GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-10 18:03:55, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001267038            1697 bp    mRNA    linear   PRI 02-AUG-2023
DEFINITION  Homo sapiens centromere protein K (CENPK), transcript variant 2,
            mRNA.
ACCESSION   NM_001267038
VERSION     NM_001267038.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1697)
  AUTHORS   Li X, Han YR, Xuefeng X, Ma YX, Xing GS, Yang ZW, Zhang Z, Shi L
            and Wu XL.
  TITLE     Lentivirus-mediated short hairpin RNA interference of CENPK
            inhibits growth of colorectal cancer cells with overexpression of
            Cullin 4A
  JOURNAL   World J Gastroenterol 28 (37), 5420-5443 (2022)
   PUBMED   36312839
  REMARK    GeneRIF: Lentivirus-mediated short hairpin RNA interference of
            CENPK inhibits growth of colorectal cancer cells with
            overexpression of Cullin 4A.
REFERENCE   2  (bases 1 to 1697)
  AUTHORS   Tian T, Chen L, Dou Z, Yang Z, Gao X, Yuan X, Wang C, Liu R, Shen
            Z, Gui P, Teng M, Meng X, Hill DL, Li L, Zhang X, Liu X, Sun L,
            Zang J and Yao X.
  TITLE     Structural insights into human CCAN complex assembled onto DNA
  JOURNAL   Cell Discov 8 (1), 90 (2022)
   PUBMED   36085283
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1697)
  AUTHORS   Tian H, Wang F, Deng Y, Ying L, Fang W, Chen D, Miao C, Li H, Sun
            S, Ma Y, Cai H and Guo T.
  TITLE     Centromeric protein K (CENPK) promotes gastric cancer proliferation
            and migration via interacting with XRCC5
  JOURNAL   Gastric Cancer 25 (5), 879-895 (2022)
   PUBMED   35715658
  REMARK    GeneRIF: Centromeric protein K (CENPK) promotes gastric cancer
            proliferation and migration via interacting with XRCC5.
REFERENCE   4  (bases 1 to 1697)
  AUTHORS   Lin X, Wang F, Chen J, Liu J, Lin YB, Li L, Chen CB and Xu Q.
  TITLE     N6-methyladenosine modification of CENPK mRNA by ZC3H13 promotes
            cervical cancer stemness and chemoresistance
  JOURNAL   Mil Med Res 9 (1), 19 (2022)
   PUBMED   35418160
  REMARK    GeneRIF: N(6)-methyladenosine modification of CENPK mRNA by ZC3H13
            promotes cervical cancer stemness and chemoresistance.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1697)
  AUTHORS   Li Q, Liang J, Zhang S, An N, Xu L and Ye C.
  TITLE     Overexpression of centromere protein K (CENPK) gene in
            Differentiated Thyroid Carcinoma promote cell Proliferation and
            Migration
  JOURNAL   Bioengineered 12 (1), 1299-1310 (2021)
   PUBMED   33904381
  REMARK    GeneRIF: Overexpression of centromere protein K (CENPK) gene in
            Differentiated Thyroid Carcinoma promote cell Proliferation and
            Migration.
REFERENCE   6  (bases 1 to 1697)
  AUTHORS   Okada M, Cheeseman IM, Hori T, Okawa K, McLeod IX, Yates JR 3rd,
            Desai A and Fukagawa T.
  TITLE     The CENP-H-I complex is required for the efficient incorporation of
            newly synthesized CENP-A into centromeres
  JOURNAL   Nat Cell Biol 8 (5), 446-457 (2006)
   PUBMED   16622420
REFERENCE   7  (bases 1 to 1697)
  AUTHORS   Foltz DR, Jansen LE, Black BE, Bailey AO, Yates JR 3rd and
            Cleveland DW.
  TITLE     The human CENP-A centromeric nucleosome-associated complex
  JOURNAL   Nat Cell Biol 8 (5), 458-469 (2006)
   PUBMED   16622419
REFERENCE   8  (bases 1 to 1697)
  AUTHORS   Obuse C, Yang H, Nozaki N, Goto S, Okazaki T and Yoda K.
  TITLE     Proteomics analysis of the centromere complex from HeLa interphase
            cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of
            the CEN-complex, while BMI-1 is transiently co-localized with the
            centromeric region in interphase
  JOURNAL   Genes Cells 9 (2), 105-120 (2004)
   PUBMED   15009096
REFERENCE   9  (bases 1 to 1697)
  AUTHORS   Yamashita A, Ito M, Takamatsu N and Shiba T.
