GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-10 19:37:33, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_022145               1731 bp    mRNA    linear   PRI 02-AUG-2023
DEFINITION  Homo sapiens centromere protein K (CENPK), transcript variant 1,
            mRNA.
ACCESSION   NM_022145
VERSION     NM_022145.5
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1731)
  AUTHORS   Li X, Han YR, Xuefeng X, Ma YX, Xing GS, Yang ZW, Zhang Z, Shi L
            and Wu XL.
  TITLE     Lentivirus-mediated short hairpin RNA interference of CENPK
            inhibits growth of colorectal cancer cells with overexpression of
            Cullin 4A
  JOURNAL   World J Gastroenterol 28 (37), 5420-5443 (2022)
   PUBMED   36312839
  REMARK    GeneRIF: Lentivirus-mediated short hairpin RNA interference of
            CENPK inhibits growth of colorectal cancer cells with
            overexpression of Cullin 4A.
REFERENCE   2  (bases 1 to 1731)
  AUTHORS   Tian T, Chen L, Dou Z, Yang Z, Gao X, Yuan X, Wang C, Liu R, Shen
            Z, Gui P, Teng M, Meng X, Hill DL, Li L, Zhang X, Liu X, Sun L,
            Zang J and Yao X.
  TITLE     Structural insights into human CCAN complex assembled onto DNA
  JOURNAL   Cell Discov 8 (1), 90 (2022)
   PUBMED   36085283
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1731)
  AUTHORS   Tian H, Wang F, Deng Y, Ying L, Fang W, Chen D, Miao C, Li H, Sun
            S, Ma Y, Cai H and Guo T.
  TITLE     Centromeric protein K (CENPK) promotes gastric cancer proliferation
            and migration via interacting with XRCC5
  JOURNAL   Gastric Cancer 25 (5), 879-895 (2022)
   PUBMED   35715658
  REMARK    GeneRIF: Centromeric protein K (CENPK) promotes gastric cancer
            proliferation and migration via interacting with XRCC5.
REFERENCE   4  (bases 1 to 1731)
  AUTHORS   Lin X, Wang F, Chen J, Liu J, Lin YB, Li L, Chen CB and Xu Q.
  TITLE     N6-methyladenosine modification of CENPK mRNA by ZC3H13 promotes
            cervical cancer stemness and chemoresistance
  JOURNAL   Mil Med Res 9 (1), 19 (2022)
   PUBMED   35418160
  REMARK    GeneRIF: N(6)-methyladenosine modification of CENPK mRNA by ZC3H13
            promotes cervical cancer stemness and chemoresistance.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1731)
  AUTHORS   Li Q, Liang J, Zhang S, An N, Xu L and Ye C.
  TITLE     Overexpression of centromere protein K (CENPK) gene in
            Differentiated Thyroid Carcinoma promote cell Proliferation and
            Migration
  JOURNAL   Bioengineered 12 (1), 1299-1310 (2021)
   PUBMED   33904381
  REMARK    GeneRIF: Overexpression of centromere protein K (CENPK) gene in
            Differentiated Thyroid Carcinoma promote cell Proliferation and
            Migration.
REFERENCE   6  (bases 1 to 1731)
  AUTHORS   Okada M, Cheeseman IM, Hori T, Okawa K, McLeod IX, Yates JR 3rd,
            Desai A and Fukagawa T.
  TITLE     The CENP-H-I complex is required for the efficient incorporation of
            newly synthesized CENP-A into centromeres
  JOURNAL   Nat Cell Biol 8 (5), 446-457 (2006)
   PUBMED   16622420
REFERENCE   7  (bases 1 to 1731)
  AUTHORS   Foltz DR, Jansen LE, Black BE, Bailey AO, Yates JR 3rd and
            Cleveland DW.
  TITLE     The human CENP-A centromeric nucleosome-associated complex
  JOURNAL   Nat Cell Biol 8 (5), 458-469 (2006)
   PUBMED   16622419
REFERENCE   8  (bases 1 to 1731)
  AUTHORS   Obuse C, Yang H, Nozaki N, Goto S, Okazaki T and Yoda K.
  TITLE     Proteomics analysis of the centromere complex from HeLa interphase
            cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of
            the CEN-complex, while BMI-1 is transiently co-localized with the
            centromeric region in interphase
  JOURNAL   Genes Cells 9 (2), 105-120 (2004)
   PUBMED   15009096
REFERENCE   9  (bases 1 to 1731)
  AUTHORS   Yamashita A, Ito M, Takamatsu N and Shiba T.
