GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2026-10-05 20:40:51, GGRNA : RefSeq release 233 (Jan, 2026)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Homo sapiens long intergenic non-protein coding RNA 2136 (LINC02136), long non-coding RNA. (529 bp)
gcagccccttgcactcgcggagtcatctacgcaaggtcgggctctgcaggcagcagcttctggtctcaccccgggcttgtgcgcacacctggggacatgtgggaaggtcgctcttgcggccactgagcggcctggcctcagggaacgagccccgcgccgggaagaaagctgcctgccgggagcgcagcctattggggacccgggacccgagccaccgcggctcaccaagaggcggtggggccctgcggtgcgtgtgggacgccgggcaggcagactctgagcacggccaggaggcaagaagagattgaagggaaatctcaaggggctccagagactactacgatggtgcaaagtcacagaagccctgggaaaagcaggtagaatggagttgccatgacattgagcctcacctagatgccagttccagatattggcagactgctggcctcctgaggagcacaggaaggggcctggcagactggtgatcctggttggagatgaagaggggctgatta
position 309
NR_146574.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : https://172.18.8.233:20082/en/hs/seq%3acaagaagagattg
lang : en | div : | spe : hs | query_string : seq:caagaagagattg | format : html | download :

0.000 | 0.000 | search_start;
0.084 | 0.084 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:caagaagagattg)?source=Homo sapiens (human)?to=0&format=json
0.139 | 0.055 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:caagaagagattg)?source=Homo sapiens (human)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.139 | 0.000 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]