  TITLE     Characterization of Solt, a novel SoxLZ/Sox6 binding protein
            expressed in adult mouse testis
  JOURNAL   FEBS Lett 481 (2), 147-151 (2000)
   PUBMED   10996314
REFERENCE   10 (bases 1 to 1697)
  AUTHORS   Taki T, Hayashi Y, Taniwaki M, Seto M, Ueda R, Hanada R, Suzukawa
            K, Yokota J and Morishita K.
  TITLE     Fusion of the MLL gene with two different genes, AF-6 and
            AF-5alpha, by a complex translocation involving chromosomes 5, 6, 8
            and 11 in infant leukemia
  JOURNAL   Oncogene 13 (10), 2121-2130 (1996)
   PUBMED   8950979
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BG502832.1, BC005400.1 and BC008504.1.
            
            On May 31, 2019 this sequence version replaced NM_001267038.1.
            
            Summary: CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM
            300065)-associated centromeric complex that targets CENPA (MIM
            117139) to centromeres and is required for proper kinetochore
            function and mitotic progression (Okada et al., 2006 [PubMed
            16622420]).[supplied by OMIM, Mar 2008].
            
            Transcript Variant: This variant (2) differs in the 5' UTR compared
            to variant 1. Variants 1 and 2 encode the same isoform (1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF315941.1, SRR7346977.403996.1
                                           [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA1965299,
                                           SAMEA1966682 [ECO:0006172]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-56                BG502832.1         2-57
            57-1094             BC005400.1         47-1084
            1095-1697           BC008504.1         1129-1731
FEATURES             Location/Qualifiers
     source          1..1697
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q12.3"
     gene            1..1697
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="centromere protein K"
                     /db_xref="GeneID:64105"
                     /db_xref="HGNC:HGNC:29479"
                     /db_xref="MIM:611502"
     exon            1..71
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359976795"
     variation       2
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313487734"
     variation       3
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1752349587"
     variation       6
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752348893"
     variation       7
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752348579"
     variation       8
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306504051"
     variation       9
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342831242"
     variation       11..20
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ggggctggca"
                     /replace="ggggctggcaggggctggca"
                     /db_xref="dbSNP:1485277906"
     variation       11
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752347563"
     variation       12
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231982437"
     variation       13
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028359789"
     variation       14
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542352928"
     variation       15
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210224911"
     variation       19
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265798087"
     variation       21
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1752345149"
     variation       22..25
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gc"
                     /replace="gcgc"
                     /db_xref="dbSNP:1257636747"
     variation       24
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1226707165"
     variation       28
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752344063"
     variation       29
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752343711"
     variation       30
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748792667"
     variation       31
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422047918"
     variation       32
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412446096"
     variation       33
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473419782"
     variation       34
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150581284"
     variation       35
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1752342051"
     variation       36
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1343690787"
     variation       37
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140804671"
     variation       39
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553552680"
     variation       40
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1752340528"
     variation       41
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9791024"
     variation       42
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404435189"
     variation       45
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413477558"
     variation       46
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1011178654"
     variation       48
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892736211"
     variation       49
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293152372"
     variation       50
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1752337962"
     variation       52
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004353263"
     variation       53
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364825946"
     variation       55
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1752336831"
     variation       56
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41268429"
     variation       61
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027093258"
     variation       62
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003673595"
     variation       63
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995243929"
     variation       64
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558001621"
     variation       69
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368732818"
     variation       71
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157875168"
     exon            72..139
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       72
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548499564"
     variation       75..77
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tag"
                     /replace="tagttag"
                     /db_xref="dbSNP:1038778849"
     variation       77
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757254302"
     variation       84
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1751964644"
     variation       85
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225478568"
     variation       86
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375448951"
     variation       90
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1751963569"
     variation       93
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001509723"
     variation       94
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445804221"
     variation       99
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171663462"
     variation       101
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1581126138"
     variation       103
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374448596"
     variation       104
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906122153"
     variation       107
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:902390139"
     variation       114
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470058908"
     variation       115
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1751960081"
     variation       119
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1581126047"
     variation       127
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2150571791"
     variation       129
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358207757"
     variation       130
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173365559"
     variation       131
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1751958616"
     variation       133
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330586449"
     variation       134
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337771016"
     variation       135
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401876701"
     variation       137
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440214129"
     exon            140..289
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       144
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443766369"
     variation       147
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750737523"
     variation       148..151
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ataa"
                     /replace="ataataa"
                     /db_xref="dbSNP:1256234642"
     variation       148
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760138230"
     variation       152
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542351057"
     misc_feature    155..157
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="upstream in-frame stop codon"
     variation       159
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:551599072"
     variation       160
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184278791"
     variation       161
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1164611338"
     variation       166
