2024-05-14 13:57:39, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_037465 65 bp RNA linear PRI 04-SEP-2020 DEFINITION Homo sapiens microRNA 3714 (MIR3714), microRNA. ACCESSION NR_037465 VERSION NR_037465.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 65) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 65) AUTHORS Schulte JH, Marschall T, Martin M, Rosenstiel P, Mestdagh P, Schlierf S, Thor T, Vandesompele J, Eggert A, Schreiber S, Rahmann S and Schramm A. TITLE Deep sequencing reveals differential expression of microRNAs in favorable versus unfavorable neuroblastoma JOURNAL Nucleic Acids Res. 38 (17), 5919-5928 (2010) PUBMED 20466808 REFERENCE 3 (bases 1 to 65) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC090943.3. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-65 AC090943.3 41682-41746 c FEATURES Location/Qualifiers source 1..65 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="3" /map="3p24.3" gene 1..65 /gene="MIR3714" /note="microRNA 3714" /db_xref="GeneID:100500913" /db_xref="HGNC:HGNC:38928" /db_xref="miRBase:MI0016135" precursor_RNA 1..65 /gene="MIR3714" /product="microRNA 3714" /db_xref="GeneID:100500913" /db_xref="HGNC:HGNC:38928" /db_xref="miRBase:MI0016135" exon 1..65 /gene="MIR3714" /inference="alignment:Splign:2.1.0" ncRNA 1..22 /ncRNA_class="miRNA" /gene="MIR3714" /product="hsa-miR-3714" /db_xref="miRBase:MIMAT0018165" /db_xref="GeneID:100500913" /db_xref="HGNC:HGNC:38928" /db_xref="miRBase:MI0016135" variation 5..11 /gene="MIR3714" /replace="gcag" /replace="gcagcag" /db_xref="dbSNP:897080435" variation 5 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:1041972338" variation 6 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:760552376" variation 9 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:904545731" variation 11 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:1697450176" variation 15 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:1372877817" variation 16 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:1284593360" variation 17 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:1697450404" variation 23 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:1697450478" variation 25 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:1358667102" variation 26 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:1697450646" variation 29 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:935974159" variation 31 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:1404508225" variation 32 /gene="MIR3714" /replace="a" /replace="c" /db_xref="dbSNP:537488110" variation 33 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:1697450984" variation 38 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:55835744" variation 39 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:372887672" variation 40 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:1024426159" variation 43 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:574434395" variation 44 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:906866849" variation 45 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:1697451837" variation 46 /gene="MIR3714" /replace="c" /replace="g" /db_xref="dbSNP:1414156596" variation 50 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:1697451993" variation 52 /gene="MIR3714" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1241801698" variation 53 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:1697452209" variation 54 /gene="MIR3714" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:543336822" variation 55 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:1322195127" variation 58 /gene="MIR3714" /replace="a" /replace="g" /db_xref="dbSNP:1697452568" variation 59 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:1024568432" variation 60 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:2124944218" variation 62 /gene="MIR3714" /replace="c" /replace="t" /db_xref="dbSNP:1034072337" ORIGIN
gaaggcagcagtgctcccctgtgacgtgctccatcaccgggcagggaagacaccgctgccacctc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]