2024-05-15 04:47:18, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_031724 72 bp RNA linear PRI 19-JUN-2022 DEFINITION Homo sapiens microRNA 320c-2 (MIR320C2), microRNA. ACCESSION NR_031724 VERSION NR_031724.2 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 72) AUTHORS Matamala N, Lara B, Gomez-Mariano G, Martinez S, Vazquez-Dominguez I, Otero-Sobrino A, Munoz-Callejas A, Sanchez E, Esquinas C, Bustamante A, Cadenas S, Curi S, Lazaro L, Martinez MT, Rodriguez E, Miravitlles M, Torres-Duran M, Herrero I, Michel FJ, Castillo S, Hernandez-Perez JM, Blanco I, Casas F and Martinez-Delgado B. TITLE miR-320c Regulates SERPINA1 Expression and Is Induced in Patients With Pulmonary Disease JOURNAL Arch Bronconeumol 57 (7), 457-463 (2021) PUBMED 35698951 REMARK GeneRIF: miR-320c Regulates SERPINA1 Expression and Is Induced in Patients With Pulmonary Disease. REFERENCE 2 (bases 1 to 72) AUTHORS Li Y, Huang Y, Zhou C, Jiang PC and Pan W. TITLE MiR-320c prevents the malignant development of cervical cancer by regulating GABRP level JOURNAL Eur Rev Med Pharmacol Sci 24 (17), 8731-8739 (2020) PUBMED 32964961 REMARK GeneRIF: MiR-320c prevents the malignant development of cervical cancer by regulating GABRP level. REFERENCE 3 (bases 1 to 72) AUTHORS Aripova A, Akparova A and Bersimbaev R. TITLE The Potential Role of miRNA-19b-3p and miRNA-320c in Patients with Moderate Bronchial Asthma JOURNAL Microrna 9 (5), 373-377 (2020) PUBMED 33632094 REMARK GeneRIF: The Potential Role of miRNA-19b-3p and miRNA-320c in Patients with Moderate Bronchial Asthma. REFERENCE 4 (bases 1 to 72) AUTHORS Sun,H., Huang,Z., Wu,P., Chang,Z., Liao,W. and Zhang,Z. TITLE CDK6 and miR-320c Co-Regulate Chondrocyte Catabolism Through NF-kappaB Signaling Pathways JOURNAL Cell Physiol Biochem 51 (2), 909-923 (2018) PUBMED 30466085 REMARK GeneRIF: MiR-320c overexpression and CDK6 inhibition attenuated IL-1beta-induced increases in expression of inflammatory products such as iNOS and MMP13 and decreased the expression of anabolic products such as COL2A1 and aggrecan. REFERENCE 5 (bases 1 to 72) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 72) AUTHORS Kaudewitz D, Skroblin P, Bender LH, Barwari T, Willeit P, Pechlaner R, Sunderland NP, Willeit K, Morton AC, Armstrong PC, Chan MV, Lu R, Yin X, Gracio F, Dudek K, Langley SR, Zampetaki A, de Rinaldis E, Ye S, Warner TD, Saxena A, Kiechl S, Storey RF and Mayr M. TITLE Association of MicroRNAs and YRNAs With Platelet Function JOURNAL Circ Res 118 (3), 420-432 (2016) PUBMED 26646931 REFERENCE 7 (bases 1 to 72) AUTHORS Wang X, Wu J, Lin Y, Zhu Y, Xu X, Xu X, Liang Z, Li S, Hu Z, Zheng X and Xie L. TITLE MicroRNA-320c inhibits tumorous behaviors of bladder cancer by targeting Cyclin-dependent kinase 6 JOURNAL J Exp Clin Cancer Res 33, 69 (2014) PUBMED 25178497 REMARK GeneRIF: miR-320c could inhibit the proliferation, migration and invasion of bladder cancer cells via regulating CDK6. Publication Status: Online-Only REFERENCE 8 (bases 1 to 72) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 9 (bases 1 to 72) AUTHORS Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S and Rajewsky N. TITLE Discovering microRNAs from deep sequencing data using miRDeep JOURNAL Nat Biotechnol 26 (4), 407-415 (2008) PUBMED 18392026 REFERENCE 10 (bases 1 to 72) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC023983.11. On Apr 17, 2019 this sequence version replaced NR_031724.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-72 AC023983.11 86169-86240 FEATURES Location/Qualifiers source 1..72 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="18" /map="18q11.2" gene 1..72 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /note="microRNA 320c-2" /db_xref="GeneID:100302195" /db_xref="HGNC:HGNC:35387" /db_xref="miRBase:MI0008191" precursor_RNA 1..72 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /product="microRNA 320c-2" /db_xref="GeneID:100302195" /db_xref="HGNC:HGNC:35387" /db_xref="miRBase:MI0008191" exon 1..72 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:765612087" variation 3 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="t" /db_xref="dbSNP:753234427" variation 8 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="t" /db_xref="dbSNP:758945141" variation 9 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:1276182440" variation 10 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="g" /replace="t" /db_xref="dbSNP:764421548" variation 11 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1204864848" variation 12 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="c" /replace="t" /db_xref="dbSNP:2090863117" variation 22 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="c" /replace="t" /db_xref="dbSNP:751981145" variation 24 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1489500700" variation 26 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="c" /replace="t" /db_xref="dbSNP:757419162" variation 29 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="c" /replace="t" /db_xref="dbSNP:1268876499" variation 30 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="c" /replace="t" /db_xref="dbSNP:1433788754" variation 31 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="c" /replace="g" /db_xref="dbSNP:2090863454" variation 34 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:1201097652" variation 39 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:781485513" variation 41 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="g" /replace="t" /db_xref="dbSNP:745882220" ncRNA 42..61 /ncRNA_class="miRNA" /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /product="hsa-miR-320c" /db_xref="miRBase:MIMAT0005793" /db_xref="GeneID:100302195" /db_xref="HGNC:HGNC:35387" /db_xref="miRBase:MI0008191" variation 43 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:1159517960" variation 46 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:1327994455" variation 50 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:769415707" variation 51 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:958657957" variation 52 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="c" /replace="t" /db_xref="dbSNP:991776304" variation 54 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:756244906" variation 58 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1285199699" variation 59 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:780317956" variation 60 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:748073401" variation 61 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="c" /replace="t" /db_xref="dbSNP:2090864218" variation 65 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:917271456" variation 69 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:2090864420" variation 70 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="c" /db_xref="dbSNP:1324975292" variation 71 /gene="MIR320C2" /gene_synonym="hsa-mir-320c-2; mir-320c-2; MIR320C-2; MIRN320C2" /replace="a" /replace="g" /db_xref="dbSNP:1683524154" ORIGIN
gcatgacaggccttctctttccagttcttcccagaattgggaaaagctgggttgagagggtaagaaaagaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]