GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-14 00:07:30, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_012146               1227 bp    mRNA    linear   PRI 20-DEC-2022
DEFINITION  Homo sapiens double homeobox 1 (DUX1), mRNA.
ACCESSION   NM_012146
VERSION     NM_012146.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1227)
  AUTHORS   Ansseau E, Eidahl JO, Lancelot C, Tassin A, Matteotti C, Yip C, Liu
            J, Leroy B, Hubeau C, Gerbaux C, Cloet S, Wauters A, Zorbo S, Meyer
            P, Pirson I, Laoudj-Chenivesse D, Wattiez R, Harper SQ, Belayew A
            and Coppee F.
  TITLE     Homologous Transcription Factors DUX4 and DUX4c Associate with
            Cytoplasmic Proteins during Muscle Differentiation
  JOURNAL   PLoS One 11 (1), e0146893 (2016)
   PUBMED   26816005
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1227)
  AUTHORS   Ostlund C, Garcia-Carrasquillo RM, Belayew A and Worman HJ.
  TITLE     Intracellular trafficking and dynamics of double homeodomain
            proteins
  JOURNAL   Biochemistry 44 (7), 2378-2384 (2005)
   PUBMED   15709750
  REMARK    GeneRIF: Report shows that full-length DUX1 is actively transported
            into the nuclei of transfected C2C12 myoblasts, and that DUX1
            homeodomains contain the signals required for this localization.
REFERENCE   3  (bases 1 to 1227)
  AUTHORS   Beckers M, Gabriels J, van der Maarel S, De Vriese A, Frants RR,
            Collen D and Belayew A.
  TITLE     Active genes in junk DNA? Characterization of DUX genes embedded
            within 3.3 kb repeated elements
  JOURNAL   Gene 264 (1), 51-57 (2001)
   PUBMED   11245978
REFERENCE   4  (bases 1 to 1227)
  AUTHORS   Ding H, Beckers MC, Plaisance S, Marynen P, Collen D and Belayew A.
  TITLE     Characterization of a double homeodomain protein (DUX1) encoded by
            a cDNA homologous to 3.3 kb dispersed repeated elements
  JOURNAL   Hum Mol Genet 7 (11), 1681-1694 (1998)
   PUBMED   9736770
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AJ001481.1.
            
            Summary: The human genome contains hundreds of repeats of the
            3.3-kb family in regions associated with heterochromatin. The DUX
            gene family, including DUX1, resides within these 3.3-kb repeated
            elements (Beckers et al., 2001 [PubMed 11245978]). See DUX4 (MIM
            606009).[supplied by OMIM, Mar 2008].
            
            ##Evidence-Data-START##
            Transcript is intronless :: AJ001481.1 [ECO:0000345]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1227              AJ001481.1         1-1227
FEATURES             Location/Qualifiers
     source          1..1227
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10"
     gene            1..1227
                     /gene="DUX1"
                     /note="double homeobox 1"
                     /db_xref="GeneID:26584"
                     /db_xref="HGNC:HGNC:3079"
                     /db_xref="MIM:611441"
     CDS             113..625
                     /gene="DUX1"
                     /codon_start=1
                     /product="double homeobox protein 1"
                     /protein_id="NP_036278.1"
                     /db_xref="GeneID:26584"
                     /db_xref="HGNC:HGNC:3079"
                     /db_xref="MIM:611441"
                     /translation="
MALLTALDDTLPEEAQGPGRRMILLSTPSQSDALRACFERNLYPGIATKEELAQGIDIPEPRVQIWFQNERSCQLRQHRRQSRPWPGRRDPQKGRRKRTAITGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHRGQSGRAPTQASIRCNAAPIG"
     misc_feature    191..328
                     /gene="DUX1"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cl00084"
                     /db_xref="CDD:444687"
     misc_feature    335..412
                     /gene="DUX1"
                     /note="propagated from UniProtKB/Swiss-Prot (O43812.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    order(395..409,413..415,464..466,482..484,521..523,
                     527..532,539..544,548..556,560..565)
                     /gene="DUX1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    401..562
                     /gene="DUX1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(401..403,410..412,530..532,539..544,551..553)
                     /gene="DUX1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
caggcctcctggcagcacctgcgcagtgaacaggctggctgaggtgcacgggagcccgcccgcctctctctgcccgtgtcagtccgtgaaattccggccggggctccctgagatggccctcctgacagctttggacgacaccctccccgaggaagcccagggaccgggaaggcgaatgatactcctttcgaccccgagtcaaagtgatgccctgcgagcctgctttgagcggaacctgtacccgggcattgccaccaaagaagagctggcccagggcatcgacattccggagcccagggtccagatttggtttcagaatgagagatcatgccagttgaggcagcaccggcggcaatctcggccctggcccgggagacgtgacccgcaaaaaggcagacgaaagcggactgccatcaccggatcccaaaccgccctgctcctccgagcctttgagaaggatcgctttccaggcattgctgccagggaagagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagagccaggcaccggggacagtctggcagggcgcccacgcaggcaagcatccggtgcaatgcagccccaattgggtgacaccctgctctctcgtgggtcgcctttgcccacactggcgcatggggaaaggggcttcctgcaccacacatgctctcccacagtgggctttcgtgagccatggattgagggccgtccctgtgctcctgcccagccaggccgcgcaggcagaagggatctcccaacctgccccagcacatggggattttgcctacaccgcccaggctcctccagaaggggcgctctcccacactcacactcctaggtggcatccacacaagggcaaaatccggaaggactgggacgcgcagcgcgacggccttccgggcacttgcgcggtgggacagcctgggccctctcaagcggggccacagggccaaggtgtgcttgcgccacccgcgtcccagggaagtccgtggtgggggtggagcaggggtacccaggtcgccggtgtggcgtggaacctcaagcaggggcaattccacctcaccagcccacgcccccagaggcctccacacggcaggggcagatgcaaggcatctcagcaccctcccaggcgctcctggagccagggtgctcgtctgcactccactccatcctgctgctggatgagctcctggcga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]