  TITLE     Characterization of Solt, a novel SoxLZ/Sox6 binding protein
            expressed in adult mouse testis
  JOURNAL   FEBS Lett 481 (2), 147-151 (2000)
   PUBMED   10996314
REFERENCE   10 (bases 1 to 1731)
  AUTHORS   Taki T, Hayashi Y, Taniwaki M, Seto M, Ueda R, Hanada R, Suzukawa
            K, Yokota J and Morishita K.
  TITLE     Fusion of the MLL gene with two different genes, AF-6 and
            AF-5alpha, by a complex translocation involving chromosomes 5, 6, 8
            and 11 in infant leukemia
  JOURNAL   Oncogene 13 (10), 2121-2130 (1996)
   PUBMED   8950979
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BC008504.1.
            
            On Nov 24, 2018 this sequence version replaced NM_022145.4.
            
            Summary: CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM
            300065)-associated centromeric complex that targets CENPA (MIM
            117139) to centromeres and is required for proper kinetochore
            function and mitotic progression (Okada et al., 2006 [PubMed
            16622420]).[supplied by OMIM, Mar 2008].
            
            Transcript Variant: This variant (1) represents the longest
            transcript. Variants 1 and 2 encode the same isoform (1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC008504.1, SRR1163658.452865.1
                                           [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA1965299,
                                           SAMEA1966682 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000396679.6/ ENSP00000379911.1
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1731              BC008504.1         1-1731
FEATURES             Location/Qualifiers
     source          1..1731
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q12.3"
     gene            1..1731
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="centromere protein K"
                     /db_xref="GeneID:64105"
                     /db_xref="HGNC:HGNC:29479"
                     /db_xref="MIM:611502"
     exon            1..71
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359976795"
     variation       2
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313487734"
     variation       3
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1752349587"
     variation       6
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752348893"
     variation       7
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752348579"
     variation       8
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306504051"
     variation       9
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342831242"
     variation       11..20
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ggggctggca"
                     /replace="ggggctggcaggggctggca"
                     /db_xref="dbSNP:1485277906"
     variation       11
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752347563"
     variation       12
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231982437"
     variation       13
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028359789"
     variation       14
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542352928"
     variation       15
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210224911"
     variation       19
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265798087"
     variation       21
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752345149"
     variation       22..25
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gc"
                     /replace="gcgc"
                     /db_xref="dbSNP:1257636747"
     variation       24
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1226707165"
     variation       28
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752344063"
     variation       29
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752343711"
     variation       30
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748792667"
     variation       31
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422047918"
     variation       32
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412446096"
     variation       33
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473419782"
     variation       34
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150581284"
     variation       35
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1752342051"
     variation       36
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1343690787"
     variation       37
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140804671"
     variation       39
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553552680"
     variation       40
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752340528"
     variation       41
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9791024"
     variation       42
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404435189"
     variation       45
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413477558"
     variation       46
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1011178654"
     variation       48
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892736211"
     variation       49
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293152372"
     variation       50
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1752337962"
     variation       52
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004353263"
     variation       53
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364825946"
     variation       55
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1752336831"
     variation       56
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41268429"
     variation       61
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027093258"
     variation       62
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003673595"
     variation       63
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995243929"
     variation       64
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558001621"
     variation       69
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368732818"
     variation       71
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157875168"
     exon            72..173
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       72
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548499564"
     variation       75..77
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tag"
                     /replace="tagttag"
                     /db_xref="dbSNP:1038778849"
     variation       77
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757254302"
     variation       84
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1751964644"
     variation       85
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225478568"
     variation       86
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375448951"
     variation       90
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1751963569"
     variation       93
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001509723"
     variation       94
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445804221"
     variation       99
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171663462"
     variation       101
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1581126138"
     variation       103
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374448596"
     variation       104
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906122153"
     variation       107
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:902390139"
     variation       114
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470058908"
     variation       115
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1751960081"
     variation       119
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1581126047"
     variation       127
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2150571791"
     variation       129
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358207757"
     variation       130
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173365559"
     variation       131
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1751958616"
     variation       133
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330586449"
     variation       134
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337771016"
     variation       135
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401876701"
     variation       137
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440214129"
     variation       140
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1581125889"
     variation       145
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1751955831"
     variation       146
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1751955343"
     variation       148
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409398045"
     variation       155
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189373120"
     variation       165
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158620897"
     variation       168
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1751953447"
     variation       170
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024707099"
     variation       171
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950264084"
     variation       172
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013728629"
     variation       173
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053275890"
     exon            174..323
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       178
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443766369"
     variation       181
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750737523"
