GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-19 21:38:01, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_054378894            2584 bp    mRNA    linear   PRI 26-AUG-2024
DEFINITION  PREDICTED: Homo sapiens ATPase phospholipid transporting 8B4
            (putative) (ATP8B4), transcript variant X42, mRNA.
ACCESSION   XM_054378894
VERSION     XM_054378894.1
DBLINK      BioProject: PRJNA807723
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060939) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_009914755.1-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/23/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2584
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /isolate="CHM13"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /sex="female"
                     /cell_line="CHM13htert"
                     /tissue_type="hydatidiform mole"
                     /note="haploid cell line"
     gene            1..2584
                     /gene="ATP8B4"
                     /gene_synonym="ATPIM"
                     /note="ATPase phospholipid transporting 8B4 (putative);
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 1 EST, 31 long SRA reads, and 100% coverage
                     of the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:79895"
                     /db_xref="HGNC:HGNC:13536"
                     /db_xref="MIM:609123"
     CDS             206..2374
                     /gene="ATP8B4"
                     /gene_synonym="ATPIM"
                     /codon_start=1
                     /product="probable phospholipid-transporting ATPase IM
                     isoform X28"
                     /protein_id="XP_054234869.1"
                     /db_xref="GeneID:79895"
                     /db_xref="HGNC:HGNC:13536"
                     /db_xref="MIM:609123"
                     /translation="
MKDDFFFTLTTFRGGASVSGGISVGHLLRPGERSGIIMFCSEKKLREVERIVKANDREYNEKFQYADNRIHTSKYNILTFLPINLFEQFQRVANAYFLCLLILQLIPEISSLTWFTTIVPLVLVITMTAVKDATDDYFRHKSDNQVNNRQSEVLINSKLQNEKWMNVKVGDIIKLENNQFVAADLLLLSSSEPHGLCYVETAELDGSLCCYKDVPWVECQLFGAQEALPTFLKQETNLKVRHALSVTSELGADISRLAGFDGIVVCEVPNNKLDKFMGILSWKDSKHSLNNEKIILRGCILRNTSWCFGMVIFAGPDTKLMQNSGKTKFKRTSIDRLMNTLVLWIFGFLICLGIILAIGNSIWESQTGDQFRTFLFWNEGEKSSVFSGFLTFWSYIIILNTVVPISLYVSVEVIRLGHSYFINWDRKMYYSRKAIPAVARTTTLNEELGQIEYIFSDKTGTLTQNIMTFKRCSINGRIYGEVHDDLDQKTEITQEKEPVDFSVKSQADREFQFFDHNLMESIKMGDPKVHEFLRLLALCHTVMSEENSAGELIYQVQSPDEGALVTAARNFGFIFKSRTPETITIEELGTLVTYQLLAFLDFNNTRKRMSVIVRNPEGQIKLYSKGADTILFEKLHPSNEVLLSLTSDHLSEFAGEGLRTLAIAYRDLDDKYFKEWHKMLEDANAATEERDERIAGLYEEIERDLMSREICCEEWGYSSKPS"
     misc_feature    404..>2323
                     /gene="ATP8B4"
                     /gene_synonym="ATPIM"
                     /note="The haloacid dehalogenase (HAD) superfamily
                     includes carbon and phosphorus hydrolases such as
                     2-haloalkonoate dehalogenase, epoxide hydrolase,
                     phosphoserine phosphatase, phosphomannomutase,
                     phosphoglycolate phosphatase, P-type ATPase, among others.
                     These...; Region: Haloacid Dehalogenase-like Hydrolases;
                     cl21460"
                     /db_xref="CDD:473868"
ORIGIN      
acactcaaaactgcacacatgcaggacagaagcctgggcttgttcctttttctctcgctgtctcagctcccaaggctgagattactctgcttcatctggatcgcccatctctggggtctcatggctgagtttcagttccccaatcctacctgctcctcagggggccagcactggggctgcagatctttactgttccaaaagttcaatgaaagatgactttttctttactctgacaacctttagaggtggagcgagtgtcagtggtggtatttcggtaggccacctgttgagacctggtgaaagatcaggtataataatgttctgcagtgaaaagaaattgcgtgaagtggaacggatagtgaaagccaatgaccgtgaatataatgaaaagttccagtatgcggataatcgtatccacacatcgaaatataatattctcaccttcttgccaattaatttatttgaacagttccaaagagtggcaaatgcctattttctttgccttctgattttacagctaattccagaaatttcctccttgacctggtttaccaccattgtgcctttggtcctggtgataactatgacagctgtcaaagatgccacagatgactattttcgccacaagagtgataatcaagtgaataatcggcagtctgaagtgctcatcaacagcaaactgcagaatgaaaaatggatgaatgtcaaagtgggagacatcattaaattagaaaataaccaatttgttgctgctgatttacttctcctatcaagtagtgagccacatggtctctgttatgttgaaactgctgagcttgatggatcattgtgttgttataaagatgtgccgtgggtagaatgccaactctttggagcccaagaagccctgcctactttcctgaaacaggaaacgaacctaaaagtccgccatgcactatcagttacttcagaacttggagcagatatcagcagacttgcagggtttgatgggattgttgtctgtgaggtgcctaacaacaagttagataaattcatgggaatcctttcttggaaagacagcaagcattccctcaacaatgagaagataatcctgagaggctgcatcctgagaaataccagctggtgttttggaatggttatttttgcaggtcctgacactaaactaatgcagaatagtggtaagacaaagtttaaaaggacaagcattgatagattgatgaatactctagtactatggatttttgggtttctgatatgcttgggaattattcttgcaataggaaattcaatctgggagagtcaaactggggaccaattcagaactttcctcttttggaatgaaggagagaagagctctgtgttctccggattcttaacattctggtcatatattattattctcaatacagttgtacccatttccttatatgtgagtgtggaagtaattcgtctaggacacagttattttataaactgggaccggaagatgtattattctcgaaaagcaatacctgcagtggctcgaacgaccacgctcaatgaggaactggggcagattgagtacattttctccgacaaaacgggtaccctcactcaaaacatcatgacctttaaaagatgttccattaatgggagaatctatggtgaagtacatgatgacctggatcagaagacagaaataactcaggaaaaagagcctgtggatttctcagtcaaatctcaagcggatagagaatttcagttctttgaccacaatctgatggaatccattaaaatgggtgatcccaaagttcatgaattccttaggttacttgctctctgccacactgtaatgtcagaagagaatagcgcaggagagctgatttaccaagttcagtcacctgatgaaggggctctagtgactgccgctagaaattttgggttcatttttaaatcccggaccccagagaccataacaatagaagaattgggaacactagttacttatcaattacttgcctttttggatttcaacaacaccagaaaaaggatgtctgtcatagttcgaaacccagaaggacagataaagctttattccaaaggagcagatactattctgtttgaaaaacttcatccttccaatgaagtccttttgtctttgacgtcagaccacctcagtgaatttgcaggggaaggccttcggaccttggccatcgcatacagagacctggatgacaagtactttaaagagtggcataagatgcttgaagatgcgaatgctgccacagaagagagggatgaacgaatagctgggctatatgaagaaattgaaagagatttgatgagcagagaaatttgctgtgaagaatggggctacagttctaaaccatcctaagccatgagattctgatgatatctgtgctatccagagcatggtctattctaaaaaccactcttacctgaagccccagtggccaggaatacctcacccactgtgaggtactagagagtatgctttgctcaacttttgatgaaaaatcgtggccgggcgcggtggctcacacctgtaatcccagcacttcaggaggccgaggtgggcggatca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]