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748100479"
     variation       167
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411927803"
     variation       169
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988842021"
     variation       171
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172936444"
     variation       173
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778744562"
     variation       176
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1403246344"
     variation       178
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486299502"
     CDS             179..988
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="isoform 1 is encoded by transcript variant 2;
                     leucine zipper protein FKSG14; SoxLZ/Sox6-binding protein
                     Solt; protein AF-5alpha; interphase centromere complex
                     protein 37"
                     /codon_start=1
                     /product="centromere protein K isoform 1"
                     /protein_id="NP_001253967.1"
                     /db_xref="CCDS:CCDS3984.1"
                     /db_xref="GeneID:64105"
                     /db_xref="HGNC:HGNC:29479"
                     /db_xref="MIM:611502"
                     /translation="
MNQEDLDPDSTTDVGDVTNTEEELIRECEEMWKDMEECQNKLSLIGTETLTDSNAQLSLLIMQVKCLTAELSQWQKKTPETIPLTEDVLITLGKEEFQKLRQDLEMVLSTKESKNEKLKEDLEREQRWLDEQQQIMESLNVLHSELKNKVETFSESRIFNELKTKMLNIKEYKEKLLSTLGEFLEDHFPLPDRSVKKKKKNIQESSVNLITLHEMLEILINRLFDVPHDPYVKISDSFWPPYVELLLRNGIALRHPEDPTRIRLEAFHQ"
     misc_feature    179..238
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9BS16.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    206..985
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="Centromere-associated protein K; Region: CENP-K;
                     pfam11802"
                     /db_xref="CDD:432085"
     misc_feature    464..469
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="Breakpoint for translocation to form
                     KMT2A/MLL1-CENPK oncogene; propagated from
                     UniProtKB/Swiss-Prot (Q9BS16.1); other site"
     variation       179
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750731325"
     variation       181
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749023060"
     variation       185
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139570970"
     variation       189
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757460492"
     variation       191
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777895549"
     variation       195
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2096371242"
     variation       197
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:935938524"
     variation       200
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150532568"
     variation       201
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758896315"
     variation       202
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75497175"
     variation       204
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216026136"
     variation       207
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371070860"
     variation       214
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750726023"
     variation       215
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760004670"
     variation       216
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750725249"
     variation       224
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397513933"
     variation       225
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750724525"
     variation       226
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754218341"
     variation       227
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766178671"
     variation       231
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760347848"
     variation       233
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348543974"
     variation       236..240
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="actga"
                     /db_xref="dbSNP:1429400174"
     variation       238
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772652364"
     variation       239..247
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gaagaa"
                     /replace="gaagaagaa"
                     /db_xref="dbSNP:1347528124"
     variation       244
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423115596"
     variation       245
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750721303"
     variation       248
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150574725"
     variation       250
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201745679"
     variation       252
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481438294"
     variation       253
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774283954"
     variation       254
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141729484"
     variation       257
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206680426"
     variation       261
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1581093357"
     variation       267..269
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1437145639"
     variation       267
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248409774"
     variation       268
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750716760"
     variation       270
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749111718"
     variation       274
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750714903"
     variation       275
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263513424"
     variation       278
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775244207"
     variation       281
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771118232"
     variation       282
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747252575"
     variation       287
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868732343"
     exon            290..346
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       290
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750271640"
     variation       291
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543487501"
     variation       292
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043343369"
     variation       293
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750268417"
     variation       304
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448020199"
     variation       305
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762865136"
     variation       308
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775330841"
     variation       310
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148016416"
     variation       311
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750263924"
     variation       312..314
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="ttg"
                     /db_xref="dbSNP:779227890"
     variation       312
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454849271"
     variation       314
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144481454"
     variation       315
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150519689"
     variation       317
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745593902"
     variation       322..333
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aacactcaccga"
                     /db_xref="dbSNP:1242902542"
     variation       324..330
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="cac"
                     /replace="cactcac"
                     /db_xref="dbSNP:757802386"
     variation       324
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946304876"
     variation       326
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138527872"
     variation       328
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339735347"
     variation       330
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2150519582"
     variation       331
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757907403"
     variation       332
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141548635"
     variation       336
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201709067"
     variation       343
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755596314"
     variation       344
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764377925"
     exon            347..419
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       348
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749320661"
     variation       349
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780631678"
     variation       353..357
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:1750067937"
     variation       353
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1750068401"
     variation       361
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750067487"
     variation       363
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532263854"
     variation       364
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328421596"
     variation       365
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750066060"
     variation       367
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1750065565"
     variation       368
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278922834"
     variation       373
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746283375"
     variation       376..378
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1388017290"
     variation       382
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781388497"