     variation       182..185
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ataa"
                     /replace="ataataa"
                     /db_xref="dbSNP:1256234642"
     variation       182
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760138230"
     variation       186
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542351057"
     misc_feature    189..191
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="upstream in-frame stop codon"
     variation       193
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:551599072"
     variation       194
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184278791"
     variation       195
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1164611338"
     variation       200
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748100479"
     variation       201
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411927803"
     variation       203
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988842021"
     variation       205
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172936444"
     variation       207
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778744562"
     variation       210
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1403246344"
     variation       212
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486299502"
     CDS             213..1022
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="isoform 1 is encoded by transcript variant 1;
                     leucine zipper protein FKSG14; SoxLZ/Sox6-binding protein
                     Solt; protein AF-5alpha; interphase centromere complex
                     protein 37"
                     /codon_start=1
                     /product="centromere protein K isoform 1"
                     /protein_id="NP_071428.2"
                     /db_xref="CCDS:CCDS3984.1"
                     /db_xref="GeneID:64105"
                     /db_xref="HGNC:HGNC:29479"
                     /db_xref="MIM:611502"
                     /translation="
MNQEDLDPDSTTDVGDVTNTEEELIRECEEMWKDMEECQNKLSLIGTETLTDSNAQLSLLIMQVKCLTAELSQWQKKTPETIPLTEDVLITLGKEEFQKLRQDLEMVLSTKESKNEKLKEDLEREQRWLDEQQQIMESLNVLHSELKNKVETFSESRIFNELKTKMLNIKEYKEKLLSTLGEFLEDHFPLPDRSVKKKKKNIQESSVNLITLHEMLEILINRLFDVPHDPYVKISDSFWPPYVELLLRNGIALRHPEDPTRIRLEAFHQ"
     misc_feature    213..272
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9BS16.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    240..1019
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="Centromere-associated protein K; Region: CENP-K;
                     pfam11802"
                     /db_xref="CDD:432085"
     misc_feature    498..503
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="Breakpoint for translocation to form
                     KMT2A/MLL1-CENPK oncogene; propagated from
                     UniProtKB/Swiss-Prot (Q9BS16.1); other site"
     variation       213
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750731325"
     variation       215
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749023060"
     variation       219
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139570970"
     variation       223
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757460492"
     variation       225
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777895549"
     variation       229
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2096371242"
     variation       231
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:935938524"
     variation       234
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150532568"
     variation       235
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758896315"
     variation       236
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75497175"
     variation       238
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216026136"
     variation       241
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371070860"
     variation       248
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750726023"
     variation       249
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760004670"
     variation       250
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750725249"
     variation       258
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397513933"
     variation       259
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750724525"
     variation       260
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754218341"
     variation       261
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766178671"
     variation       265
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760347848"
     variation       267
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348543974"
     variation       270..274
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="actga"
                     /db_xref="dbSNP:1429400174"
     variation       272
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772652364"
     variation       273..281
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gaagaa"
                     /replace="gaagaagaa"
                     /db_xref="dbSNP:1347528124"
     variation       278
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423115596"
     variation       279
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750721303"
     variation       282
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150574725"
     variation       284
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201745679"
     variation       286
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481438294"
     variation       287
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774283954"
     variation       288
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141729484"
     variation       291
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206680426"
     variation       295
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1581093357"
     variation       301..303
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1437145639"
     variation       301
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248409774"
     variation       302
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750716760"
     variation       304
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749111718"
     variation       308
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750714903"
     variation       309
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263513424"
     variation       312
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775244207"
     variation       315
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771118232"
     variation       316
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747252575"
     variation       321
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868732343"
     exon            324..380
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       324
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750271640"
     variation       325
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543487501"
     variation       326
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043343369"
     variation       327
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750268417"
     variation       338
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448020199"
     variation       339
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762865136"
     variation       342
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775330841"
     variation       344
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148016416"
     variation       345
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750263924"
     variation       346..348
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="ttg"
                     /db_xref="dbSNP:779227890"
     variation       346
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454849271"
     variation       348
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144481454"
     variation       349
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150519689"
     variation       351
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745593902"
     variation       356..367
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aacactcaccga"
                     /db_xref="dbSNP:1242902542"
     variation       358..364
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="cac"
                     /replace="cactcac"
                     /db_xref="dbSNP:757802386"
     variation       358
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946304876"
     variation       360
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138527872"
     variation       362
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339735347"
     variation       364
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2150519582"
     variation       365
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757907403"
     variation       366
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141548635"
     variation       370
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201709067"
     variation       377
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755596314"
     variation       378
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764377925"
     exon            381..453
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       382
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749320661"
     variation       383
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780631678"
     variation       387..391
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:1750067937"
     variation       387
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750068401"
     variation       395
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750067487"
     variation       397
