2024-05-14 12:22:06, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_039729 84 bp RNA linear PRI 31-JUL-2023 DEFINITION Homo sapiens microRNA 2392 (MIR2392), microRNA. ACCESSION NR_039729 VERSION NR_039729.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 84) AUTHORS Aalikhani M, Alikhani M, Khajeniazi S, Khosravi A, Bazi Z and Kianmehr A. TITLE Positive effect of miR-2392 on fibroblast to cardiomyocyte-like cell fate transition: An in silico and in vitro study JOURNAL Gene 879, 147598 (2023) PUBMED 37393060 REMARK GeneRIF: Positive effect of miR-2392 on fibroblast to cardiomyocyte-like cell fate transition: An in silico and in vitro study. REFERENCE 2 (bases 1 to 84) AUTHORS Sun B, Ji W, Liu C, Lin X, Chen L, Qian H and Su C. TITLE miR-2392 functions as tumour suppressor and inhibits malignant progression of hepatocellular carcinoma via directly targeting JAG2 JOURNAL Liver Int 42 (7), 1658-1673 (2022) PUBMED 35485355 REMARK GeneRIF: miR-2392 functions as tumour suppressor and inhibits malignant progression of hepatocellular carcinoma via directly targeting JAG2. REFERENCE 3 (bases 1 to 84) AUTHORS McDonald JT, Enguita FJ, Taylor D, Griffin RJ, Priebe W, Emmett MR, Sajadi MM, Harris AD, Clement J, Dybas JM, Aykin-Burns N, Guarnieri JW, Singh LN, Grabham P, Baylin SB, Yousey A, Pearson AN, Corry PM, Saravia-Butler A, Aunins TR, Sharma S, Nagpal P, Meydan C, Foox J, Mozsary C, Cerqueira B, Zaksas V, Singh U, Wurtele ES, Costes SV, Davanzo GG, Galeano D, Paccanaro A, Meinig SL, Hagan RS, Bowman NM, Wolfgang MC, Altinok S, Sapoval N, Treangen TJ, Moraes-Vieira PM, Vanderburg C, Wallace DC, Schisler JC, Mason CE, Chatterjee A, Meller R and Beheshti A. CONSRTM UNC COVID-19 Pathobiology Consortium TITLE Role of miR-2392 in driving SARS-CoV-2 infection JOURNAL Cell Rep 37 (3), 109839 (2021) PUBMED 34624208 REMARK GeneRIF: Role of miR-2392 in driving SARS-CoV-2 infection. REFERENCE 4 (bases 1 to 84) AUTHORS Hou Z, Fan F and Liu P. TITLE BTXA regulates the epithelial-mesenchymal transition and autophagy of keloid fibroblasts via modulating miR-1587/miR-2392 targeted ZEB2 JOURNAL Biosci Rep 39 (10) (2019) PUBMED 31652445 REMARK GeneRIF: BTXA regulates the epithelial-mesenchymal transition and autophagy of keloid fibroblasts via modulating miR-1587/miR-2392 targeted ZEB2. REFERENCE 5 (bases 1 to 84) AUTHORS Yang J, Li C, Li H and E C. TITLE LncRNA CACNA1G-AS1 facilitates hepatocellular carcinoma progression through the miR-2392/C1orf61 pathway JOURNAL J Cell Physiol 234 (10), 18415-18422 (2019) PUBMED 30908634 REMARK GeneRIF: CACNA1G-AS1 promotes hepatocellular carcinoma progression through regulating the miR-2392/C1orf61 pathway. REFERENCE 6 (bases 1 to 84) AUTHORS Li J, Li T, Lu Y, Shen G, Guo H, Wu J, Lei C, Du F, Zhou F, Zhao X, Nie Y and Fan D. TITLE MiR-2392 suppresses metastasis and epithelial-mesenchymal transition by targeting MAML3 and WHSC1 in gastric cancer JOURNAL FASEB J 31 (9), 3774-3786 (2017) PUBMED 28512191 REMARK GeneRIF: These findings indicate that the miR-2392-MAML3/WHSC1-Slug/Twist1 regulatory axis plays a critical role in GC metastasis. REFERENCE 7 (bases 1 to 84) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 8 (bases 1 to 84) AUTHORS Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q, How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE, Chadburn A and Dave SS. CONSRTM Hematologic Malignancies Research Consortium TITLE Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs JOURNAL Blood 116 (23), e118-e127 (2010) PUBMED 20733160 REFERENCE 9 (bases 1 to 84) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL117190.6. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-84 AL117190.6 54607-54690 FEATURES Location/Qualifiers source 1..84 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="14" /map="14q32.2" gene 1..84 /gene="MIR2392" /note="microRNA 2392" /db_xref="GeneID:100616495" /db_xref="HGNC:HGNC:41843" /db_xref="miRBase:MI0016870" precursor_RNA 1..84 /gene="MIR2392" /product="microRNA 2392" /db_xref="GeneID:100616495" /db_xref="HGNC:HGNC:41843" /db_xref="miRBase:MI0016870" exon 1..84 /gene="MIR2392" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:558004045" variation 9 /gene="MIR2392" /replace="" /replace="t" /db_xref="dbSNP:2139913660" variation 9 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:1595240852" variation 10 /gene="MIR2392" /replace="a" /replace="c" /db_xref="dbSNP:2139913661" variation 13 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:1367312817" variation 14 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:182974078" variation 15 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:1595240863" variation 22 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:1480254330" variation 23 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:2037087052" variation 25 /gene="MIR2392" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:2037087073" variation 26 /gene="MIR2392" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:917382033" variation 28 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:2139913676" variation 29 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:73347569" variation 32 /gene="MIR2392" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:557023035" variation 33 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:997221201" variation 34 /gene="MIR2392" /replace="a" /replace="t" /db_xref="dbSNP:1250435089" variation 37 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:2037087263" variation 38 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:2037087286" variation 39 /gene="MIR2392" /replace="c" /replace="g" /db_xref="dbSNP:2037087314" variation 42 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:1259174581" variation 44 /gene="MIR2392" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1044641262" variation 45 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:1206095780" variation 46 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:1266535249" variation 51 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:1259479156" variation 52 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:1218841974" variation 53 /gene="MIR2392" /replace="c" /replace="g" /db_xref="dbSNP:1250234556" variation 54 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:576509898" variation 57 /gene="MIR2392" /replace="c" /replace="g" /db_xref="dbSNP:1272853344" variation 58 /gene="MIR2392" /replace="a" /replace="c" /db_xref="dbSNP:779172086" ncRNA 61..80 /ncRNA_class="miRNA" /gene="MIR2392" /product="hsa-miR-2392" /db_xref="miRBase:MIMAT0019043" /db_xref="GeneID:100616495" /db_xref="HGNC:HGNC:41843" /db_xref="miRBase:MI0016870" variation 61 /gene="MIR2392" /replace="c" /replace="t" /db_xref="dbSNP:1193524402" variation 62 /gene="MIR2392" /replace="a" /replace="aa" /db_xref="dbSNP:2139913704" variation 63..64 /gene="MIR2392" /replace="g" /replace="gg" /db_xref="dbSNP:2037087567" variation 64 /gene="MIR2392" /replace="c" /replace="g" /db_xref="dbSNP:1235148713" variation 65 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:118055959" variation 67 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:1566709192" variation 71 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:1595240889" variation 72 /gene="MIR2392" /replace="g" /replace="t" /db_xref="dbSNP:1595240892" variation 77 /gene="MIR2392" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:761601922" variation 80 /gene="MIR2392" /replace="a" /replace="g" /db_xref="dbSNP:1402511503" variation 81 /gene="MIR2392" /replace="c" /replace="g" /db_xref="dbSNP:2037087734" variation 82 /gene="MIR2392" /replace="" /replace="t" /db_xref="dbSNP:2139913722" ORIGIN
atggtccctcccaatccagccattcctcagaccaggtggctcccgagccaccccaggctgtaggatgggggtgagaggtgctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]