     variation       383
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751218204"
     variation       384
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406983239"
     variation       389
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391243960"
     variation       390..396
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tca"
                     /replace="tcagtca"
                     /db_xref="dbSNP:762598205"
     variation       390
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561685621"
     variation       391
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777349763"
     variation       392
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185445391"
     variation       393
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425260470"
     variation       397
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749780402"
     variation       398
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750057694"
     variation       400
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477188242"
     variation       401
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1750056781"
     variation       403
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1750056286"
     variation       404..410
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:750256768"
     variation       406
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377608156"
     variation       410
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549718297"
     variation       411
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1750053838"
     variation       412
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759373577"
     variation       413
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753728671"
     variation       416
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561685364"
     variation       419
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1693238677"
     exon            420..466
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       422
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438182467"
     variation       425
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557986609"
     variation       427
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764452510"
     variation       429
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763064949"
     variation       430
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1483041739"
     variation       431
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748212552"
     variation       434
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748212077"
     variation       435..436
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1403653612"
     variation       439
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765236390"
     variation       440
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548653305"
     variation       442
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771385648"
     variation       443
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1286587676"
     variation       445
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138507676"
     variation       449
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314951065"
     variation       450
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974580309"
     variation       453
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773540586"
     variation       455..456
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1581021207"
     variation       456
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2150453321"
     variation       460
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1581021175"
     variation       462..463
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:779363914"
     variation       462..463
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1748205064"
     variation       463
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228585329"
     exon            467..549
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       469
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393117032"
     variation       472
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180206825"
     variation       478
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150375703"
     variation       482
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773628734"
     variation       486
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237140365"
     variation       495
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1232231851"
     variation       497
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193606113"
     variation       498
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745284481"
     variation       499
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547550705"
     variation       500
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1745283514"
     variation       502
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186908669"
     variation       506
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748490924"
     variation       507
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773901255"
     variation       510
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2150375557"
     variation       516
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768317556"
     variation       517
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561634678"
     variation       519
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748850005"
     variation       522
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745280061"
     variation       523
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145897680"
     variation       524
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753691260"
     variation       529
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376463567"
     variation       530
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327050486"
     variation       532..535
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="aaag"
                     /db_xref="dbSNP:2150375437"
     variation       537
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140748564"
     variation       539
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286143770"
     variation       540
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1745276214"
     variation       541
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745797201"
     variation       542
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302333711"
     variation       544
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434037126"
     variation       546
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1580930674"
     variation       547
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909927578"
     exon            550..648
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       552
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745248317"
     variation       553
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195109001"
     variation       554
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1745247359"
     variation       556
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185309293"
     variation       557
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755218264"
     variation       558
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138940796"
     variation       563
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745244701"
     variation       565
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357350104"
     variation       566
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265044045"
     variation       567
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:892129867"
     variation       568
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561633837"
     variation       569
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867891240"
     variation       569
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1745242213"
     variation       570
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:780195488"
     variation       571..602
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ac"
                     /replace="acagcaacagataatggaatctcttaatgtac"
                     /db_xref="dbSNP:1745237533"
     variation       577
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157077028"
     variation       580
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363410017"
     variation       589
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756212865"
     variation       592
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750466231"
     variation       596
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325715984"
     variation       599
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767952170"
     variation       601
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406824741"
     variation       602
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580929057"
     variation       604
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150254661"
     variation       606
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451415236"
     variation       607
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745235605"
     variation       608
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1580928949"
     variation       609..610
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:749771436"
     variation       609
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751927567"
     variation       610
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141033147"