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532263854"
     variation       398
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328421596"
     variation       399
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750066060"
     variation       401
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750065565"
     variation       402
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278922834"
     variation       407
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746283375"
     variation       410..412
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1388017290"
     variation       416
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781388497"
     variation       417
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751218204"
     variation       418
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406983239"
     variation       423
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391243960"
     variation       424..430
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tca"
                     /replace="tcagtca"
                     /db_xref="dbSNP:762598205"
     variation       424
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561685621"
     variation       425
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777349763"
     variation       426
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185445391"
     variation       427
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425260470"
     variation       431
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749780402"
     variation       432
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750057694"
     variation       434
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477188242"
     variation       435
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1750056781"
     variation       437
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750056286"
     variation       438..444
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:750256768"
     variation       440
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377608156"
     variation       444
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549718297"
     variation       445
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750053838"
     variation       446
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759373577"
     variation       447
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753728671"
     variation       450
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561685364"
     variation       453
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1693238677"
     exon            454..500
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       456
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438182467"
     variation       459
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557986609"
     variation       461
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764452510"
     variation       463
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763064949"
     variation       464
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1483041739"
     variation       465
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748212552"
     variation       468
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748212077"
     variation       469..470
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1403653612"
     variation       473
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765236390"
     variation       474
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548653305"
     variation       476
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771385648"
     variation       477
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1286587676"
     variation       479
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138507676"
     variation       483
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314951065"
     variation       484
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974580309"
     variation       487
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773540586"
     variation       489..490
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1581021207"
     variation       490
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2150453321"
     variation       494
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1581021175"
     variation       496..497
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:779363914"
     variation       496..497
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1748205064"
     variation       497
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228585329"
     exon            501..583
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       503
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393117032"
     variation       506
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180206825"
     variation       512
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150375703"
     variation       516
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773628734"
     variation       520
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237140365"
     variation       529
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1232231851"
     variation       531
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193606113"
     variation       532
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745284481"
     variation       533
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547550705"
     variation       534
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1745283514"
     variation       536
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186908669"
     variation       540
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748490924"
     variation       541
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773901255"
     variation       544
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2150375557"
     variation       550
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768317556"
     variation       551
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561634678"
     variation       553
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748850005"
     variation       556
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745280061"
     variation       557
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145897680"
     variation       558
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753691260"
     variation       563
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376463567"
     variation       564
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327050486"
     variation       566..569
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aaag"
                     /db_xref="dbSNP:2150375437"
     variation       571
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140748564"
     variation       573
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286143770"
     variation       574
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1745276214"
     variation       575
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745797201"
     variation       576
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302333711"
     variation       578
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434037126"
     variation       580
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1580930674"
     variation       581
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909927578"
     exon            584..682
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       586
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745248317"
     variation       587
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195109001"
     variation       588
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1745247359"
     variation       590
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185309293"
     variation       591
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755218264"
     variation       592
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138940796"
     variation       597
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745244701"
     variation       599
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357350104"
     variation       600
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265044045"
     variation       601
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:892129867"
     variation       602
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561633837"
     variation       603
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867891240"
     variation       603
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1745242213"
     variation       604
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:780195488"
     variation       605..636
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ac"
                     /replace="acagcaacagataatggaatctcttaatgtac"
                     /db_xref="dbSNP:1745237533"
     variation       611
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157077028"
     variation       614
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363410017"
     variation       623
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756212865"
     variation       626
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750466231"
     variation       630
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325715984"
     variation       633
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767952170"
     variation       635
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406824741"
     variation       636
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580929057"
     variation       638
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150254661"
