2025-09-18 07:03:03, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NR_039677 63 bp RNA linear PRI 03-SEP-2020 DEFINITION Homo sapiens microRNA 4467 (MIR4467), microRNA. ACCESSION NR_039677 VERSION NR_039677.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 63) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 63) AUTHORS Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C. TITLE Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene JOURNAL Cancer Res. 71 (1), 78-86 (2011) PUBMED 21199797 REFERENCE 3 (bases 1 to 63) AUTHORS Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q, How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE, Chadburn A and Dave SS. CONSRTM Hematologic Malignancies Research Consortium TITLE Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs JOURNAL Blood 116 (23), e118-e127 (2010) PUBMED 20733160 REFERENCE 4 (bases 1 to 63) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC093668.4. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-63 AC093668.4 85419-85481 FEATURES Location/Qualifiers source 1..63 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="7" /map="7q22.1" gene 1..63 /gene="MIR4467" /note="microRNA 4467" /db_xref="GeneID:100616367" /db_xref="HGNC:HGNC:41896" /db_xref="miRBase:MI0016818" precursor_RNA 1..63 /gene="MIR4467" /product="microRNA 4467" /db_xref="GeneID:100616367" /db_xref="HGNC:HGNC:41896" /db_xref="miRBase:MI0016818" exon 1..63 /gene="MIR4467" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR4467" /replace="c" /replace="t" /db_xref="dbSNP:1477581216" variation 3 /gene="MIR4467" /replace="a" /replace="g" /db_xref="dbSNP:558945069" ncRNA 4..25 /ncRNA_class="miRNA" /gene="MIR4467" /product="hsa-miR-4467" /db_xref="miRBase:MIMAT0018994" /db_xref="GeneID:100616367" /db_xref="HGNC:HGNC:41896" /db_xref="miRBase:MI0016818" variation 4 /gene="MIR4467" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1798183190" variation 6 /gene="MIR4467" /replace="g" /replace="t" /db_xref="dbSNP:1043872367" variation 7 /gene="MIR4467" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:577520210" variation 8 /gene="MIR4467" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:115101071" variation 10 /gene="MIR4467" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:374409015" variation 11..13 /gene="MIR4467" /replace="" /replace="ggt" /db_xref="dbSNP:1486676393" variation 11 /gene="MIR4467" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1051250339" variation 12 /gene="MIR4467" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1200079421" variation 13 /gene="MIR4467" /replace="g" /replace="t" /db_xref="dbSNP:2133273034" variation 15 /gene="MIR4467" /replace="a" /replace="g" /db_xref="dbSNP:1798183882" variation 16 /gene="MIR4467" /replace="g" /replace="t" /db_xref="dbSNP:1586743603" variation 18 /gene="MIR4467" /replace="a" /replace="t" /db_xref="dbSNP:891385847" variation 19 /gene="MIR4467" /replace="c" /replace="t" /db_xref="dbSNP:555983141" variation 21 /gene="MIR4467" /replace="a" /replace="g" /db_xref="dbSNP:60871950" variation 23 /gene="MIR4467" /replace="c" /replace="t" /db_xref="dbSNP:1798184194" variation 25..29 /gene="MIR4467" /replace="t" /replace="tct" /replace="tctct" /db_xref="dbSNP:373524227" variation 25 /gene="MIR4467" /replace="g" /replace="t" /db_xref="dbSNP:1350983737" variation 26 /gene="MIR4467" /replace="c" /replace="t" /db_xref="dbSNP:1798184436" variation 28 /gene="MIR4467" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:964386659" variation 29..31 /gene="MIR4467" /replace="t" /replace="ttt" /db_xref="dbSNP:1356797440" variation 31 /gene="MIR4467" /replace="c" /replace="t" /db_xref="dbSNP:1586743644" variation 32 /gene="MIR4467" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:557614530" variation 35 /gene="MIR4467" /replace="a" /replace="c" /db_xref="dbSNP:1586743656" variation 38 /gene="MIR4467" /replace="a" /replace="g" /db_xref="dbSNP:1413484372" variation 41 /gene="MIR4467" /replace="a" /replace="g" /db_xref="dbSNP:1798184884" variation 43..46 /gene="MIR4467" /replace="ccc" /replace="cccc" /db_xref="dbSNP:1488673451" variation 43 /gene="MIR4467" /replace="c" /replace="t" /db_xref="dbSNP:1434771995" variation 44 /gene="MIR4467" /replace="c" /replace="t" /db_xref="dbSNP:1586743675" variation 45 /gene="MIR4467" /replace="c" /replace="t" /db_xref="dbSNP:1209053377" variation 50..58 /gene="MIR4467" /replace="gccgccgcc" /replace="gccgccgccgcc" /db_xref="dbSNP:754211189" variation 52 /gene="MIR4467" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1027368924" variation 53 /gene="MIR4467" /replace="a" /replace="g" /db_xref="dbSNP:1454660579" variation 55 /gene="MIR4467" /replace="c" /replace="t" /db_xref="dbSNP:188069903" variation 56 /gene="MIR4467" /replace="a" /replace="g" /db_xref="dbSNP:983706457" variation 58 /gene="MIR4467" /replace="c" /replace="t" /db_xref="dbSNP:1273339414" ORIGIN
tggtggcggcggtagttatgggcttctctttctcaccagcagcccctgggccgccgcctccct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]