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="FR3 [structural motif]; Region: FR3"
                     /db_xref="CDD:409381"
     misc_feature    323..352
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409381"
     misc_feature    362..388
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409381"
     misc_feature    371..373
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q3LRV9.1); glycosylation site"
     misc_feature    404..427
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409381"
     misc_feature    428..454
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="CDR3 [structural motif]; Region: CDR3"
                     /db_xref="CDD:409381"
     misc_feature    575..646
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q3LRV9.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    674..736
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q3LRV9.1);
                     transmembrane region"
     exon            147..488
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /inference="alignment:Splign:2.1.0"
     exon            489..539
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /inference="alignment:Splign:2.1.0"
     exon            540..621
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /inference="alignment:Splign:2.1.0"
     exon            622..751
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /inference="alignment:Splign:2.1.0"
     exon            752..1730
                     /gene="Treml4"
                     /gene_synonym="5031403H21Rik; IDCP1; TLT-4; TLT4; Treml3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

agatgatgagacttaggggaagacttgcctagttcagaggtctcctccttttctcctctcctctactgacagaatctggactggtatggcctggaggtactcacaactgctcctggtccctgtgcagctggtgttcctggcctcaggtgtctgggggtccacagtatctgaagagcttcatagaatggtaggacagagcctctccgtgcagtgccaatacaagcctaaggaggagtcctatgtgctgaaaacgtggtgtcggcaaacagccccaagtaaatgtacgagagtggtcactacctctgagcctcggaaagcagccagggaattacagcacacaatctgggatgatcctgaagctggcttcttcaacatcaccatgactcaactaacagaggatgactcagcgttctactggtgtggtccatattatccttccctcagagaagtaactgttctcagaaacatcagcctggtggtgtcgccagccccatcaacccttccttcgcagacgattgctccgctcccagaaagcacagccaccatctttatgcccttcccagttctgactacctctcccgaggagaccactgactcttccatcaatggcactgggcacagaaaccaaagttcctcctctcctggctggacctccccggggcttctggtctctgtgcaatatggactcctcctgctcaaggccctgatgctgtcagttttctgtgtgcttctttgctggaggagtggccagggacgagagtacatggcagagacgatggagctttcaaaactacctcacatctccaagtccttggacacggttagccacatctcagggtatgagaagaaggctaactggtactaaggcagaacaggccaaacttccgctctaccgaagccatcaggcaagcccacgagagacaacagccagacctgcatctcaaatcgccagggctaattgacactccagtatcgagcaccctcagagctgtataccccgtagcccagacctccgccaagatgaccaaccacggggcagttcatctgcaacacccagctcaagtgctttcccagatccccagccccgggcctttctcactctctctcctgcctcccttggcatcacaagcctcacaggctctgtttcccaagtgagctactcacaaggcccatgcctgtccactctactcacgttcacaagctcaccttcttggtttgctctagatttcctaaaatgagggggaaactaacttaaaggctaacacggggagccaagaaaggctgtgtgctgcggaccacaaaccgagaaagtccagaagttaaaggggggaaaaaagtgttttaaacaagaccaaaacctccccaaactgacccttcatgcacatcatgctgacttcatgcacatcagagctgaccaccaggggtcagtattgtgctggtttacccagtgatgcaatttcatctgcacaaagtctgcttatacaaagaggatggttggctgatgggaggagccggggagaatcccttagggaacaaaaagaatgtcacatctgtaaaacaagaagagtccagagtgacgttcaggagagcctggatactggcatacgctactaacaacatgctgaatgtagccacagccttgtaaccataaaaaggccactatgacggggtcacattttattccttttttatgttatgtgtgggagaataaaatatagatgtttcttcat

//