     variation       640
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451415236"
     variation       641
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745235605"
     variation       642
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1580928949"
     variation       643..644
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:749771436"
     variation       643
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751927567"
     variation       644
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141033147"
     variation       649
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775303734"
     variation       650
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1471995857"
     variation       656
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425234534"
     variation       658
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323742457"
     variation       660
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745230797"
     variation       664
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540839130"
     variation       665
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745229775"
     variation       668
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745229292"
     variation       669
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475383930"
     variation       673
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240814809"
     variation       674
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201507225"
     variation       675
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452590609"
     variation       679
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199710596"
     variation       680
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776182305"
     variation       681
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770828450"
     exon            683..809
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       686
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745162523"
     variation       689
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192069105"
     variation       702
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745161624"
     variation       705..708
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1238965408"
     variation       707
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745161152"
     variation       708
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752112029"
     variation       712
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1203948509"
     variation       714
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150372287"
     variation       717
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745159363"
     variation       720
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745158892"
     variation       723
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764451391"
     variation       724
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758865586"
     variation       725
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753079695"
     variation       729
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765028924"
     variation       731
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376864120"
     variation       740
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745154105"
     variation       743..745
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gag"
                     /db_xref="dbSNP:1231746887"
     variation       743
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216777810"
     variation       744
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745152720"
     variation       748
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378696125"
     variation       755
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538146502"
     variation       756
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868259372"
     variation       758
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745150168"
     variation       761
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1745149712"
     variation       762
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765914401"
     variation       763
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185768219"
     variation       766
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569355500"
     variation       767
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377239133"
     variation       768
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773227049"
     variation       770
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745146291"
     variation       771
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745145818"
     variation       773
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172188810"
     variation       777
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866918568"
     variation       778
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771962047"
     variation       780
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774114264"
     variation       782
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176885832"
     variation       783
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468783521"
     variation       788
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770061194"
     variation       790
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151068525"
     variation       793
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781204320"
     variation       794
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759021447"
     variation       798..802
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1284629517"
     variation       800
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745140405"
     variation       804..808
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1745137975"
     variation       804
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757372616"
     variation       809
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409007703"
     exon            810..863
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       810
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213991862"
     variation       811..821
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aa"
                     /replace="aaaacattcaa"
                     /db_xref="dbSNP:1743744485"
     variation       814
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774200181"
     variation       816
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270744844"
     variation       817
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561615890"
     variation       819
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219885542"
     variation       823
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308635150"
     variation       829
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759382373"
     variation       840
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776934831"
     variation       841
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580880398"
     variation       845
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376455824"
     variation       848
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743741013"
     variation       850
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747162578"
     variation       855
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743739935"
     variation       857
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440453004"
     variation       863
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777984796"
     exon            864..1731
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       865
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193515151"
     variation       866
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457022289"
     variation       869
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407171241"
     variation       870..876
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ata"
                     /replace="ataaata"
                     /db_xref="dbSNP:1410263007"
     variation       870
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484537441"
     variation       871
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779591294"
     variation       873..876
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aata"
                     /db_xref="dbSNP:774484343"
     variation       874
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210752666"
     variation       876
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346222240"
     variation       877..880
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="gatt"
                     /db_xref="dbSNP:1240110785"
     variation       882..884
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1161999795"
     variation       882
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1322275300"
     variation       886
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335325956"
     variation       888
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769017086"
     variation       893
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749715663"
     variation       894
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755866468"
     variation       895..906
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="atg"
                     /replace="atgatccatatg"
                     /db_xref="dbSNP:1329394537"
     variation       895..896
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="at"
                     /replace="ataat"
                     /db_xref="dbSNP:1373474133"
     variation       895
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542463893"
     variation       896
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145412104"