     variation       615
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775303734"
     variation       616
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1471995857"
     variation       622
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425234534"
     variation       624
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323742457"
     variation       626
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745230797"
     variation       630
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540839130"
     variation       631
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745229775"
     variation       634
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745229292"
     variation       635
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475383930"
     variation       639
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240814809"
     variation       640
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201507225"
     variation       641
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452590609"
     variation       645
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199710596"
     variation       646
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776182305"
     variation       647
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770828450"
     exon            649..775
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       652
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745162523"
     variation       655
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192069105"
     variation       668
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745161624"
     variation       671..674
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1238965408"
     variation       673
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745161152"
     variation       674
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752112029"
     variation       678
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1203948509"
     variation       680
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150372287"
     variation       683
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745159363"
     variation       686
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745158892"
     variation       689
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764451391"
     variation       690
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758865586"
     variation       691
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753079695"
     variation       695
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765028924"
     variation       697
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376864120"
     variation       706
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745154105"
     variation       709..711
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gag"
                     /db_xref="dbSNP:1231746887"
     variation       709
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216777810"
     variation       710
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745152720"
     variation       714
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378696125"
     variation       721
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538146502"
     variation       722
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868259372"
     variation       724
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745150168"
     variation       727
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1745149712"
     variation       728
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765914401"
     variation       729
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185768219"
     variation       732
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569355500"
     variation       733
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377239133"
     variation       734
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773227049"
     variation       736
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1745146291"
     variation       737
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1745145818"
     variation       739
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172188810"
     variation       743
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866918568"
     variation       744
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771962047"
     variation       746
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774114264"
     variation       748
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176885832"
     variation       749
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468783521"
     variation       754
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770061194"
     variation       756
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151068525"
     variation       759
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781204320"
     variation       760
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759021447"
     variation       764..768
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1284629517"
     variation       766
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1745140405"
     variation       770..774
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1745137975"
     variation       770
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757372616"
     variation       775
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409007703"
     exon            776..829
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       776
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213991862"
     variation       777..787
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aa"
                     /replace="aaaacattcaa"
                     /db_xref="dbSNP:1743744485"
     variation       780
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774200181"
     variation       782
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270744844"
     variation       783
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561615890"
     variation       785
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219885542"
     variation       789
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308635150"
     variation       795
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759382373"
     variation       806
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776934831"
     variation       807
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580880398"
     variation       811
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376455824"
     variation       814
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743741013"
     variation       816
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747162578"
     variation       821
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743739935"
     variation       823
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440453004"
     variation       829
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777984796"
     exon            830..1697
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /inference="alignment:Splign:2.1.0"
     variation       831
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193515151"
     variation       832
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457022289"
     variation       835
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407171241"
     variation       836..842
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ata"
                     /replace="ataaata"
                     /db_xref="dbSNP:1410263007"
     variation       836
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484537441"
     variation       837
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779591294"
     variation       839..842
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aata"
                     /db_xref="dbSNP:774484343"
     variation       840
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210752666"
     variation       842
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346222240"
     variation       843..846
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="gatt"
                     /db_xref="dbSNP:1240110785"
     variation       848..850
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1161999795"
     variation       848
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1322275300"
     variation       852
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335325956"
     variation       854
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769017086"
     variation       859
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749715663"
     variation       860
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755866468"
     variation       861..872
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="atg"
                     /replace="atgatccatatg"
                     /db_xref="dbSNP:1329394537"
     variation       861..862
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="at"
                     /replace="ataat"
                     /db_xref="dbSNP:1373474133"
     variation       861
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542463893"
     variation       862
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145412104"
     variation       863..864
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="tttttt"
                     /db_xref="dbSNP:771313026"
     variation       866
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960235172"
     variation       867
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454009624"
     variation       868
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362811635"
