2024-05-15 07:05:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_037410 92 bp RNA linear PRI 11-SEP-2020 DEFINITION Homo sapiens microRNA 3616 (MIR3616), microRNA. ACCESSION NR_037410 VERSION NR_037410.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 92) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 92) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res. 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 3 (bases 1 to 92) AUTHORS Witten D, Tibshirani R, Gu SG, Fire A and Lui WO. TITLE Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls JOURNAL BMC Biol. 8, 58 (2010) PUBMED 20459774 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 92) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL022342.7. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM611175.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-92 AL022342.7 41675-41766 FEATURES Location/Qualifiers source 1..92 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="20" /map="20q13.12" gene 1..92 /gene="MIR3616" /gene_synonym="mir-3616" /note="microRNA 3616" /db_xref="GeneID:100500814" /db_xref="HGNC:HGNC:38943" /db_xref="miRBase:MI0016006" precursor_RNA 1..92 /gene="MIR3616" /gene_synonym="mir-3616" /product="microRNA 3616" /db_xref="GeneID:100500814" /db_xref="HGNC:HGNC:38943" /db_xref="miRBase:MI0016006" exon 1..92 /gene="MIR3616" /gene_synonym="mir-3616" /inference="alignment:Splign:2.1.0" variation 9 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="t" /db_xref="dbSNP:1285738651" variation 10 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:192179398" variation 12 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="t" /db_xref="dbSNP:2146645259" variation 13 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:2146645267" variation 16 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:753430018" ncRNA 19..40 /ncRNA_class="miRNA" /gene="MIR3616" /gene_synonym="mir-3616" /product="hsa-miR-3616-5p" /db_xref="miRBase:MIMAT0017995" /db_xref="GeneID:100500814" /db_xref="HGNC:HGNC:38943" /db_xref="miRBase:MI0016006" variation 23 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:2034211482" variation 25 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="t" /db_xref="dbSNP:2034211536" variation 27 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="g" /db_xref="dbSNP:2034211588" variation 28 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:1600763037" variation 29 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="g" /db_xref="dbSNP:2034211714" variation 31 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="t" /db_xref="dbSNP:576379844" variation 32 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:757683299" variation 33 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="t" /db_xref="dbSNP:1600763051" variation 34 /gene="MIR3616" /gene_synonym="mir-3616" /replace="g" /replace="t" /db_xref="dbSNP:2034211968" variation 35 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:2034212029" variation 37 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:1258362367" variation 38 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="t" /db_xref="dbSNP:765803807" variation 39 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:1046675950" variation 52 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:2034212239" variation 54 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:557286910" ncRNA 60..82 /ncRNA_class="miRNA" /gene="MIR3616" /gene_synonym="mir-3616" /product="hsa-miR-3616-3p" /db_xref="miRBase:MIMAT0017996" /db_xref="GeneID:100500814" /db_xref="HGNC:HGNC:38943" /db_xref="miRBase:MI0016006" variation 60 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="t" /db_xref="dbSNP:2034212369" variation 61 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:1241656567" variation 62 /gene="MIR3616" /gene_synonym="mir-3616" /replace="" /replace="a" /db_xref="dbSNP:2034212488" variation 65 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:2146645335" variation 67 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:1336777739" variation 71 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:2034212581" variation 72 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:1288261512" variation 76 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="t" /db_xref="dbSNP:2146645350" variation 80 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:750749182" variation 82 /gene="MIR3616" /gene_synonym="mir-3616" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:751652021" variation 83 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:532889629" variation 85 /gene="MIR3616" /gene_synonym="mir-3616" /replace="a" /replace="g" /db_xref="dbSNP:2034212937" variation 87 /gene="MIR3616" /gene_synonym="mir-3616" /replace="g" /replace="t" /db_xref="dbSNP:1005886100" ORIGIN
tgtcactccgccagcatcatgaagtgcactcatgatatgtttgccccatcagcgtgtcacgagggcatttcatgatgcaggcggggttggca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]