     variation       897..898
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="tttttt"
                     /db_xref="dbSNP:771313026"
     variation       900
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960235172"
     variation       901
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454009624"
     variation       902
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362811635"
     variation       905
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580864222"
     variation       906
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743131833"
     variation       909..912
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1743131212"
     variation       914
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756782808"
     variation       916
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368786771"
     variation       918
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257572242"
     variation       926
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919152018"
     variation       928
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489193688"
     variation       929
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034387973"
     variation       930..931
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:749720138"
     variation       931
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484974307"
     variation       932
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112503088"
     variation       934
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001989973"
     variation       935
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899250076"
     variation       938
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762786158"
     variation       948
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1016654387"
     variation       950
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141551708"
     variation       952
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206028496"
     variation       954
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752602369"
     variation       955
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147863579"
     variation       956
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004913643"
     variation       957
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207772442"
     variation       958
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759344010"
     variation       959
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161689071"
     variation       960
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743117164"
     variation       963
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1386097326"
     variation       968
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:528929654"
     variation       969..970
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1580863575"
     variation       972
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743115124"
     variation       974
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1001577205"
     variation       976
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334649862"
     variation       982
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773588233"
     variation       984
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772376049"
     variation       985
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414102882"
     variation       987
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1350727271"
     variation       991
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762026997"
     variation       993
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774554899"
     variation       994
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749758005"
     variation       996
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746284263"
     variation       998
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775999649"
     variation       1000
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375568861"
     variation       1002
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746181867"
     variation       1006
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163495587"
     variation       1008
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228791496"
     variation       1009
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933805256"
     variation       1010
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1279834410"
     variation       1013
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487486189"
     variation       1015
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244285837"
     variation       1019
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:36068055"
     variation       1025
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756880796"
     variation       1030..1033
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1743101471"
     variation       1035
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1260071196"
     variation       1036
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746580111"
     variation       1037
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469027129"
     variation       1038
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777142009"
     variation       1040
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757857332"
     variation       1041
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1472961778"
     variation       1042
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748983371"
     variation       1044
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942422849"
     variation       1045
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752587413"
     variation       1049..1053
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1410026237"
     variation       1049
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765169647"
     variation       1050
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743095898"
     variation       1054
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554102945"
     variation       1055
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743094716"
     variation       1056
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754847602"
     variation       1057
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753650693"
     variation       1060
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149505574"
     variation       1061
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172922491"
     variation       1062
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394689518"
     variation       1070
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762116904"
     variation       1071..1074
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="t"
                     /replace="tatt"
                     /db_xref="dbSNP:1743090541"
     variation       1071
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459452062"
     variation       1072
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774559990"
     variation       1073
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743091117"
     variation       1085
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1649200052"
     variation       1086
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743090066"
     variation       1088
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329637299"
     variation       1090
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904709766"
     variation       1094
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743088868"
     variation       1097
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1039179836"
     variation       1098
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2150328447"
     variation       1099
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1312201262"
     variation       1102..1104
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1561607792"
     variation       1103..1105
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="cat"
                     /db_xref="dbSNP:1743086947"
     variation       1108
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743086428"
     variation       1111
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743085588"
     variation       1115
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743084567"
     variation       1116
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370569166"
     variation       1119
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743083080"
     variation       1121
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1743082614"
     variation       1122
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978818163"
     variation       1123
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577792004"
     variation       1124
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349464377"
     variation       1125
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:945753719"
     variation       1126
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913482577"
     variation       1129..1135
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="gccatct"
                     /db_xref="dbSNP:3050538"
     variation       1129..1135
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gccatct"
                     /replace="gccatctgccatct"
                     /db_xref="dbSNP:2150328214"
     variation       1129
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1580862389"
     variation       1133..1136
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="t"
                     /replace="tctt"
                     /db_xref="dbSNP:764130293"
     variation       1134..1140
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ctt"
                     /replace="cttactt"