     variation       871
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580864222"
     variation       872
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743131833"
     variation       875..878
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1743131212"
     variation       880
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756782808"
     variation       882
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368786771"
     variation       884
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257572242"
     variation       892
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919152018"
     variation       894
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489193688"
     variation       895
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034387973"
     variation       896..897
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:749720138"
     variation       897
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484974307"
     variation       898
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112503088"
     variation       900
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001989973"
     variation       901
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899250076"
     variation       904
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762786158"
     variation       914
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1016654387"
     variation       916
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141551708"
     variation       918
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206028496"
     variation       920
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752602369"
     variation       921
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147863579"
     variation       922
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004913643"
     variation       923
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207772442"
     variation       924
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759344010"
     variation       925
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161689071"
     variation       926
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743117164"
     variation       929
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1386097326"
     variation       934
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:528929654"
     variation       935..936
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1580863575"
     variation       938
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743115124"
     variation       940
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1001577205"
     variation       942
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334649862"
     variation       948
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773588233"
     variation       950
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772376049"
     variation       951
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414102882"
     variation       953
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1350727271"
     variation       957
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762026997"
     variation       959
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774554899"
     variation       960
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749758005"
     variation       962
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746284263"
     variation       964
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775999649"
     variation       966
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375568861"
     variation       968
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746181867"
     variation       972
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163495587"
     variation       974
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228791496"
     variation       975
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933805256"
     variation       976
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1279834410"
     variation       979
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487486189"
     variation       981
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244285837"
     variation       985
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:36068055"
     variation       991
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756880796"
     variation       996..999
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1743101471"
     variation       1001
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1260071196"
     variation       1002
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746580111"
     variation       1003
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469027129"
     variation       1004
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777142009"
     variation       1006
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757857332"
     variation       1007
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1472961778"
     variation       1008
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748983371"
     variation       1010
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942422849"
     variation       1011
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752587413"
     variation       1015..1019
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1410026237"
     variation       1015
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765169647"
     variation       1016
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743095898"
     variation       1020
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554102945"
     variation       1021
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743094716"
     variation       1022
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754847602"
     variation       1023
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753650693"
     variation       1026
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149505574"
     variation       1027
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172922491"
     variation       1028
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394689518"
     variation       1036
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762116904"
     variation       1037..1040
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="t"
                     /replace="tatt"
                     /db_xref="dbSNP:1743090541"
     variation       1037
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459452062"
     variation       1038
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774559990"
     variation       1039
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743091117"
     variation       1051
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1649200052"
     variation       1052
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743090066"
     variation       1054
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329637299"
     variation       1056
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904709766"
     variation       1060
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743088868"
     variation       1063
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1039179836"
     variation       1064
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2150328447"
     variation       1065
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1312201262"
     variation       1068..1070
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1561607792"
     variation       1069..1071
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="cat"
                     /db_xref="dbSNP:1743086947"
     variation       1074
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743086428"
     variation       1077
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743085588"
     variation       1081
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743084567"
     variation       1082
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370569166"
     variation       1085
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743083080"
     variation       1087
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1743082614"
     variation       1088
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978818163"
     variation       1089
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577792004"
     variation       1090
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349464377"
     variation       1091
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:945753719"
     variation       1092
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913482577"
     variation       1095..1101
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="gccatct"
                     /db_xref="dbSNP:3050538"
     variation       1095..1101
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="gccatct"
                     /replace="gccatctgccatct"
                     /db_xref="dbSNP:2150328214"
     variation       1095
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1580862389"
     variation       1099..1102
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="t"
                     /replace="tctt"
                     /db_xref="dbSNP:764130293"
     variation       1100..1106
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ctt"
                     /replace="cttactt"
                     /db_xref="dbSNP:750310884"
     variation       1100
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993073629"
     variation       1101
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199686668"
     variation       1103
