2024-05-14 00:07:30, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_012146 1227 bp mRNA linear PRI 20-DEC-2022 DEFINITION Homo sapiens double homeobox 1 (DUX1), mRNA. ACCESSION NM_012146 VERSION NM_012146.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1227) AUTHORS Ansseau E, Eidahl JO, Lancelot C, Tassin A, Matteotti C, Yip C, Liu J, Leroy B, Hubeau C, Gerbaux C, Cloet S, Wauters A, Zorbo S, Meyer P, Pirson I, Laoudj-Chenivesse D, Wattiez R, Harper SQ, Belayew A and Coppee F. TITLE Homologous Transcription Factors DUX4 and DUX4c Associate with Cytoplasmic Proteins during Muscle Differentiation JOURNAL PLoS One 11 (1), e0146893 (2016) PUBMED 26816005 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 1227) AUTHORS Ostlund C, Garcia-Carrasquillo RM, Belayew A and Worman HJ. TITLE Intracellular trafficking and dynamics of double homeodomain proteins JOURNAL Biochemistry 44 (7), 2378-2384 (2005) PUBMED 15709750 REMARK GeneRIF: Report shows that full-length DUX1 is actively transported into the nuclei of transfected C2C12 myoblasts, and that DUX1 homeodomains contain the signals required for this localization. REFERENCE 3 (bases 1 to 1227) AUTHORS Beckers M, Gabriels J, van der Maarel S, De Vriese A, Frants RR, Collen D and Belayew A. TITLE Active genes in junk DNA? Characterization of DUX genes embedded within 3.3 kb repeated elements JOURNAL Gene 264 (1), 51-57 (2001) PUBMED 11245978 REFERENCE 4 (bases 1 to 1227) AUTHORS Ding H, Beckers MC, Plaisance S, Marynen P, Collen D and Belayew A. TITLE Characterization of a double homeodomain protein (DUX1) encoded by a cDNA homologous to 3.3 kb dispersed repeated elements JOURNAL Hum Mol Genet 7 (11), 1681-1694 (1998) PUBMED 9736770 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AJ001481.1. Summary: The human genome contains hundreds of repeats of the 3.3-kb family in regions associated with heterochromatin. The DUX gene family, including DUX1, resides within these 3.3-kb repeated elements (Beckers et al., 2001 [PubMed 11245978]). See DUX4 (MIM 606009).[supplied by OMIM, Mar 2008]. ##Evidence-Data-START## Transcript is intronless :: AJ001481.1 [ECO:0000345] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1227 AJ001481.1 1-1227 FEATURES Location/Qualifiers source 1..1227 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="10" /map="10" gene 1..1227 /gene="DUX1" /note="double homeobox 1" /db_xref="GeneID:26584" /db_xref="HGNC:HGNC:3079" /db_xref="MIM:611441" CDS 113..625 /gene="DUX1" /codon_start=1 /product="double homeobox protein 1" /protein_id="NP_036278.1" /db_xref="GeneID:26584" /db_xref="HGNC:HGNC:3079" /db_xref="MIM:611441" /translation="
MALLTALDDTLPEEAQGPGRRMILLSTPSQSDALRACFERNLYPGIATKEELAQGIDIPEPRVQIWFQNERSCQLRQHRRQSRPWPGRRDPQKGRRKRTAITGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHRGQSGRAPTQASIRCNAAPIG"
misc_feature 191..328 /gene="DUX1" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cl00084" /db_xref="CDD:444687" misc_feature 335..412 /gene="DUX1" /note="propagated from UniProtKB/Swiss-Prot (O43812.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature order(395..409,413..415,464..466,482..484,521..523, 527..532,539..544,548..556,560..565) /gene="DUX1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 401..562 /gene="DUX1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(401..403,410..412,530..532,539..544,551..553) /gene="DUX1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" ORIGIN
caggcctcctggcagcacctgcgcagtgaacaggctggctgaggtgcacgggagcccgcccgcctctctctgcccgtgtcagtccgtgaaattccggccggggctccctgagatggccctcctgacagctttggacgacaccctccccgaggaagcccagggaccgggaaggcgaatgatactcctttcgaccccgagtcaaagtgatgccctgcgagcctgctttgagcggaacctgtacccgggcattgccaccaaagaagagctggcccagggcatcgacattccggagcccagggtccagatttggtttcagaatgagagatcatgccagttgaggcagcaccggcggcaatctcggccctggcccgggagacgtgacccgcaaaaaggcagacgaaagcggactgccatcaccggatcccaaaccgccctgctcctccgagcctttgagaaggatcgctttccaggcattgctgccagggaagagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagagccaggcaccggggacagtctggcagggcgcccacgcaggcaagcatccggtgcaatgcagccccaattgggtgacaccctgctctctcgtgggtcgcctttgcccacactggcgcatggggaaaggggcttcctgcaccacacatgctctcccacagtgggctttcgtgagccatggattgagggccgtccctgtgctcctgcccagccaggccgcgcaggcagaagggatctcccaacctgccccagcacatggggattttgcctacaccgcccaggctcctccagaaggggcgctctcccacactcacactcctaggtggcatccacacaagggcaaaatccggaaggactgggacgcgcagcgcgacggccttccgggcacttgcgcggtgggacagcctgggccctctcaagcggggccacagggccaaggtgtgcttgcgccacccgcgtcccagggaagtccgtggtgggggtggagcaggggtacccaggtcgccggtgtggcgtggaacctcaagcaggggcaattccacctcaccagcccacgcccccagaggcctccacacggcaggggcagatgcaaggcatctcagcaccctcccaggcgctcctggagccagggtgctcgtctgcactccactccatcctgctgctggatgagctcctggcga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]