                     /db_xref="dbSNP:750310884"
     variation       1134
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993073629"
     variation       1135
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199686668"
     variation       1137
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960287476"
     variation       1138
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557852862"
     variation       1143
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150328136"
     variation       1148
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217910725"
     variation       1149
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11952932"
     variation       1153
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743074804"
     variation       1154
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207342510"
     variation       1156
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051477604"
     variation       1161
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980313749"
     variation       1163
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379083883"
     variation       1165
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743072067"
     variation       1166
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771152778"
     variation       1168
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476923760"
     variation       1170
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963780201"
     variation       1184
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1172842501"
     variation       1186
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743069976"
     variation       1192
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743069574"
     variation       1194
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743069146"
     variation       1195
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743068751"
     variation       1203
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016373653"
     variation       1217
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743067853"
     variation       1221
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743067391"
     variation       1222
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743066970"
     variation       1226
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743066553"
     variation       1227
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743066123"
     variation       1229
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377015673"
     variation       1230
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743065238"
     variation       1231
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431598611"
     variation       1232
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476832769"
     variation       1243
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743063753"
     variation       1244
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743063346"
     variation       1247
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743062908"
     variation       1249
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743062518"
     variation       1263
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005290916"
     variation       1266
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743061710"
     variation       1269
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743061305"
     variation       1273
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395176719"
     variation       1274..1275
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1743060475"
     variation       1276
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950730610"
     variation       1277
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918903214"
     variation       1281..1285
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="cttac"
                     /replace="cttacttac"
                     /db_xref="dbSNP:1743058362"
     variation       1283
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743059183"
     variation       1284
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1580861850"
     variation       1285
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743057940"
     variation       1286
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1030344060"
     variation       1289
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:998061561"
     variation       1292
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743056633"
     variation       1294
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743056190"
     variation       1297..1301
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttctt"
                     /db_xref="dbSNP:1379062344"
     variation       1300
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743055799"
     variation       1307
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232536793"
     variation       1308
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743054584"
     variation       1310
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901106029"
     variation       1317..1319
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:2150327537"
     variation       1324
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303180714"
     variation       1330
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743053398"
     variation       1334
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963227783"
     variation       1352
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039911851"
     variation       1353
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926467233"
     variation       1354
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743050692"
     variation       1356..1357
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1743050266"
     variation       1358
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1231285212"
     variation       1360
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743049462"
     variation       1362
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138007557"
     variation       1364
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743048540"
     variation       1365
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338827386"
     variation       1369
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1210597400"
     variation       1369
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743047305"
     variation       1371
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1743046847"
     variation       1372
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150327342"
     variation       1374..1377
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1743045993"
     variation       1374
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269715863"
     variation       1378
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260858610"
     variation       1384
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150327288"
     variation       1388
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195775126"
     variation       1389
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970156172"
     variation       1395
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2150327248"
     variation       1396
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743044194"
     variation       1406
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555421066"
     variation       1413
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743043231"
     variation       1414
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743042786"
     variation       1416
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743042345"
     variation       1418
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743041595"
     variation       1421
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1248470707"
     variation       1424
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:535728857"
     variation       1426
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743040225"
     variation       1427
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743039797"
     variation       1430
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743039346"
     variation       1436
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743038929"
     variation       1442
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743038506"
     variation       1447
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743038099"
     variation       1448..1451
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1743037214"
     variation       1449
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743037649"
     variation       1452..1453
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1743036202"
     variation       1452
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181291384"
     variation       1455
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:956248428"
     variation       1456
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457981299"
     variation       1457
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191377833"
     variation       1458..1462
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ta"
                     /replace="taata"
                     /db_xref="dbSNP:1743032082"
     variation       1458
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743033537"
     variation       1460
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539417576"
     variation       1464
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1164554935"
     variation       1466
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743030703"
     variation       1468
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042853202"
     variation       1471