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960287476"
     variation       1104
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557852862"
     variation       1109
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150328136"
     variation       1114
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217910725"
     variation       1115
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11952932"
     variation       1119
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743074804"
     variation       1120
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207342510"
     variation       1122
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051477604"
     variation       1127
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980313749"
     variation       1129
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379083883"
     variation       1131
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743072067"
     variation       1132
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771152778"
     variation       1134
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476923760"
     variation       1136
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963780201"
     variation       1150
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1172842501"
     variation       1152
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743069976"
     variation       1158
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743069574"
     variation       1160
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743069146"
     variation       1161
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743068751"
     variation       1169
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016373653"
     variation       1183
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743067853"
     variation       1187
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743067391"
     variation       1188
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743066970"
     variation       1192
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743066553"
     variation       1193
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743066123"
     variation       1195
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377015673"
     variation       1196
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743065238"
     variation       1197
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431598611"
     variation       1198
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476832769"
     variation       1209
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743063753"
     variation       1210
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743063346"
     variation       1213
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743062908"
     variation       1215
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743062518"
     variation       1229
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005290916"
     variation       1232
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743061710"
     variation       1235
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743061305"
     variation       1239
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395176719"
     variation       1240..1241
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1743060475"
     variation       1242
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950730610"
     variation       1243
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918903214"
     variation       1247..1251
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="cttac"
                     /replace="cttacttac"
                     /db_xref="dbSNP:1743058362"
     variation       1249
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743059183"
     variation       1250
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1580861850"
     variation       1251
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743057940"
     variation       1252
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1030344060"
     variation       1255
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:998061561"
     variation       1258
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743056633"
     variation       1260
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743056190"
     variation       1263..1267
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttctt"
                     /db_xref="dbSNP:1379062344"
     variation       1266
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743055799"
     variation       1273
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232536793"
     variation       1274
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743054584"
     variation       1276
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901106029"
     variation       1283..1285
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:2150327537"
     variation       1290
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303180714"
     variation       1296
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743053398"
     variation       1300
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963227783"
     variation       1318
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039911851"
     variation       1319
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926467233"
     variation       1320
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743050692"
     variation       1322..1323
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1743050266"
     variation       1324
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1231285212"
     variation       1326
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743049462"
     variation       1328
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138007557"
     variation       1330
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743048540"
     variation       1331
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338827386"
     variation       1335
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1210597400"
     variation       1335
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743047305"
     variation       1337
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1743046847"
     variation       1338
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150327342"
     variation       1340..1343
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1743045993"
     variation       1340
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269715863"
     variation       1344
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260858610"
     variation       1350
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2150327288"
     variation       1354
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195775126"
     variation       1355
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970156172"
     variation       1361
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2150327248"
     variation       1362
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743044194"
     variation       1372
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555421066"
     variation       1379
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743043231"
     variation       1380
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743042786"
     variation       1382
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743042345"
     variation       1384
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743041595"
     variation       1387
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1248470707"
     variation       1390
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:535728857"
     variation       1392
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743040225"
     variation       1393
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743039797"
     variation       1396
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743039346"
     variation       1402
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743038929"
     variation       1408
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743038506"
     variation       1413
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743038099"
     variation       1414..1417
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1743037214"
     variation       1415
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743037649"
     variation       1418..1419
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1743036202"
     variation       1418
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181291384"
     variation       1421
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:956248428"
     variation       1422
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457981299"
     variation       1423
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191377833"
     variation       1424..1428
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ta"
                     /replace="taata"
                     /db_xref="dbSNP:1743032082"
     variation       1424
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743033537"
     variation       1426
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539417576"
     variation       1430
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1164554935"
     variation       1432
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743030703"
     variation       1434
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042853202"
     variation       1437
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199984915"
     variation       1448
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1388092390"
     variation       1454
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743028067"
     variation       1458
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1343109599"
     variation       1459
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031647042"
     variation       1460
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437815344"
     variation       1461
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743024787"
     variation       1464
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743024219"
     variation       1466
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743023557"
     variation       1467
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294075340"
     variation       1473
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945709709"
     variation       1475
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2150326827"
     variation       1476
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743021901"
     variation       1477
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326412701"
     variation       1479
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743021208"
     variation       1482
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000450375"
     variation       1483..1484
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1743019563"
     variation       1485
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374187039"
     variation       1492
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1743018191"
     variation       1498
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743017506"
     variation       1499
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354485971"
     variation       1500
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056728221"
     variation       1506
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743016253"
     variation       1507
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213331032"
     variation       1512
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268486647"
     variation       1523
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743014908"
     variation       1525..1526
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1743014111"
     variation       1525
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743014523"
     variation       1526
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1039250611"
     variation       1527
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743013272"
     variation       1531
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743012845"
     variation       1539
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186533991"
     variation       1543
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743011987"
     variation       1546
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743011557"
     variation       1550..1553
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1743010647"
     variation       1550
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1340299966"
     variation       1553
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743010222"
     variation       1558
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424395658"
     variation       1559
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532743192"
     variation       1560..1567
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tatta"
                     /replace="tattatta"
                     /db_xref="dbSNP:1743008574"
     variation       1561
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366225240"
     variation       1566..1570
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="ta"
                     /replace="taata"
                     /db_xref="dbSNP:1159449444"
     variation       1567
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460556343"
     variation       1570..1576
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="at"
                     /replace="atatcat"
                     /db_xref="dbSNP:1459141015"
     variation       1571
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389766148"
     variation       1572
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1743006871"
     variation       1575
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1743006467"
     variation       1579
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927562539"
     variation       1580
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2150326376"
     variation       1581
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1743005152"
     variation       1582
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743004554"
     variation       1585
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1287552641"
     variation       1587
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361828535"
     variation       1589
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980658237"
     variation       1593
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314885435"
     variation       1594
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1743001315"
     variation       1598
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1743000469"
     variation       1603
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1353680059"
     variation       1606
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1327594781"
     variation       1607
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051966282"
     variation       1612
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289235686"
     variation       1613..1619
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="atta"
                     /replace="attatta"
                     /db_xref="dbSNP:1331567359"
     variation       1616
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1742997647"
     variation       1618
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742996975"
     variation       1620
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742995591"
     variation       1623
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1742994796"
     variation       1624
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:929048520"
     variation       1626
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369693784"
     variation       1644
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259977140"
     variation       1651
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1483507690"
     variation       1652
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202138533"
     variation       1653
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1742990821"
     variation       1657..1660
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:897488737"
     variation       1665
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176718170"
     variation       1671..1679
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="aaat"
                     /replace="aaataaaat"
                     /db_xref="dbSNP:1421192369"
     regulatory      1672..1677
                     /regulatory_class="polyA_signal_sequence"
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="hexamer: AATAAA"
     variation       1673
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464857841"
     variation       1678..1683
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="att"
                     /replace="attatt"
                     /db_xref="dbSNP:1580860318"
     variation       1686
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1742987371"
     variation       1687
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1742986932"
     variation       1694
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879097828"
     variation       1695
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182336846"
     polyA_site      1697
                     /gene="CENPK"
                     /gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
                     /note="major polyA site"
ORIGIN      
gcagaagtccggggctggcaagcgcttcctgcgcagcgcctaggcgacctggagtttgtgacgctgtgatggtctagaggctggagattcaagatctgggtgccatcattttctggttctgttgatgaccctcttccagtttttcttataaggctaaaaattcacaaagcatatatcaatgaatcaggaggatctagatccggatagtactacagatgtgggagatgttacaaatactgaagaagaacttattagagaatgtgaagaaatgtggaaagatatggaagaatgtcagaataaattatcacttattggaactgaaacactcaccgattcaaatgctcagctatcattgttaattatgcaagtaaaatgtttaaccgctgaactcagtcaatggcagaaaaaaacacctgaaacaattcccttgactgaagacgttctcataacattaggaaaagaagagttccaaaagctgagacaagatcttgaaatggtactgtccactaaggagtcaaagaatgaaaagttaaaggaagacttagaaagggaacaacggtggttggatgaacagcaacagataatggaatctcttaatgtactacacagtgaattgaaaaataaggttgaaacattttctgaatcaagaatctttaatgaactgaaaactaaaatgcttaatataaaagaatataaggagaaactcttgagtaccttgggcgagtttctagaagaccattttcctctgcctgatagaagtgttaaaaagaaaaagaaaaacattcaagaatcatctgtaaacctgataacactgcatgaaatgttagagattcttataaatagattatttgatgttccacatgatccatatgtcaaaattagtgattccttttggccaccttatgttgagctgctgctgcgtaatggaattgccttgagacatccagaagatccaacccgaataagattagaagctttccatcagtaaaaggatgttttcttttttcacacagtaaaaattcttatcattcaaggatattggaaccacaggactatttggataaaaaacattatttgcaaattaatgcgcataggccatcttacttttattgcaaaatggcatgtgctgccatctattattcatttttaaatggtcatttcttattcagtgagtgctttagtgttttaaactatatggataagaatgcaggtagataatattctaggcataaaacatttaatgtaccttacctcatgcaatattctttggattctttgttgatttatgatattgctaatataatattttcttaaaatatataacaatatcttttatgcattttgagttccagctggtgcttctttatatttagaaattataatgggaaggtcatttaatttacagatggttttaaaattgaggtaatatctgaggtggcataatttaaaaatatttagcaaatttgtttcatatatactgtcttatttctagatttgtttaaaattggaatatgaaaaactaatggataaagctagcataaaattgatattttagtttgtattattaatatatcatgttaccttatatattaatctactcttgattctgctaattattaccaacaaaattgtattcatgacattttattaatcctctgtgaattttctgtaaataaaattatttctgaaaatctcta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]