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199984915"
     variation       1482
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1388092390"
     variation       1488
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743028067"
     variation       1492
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1343109599"
     variation       1493
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031647042"
     variation       1494
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437815344"
     variation       1495
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743024787"
     variation       1498
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743024219"
     variation       1500
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743023557"
     variation       1501
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294075340"
     variation       1507
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945709709"
     variation       1509
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150326827"
     variation       1510
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743021901"
     variation       1511
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326412701"
     variation       1513
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743021208"
     variation       1516
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000450375"
     variation       1517..1518
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1743019563"
     variation       1519
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374187039"
     variation       1526
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1743018191"
     variation       1532
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743017506"
     variation       1533
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354485971"
     variation       1534
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056728221"
     variation       1540
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743016253"
     variation       1541
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213331032"
     variation       1546
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268486647"
     variation       1557
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743014908"
     variation       1559..1560
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1743014111"
     variation       1559
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743014523"
     variation       1560
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1039250611"
     variation       1561
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743013272"
     variation       1565
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743012845"
     variation       1573
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186533991"
     variation       1577
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743011987"
     variation       1580
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743011557"
     variation       1584..1587
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1743010647"
     variation       1584
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1340299966"
     variation       1587
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743010222"
     variation       1592
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424395658"
     variation       1593
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532743192"
     variation       1594..1601
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tatta"
                     /replace="tattatta"
                     /db_xref="dbSNP:1743008574"
     variation       1595
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366225240"
     variation       1600..1604
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ta"
                     /replace="taata"
                     /db_xref="dbSNP:1159449444"
     variation       1601
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460556343"
     variation       1604..1610
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="at"
                     /replace="atatcat"
                     /db_xref="dbSNP:1459141015"
     variation       1605
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389766148"
     variation       1606
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743006871"
     variation       1609
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743006467"
     variation       1613
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927562539"
     variation       1614
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2150326376"
     variation       1615
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743005152"
     variation       1616
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743004554"
     variation       1619
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1287552641"
     variation       1621
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361828535"
     variation       1623
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980658237"
     variation       1627
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314885435"
     variation       1628
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743001315"
     variation       1632
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743000469"
     variation       1637
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1353680059"
     variation       1640
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1327594781"
     variation       1641
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051966282"
     variation       1646
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289235686"
     variation       1647..1653
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="atta"
                     /replace="attatta"
                     /db_xref="dbSNP:1331567359"
     variation       1650
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1742997647"
     variation       1652
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742996975"
     variation       1654
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742995591"
     variation       1657
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1742994796"
     variation       1658
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:929048520"
     variation       1660
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369693784"
     variation       1678
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259977140"
     variation       1685
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1483507690"
     variation       1686
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202138533"
     variation       1687
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742990821"
     variation       1691..1694
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:897488737"
     variation       1699
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176718170"
     variation       1705..1713
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaat"
                     /replace="aaataaaat"
                     /db_xref="dbSNP:1421192369"
     regulatory      1706..1711
                     /regulatory_class="polyA_signal_sequence"
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="hexamer: AATAAA"
     variation       1707
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464857841"
     variation       1712..1717
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="att"
                     /replace="attatt"
                     /db_xref="dbSNP:1580860318"
     variation       1720
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1742987371"
     variation       1721
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742986932"
     variation       1728
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879097828"
     variation       1729
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182336846"
     polyA_site      1731
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="major polyA site"
ORIGIN      
gcagaagtccggggctggcaagcgcttcctgcgcagcgcctaggcgacctggagtttgtgacgctgtgatggtctagaggctggagattcaagatctgggtgccatcattttctggttctgttgatgaccctcttccaggttacatacagcttacatcttgcatcctcaagcgtttttcttataaggctaaaaattcacaaagcatatatcaatgaatcaggaggatctagatccggatagtactacagatgtgggagatgttacaaatactgaagaagaacttattagagaatgtgaagaaatgtggaaagatatggaagaatgtcagaataaattatcacttattggaactgaaacactcaccgattcaaatgctcagctatcattgttaattatgcaagtaaaatgtttaaccgctgaactcagtcaatggcagaaaaaaacacctgaaacaattcccttgactgaagacgttctcataacattaggaaaagaagagttccaaaagctgagacaagatcttgaaatggtactgtccactaaggagtcaaagaatgaaaagttaaaggaagacttagaaagggaacaacggtggttggatgaacagcaacagataatggaatctcttaatgtactacacagtgaattgaaaaataaggttgaaacattttctgaatcaagaatctttaatgaactgaaaactaaaatgcttaatataaaagaatataaggagaaactcttgagtaccttgggcgagtttctagaagaccattttcctctgcctgatagaagtgttaaaaagaaaaagaaaaacattcaagaatcatctgtaaacctgataacactgcatgaaatgttagagattcttataaatagattatttgatgttccacatgatccatatgtcaaaattagtgattccttttggccaccttatgttgagctgctgctgcgtaatggaattgccttgagacatccagaagatccaacccgaataagattagaagctttccatcagtaaaaggatgttttcttttttcacacagtaaaaattcttatcattcaaggatattggaaccacaggactatttggataaaaaacattatttgcaaattaatgcgcataggccatcttacttttattgcaaaatggcatgtgctgccatctattattcatttttaaatggtcatttcttattcagtgagtgctttagtgttttaaactatatggataagaatgcaggtagataatattctaggcataaaacatttaatgtaccttacctcatgcaatattctttggattctttgttgatttatgatattgctaatataatattttcttaaaatatataacaatatcttttatgcattttgagttccagctggtgcttctttatatttagaaattataatgggaaggtcatttaatttacagatggttttaaaattgaggtaatatctgaggtggcataatttaaaaatatttagcaaatttgtttcatatatactgtcttatttctagatttgtttaaaattggaatatgaaaaactaatggataaagctagcataaaattgatattttagtttgtattattaatatatcatgttaccttatatattaatctactcttgattctgctaattattaccaacaaaattgtattcatgacattttattaatcctctgtgaattttctgtaaataaaattatttctgaaaatctcta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]