2025-09-19 21:38:01, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_054378894 2584 bp mRNA linear PRI 26-AUG-2024 DEFINITION PREDICTED: Homo sapiens ATPase phospholipid transporting 8B4 (putative) (ATP8B4), transcript variant X42, mRNA. ACCESSION XM_054378894 VERSION XM_054378894.1 DBLINK BioProject: PRJNA807723 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_060939) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_009914755.1-RS_2024_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; RefSeqFE; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/23/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2584 /organism="Homo sapiens" /mol_type="mRNA" /isolate="CHM13" /db_xref="taxon:9606" /chromosome="15" /sex="female" /cell_line="CHM13htert" /tissue_type="hydatidiform mole" /note="haploid cell line" gene 1..2584 /gene="ATP8B4" /gene_synonym="ATPIM" /note="ATPase phospholipid transporting 8B4 (putative); Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 EST, 31 long SRA reads, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:79895" /db_xref="HGNC:HGNC:13536" /db_xref="MIM:609123" CDS 206..2374 /gene="ATP8B4" /gene_synonym="ATPIM" /codon_start=1 /product="probable phospholipid-transporting ATPase IM isoform X28" /protein_id="XP_054234869.1" /db_xref="GeneID:79895" /db_xref="HGNC:HGNC:13536" /db_xref="MIM:609123" /translation="
MKDDFFFTLTTFRGGASVSGGISVGHLLRPGERSGIIMFCSEKKLREVERIVKANDREYNEKFQYADNRIHTSKYNILTFLPINLFEQFQRVANAYFLCLLILQLIPEISSLTWFTTIVPLVLVITMTAVKDATDDYFRHKSDNQVNNRQSEVLINSKLQNEKWMNVKVGDIIKLENNQFVAADLLLLSSSEPHGLCYVETAELDGSLCCYKDVPWVECQLFGAQEALPTFLKQETNLKVRHALSVTSELGADISRLAGFDGIVVCEVPNNKLDKFMGILSWKDSKHSLNNEKIILRGCILRNTSWCFGMVIFAGPDTKLMQNSGKTKFKRTSIDRLMNTLVLWIFGFLICLGIILAIGNSIWESQTGDQFRTFLFWNEGEKSSVFSGFLTFWSYIIILNTVVPISLYVSVEVIRLGHSYFINWDRKMYYSRKAIPAVARTTTLNEELGQIEYIFSDKTGTLTQNIMTFKRCSINGRIYGEVHDDLDQKTEITQEKEPVDFSVKSQADREFQFFDHNLMESIKMGDPKVHEFLRLLALCHTVMSEENSAGELIYQVQSPDEGALVTAARNFGFIFKSRTPETITIEELGTLVTYQLLAFLDFNNTRKRMSVIVRNPEGQIKLYSKGADTILFEKLHPSNEVLLSLTSDHLSEFAGEGLRTLAIAYRDLDDKYFKEWHKMLEDANAATEERDERIAGLYEEIERDLMSREICCEEWGYSSKPS"
misc_feature 404..>2323 /gene="ATP8B4" /gene_synonym="ATPIM" /note="The haloacid dehalogenase (HAD) superfamily includes carbon and phosphorus hydrolases such as 2-haloalkonoate dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, among others. These...; Region: Haloacid Dehalogenase-like Hydrolases; cl21460" /db_xref="CDD:473868" ORIGIN
acactcaaaactgcacacatgcaggacagaagcctgggcttgttcctttttctctcgctgtctcagctcccaaggctgagattactctgcttcatctggatcgcccatctctggggtctcatggctgagtttcagttccccaatcctacctgctcctcagggggccagcactggggctgcagatctttactgttccaaaagttcaatgaaagatgactttttctttactctgacaacctttagaggtggagcgagtgtcagtggtggtatttcggtaggccacctgttgagacctggtgaaagatcaggtataataatgttctgcagtgaaaagaaattgcgtgaagtggaacggatagtgaaagccaatgaccgtgaatataatgaaaagttccagtatgcggataatcgtatccacacatcgaaatataatattctcaccttcttgccaattaatttatttgaacagttccaaagagtggcaaatgcctattttctttgccttctgattttacagctaattccagaaatttcctccttgacctggtttaccaccattgtgcctttggtcctggtgataactatgacagctgtcaaagatgccacagatgactattttcgccacaagagtgataatcaagtgaataatcggcagtctgaagtgctcatcaacagcaaactgcagaatgaaaaatggatgaatgtcaaagtgggagacatcattaaattagaaaataaccaatttgttgctgctgatttacttctcctatcaagtagtgagccacatggtctctgttatgttgaaactgctgagcttgatggatcattgtgttgttataaagatgtgccgtgggtagaatgccaactctttggagcccaagaagccctgcctactttcctgaaacaggaaacgaacctaaaagtccgccatgcactatcagttacttcagaacttggagcagatatcagcagacttgcagggtttgatgggattgttgtctgtgaggtgcctaacaacaagttagataaattcatgggaatcctttcttggaaagacagcaagcattccctcaacaatgagaagataatcctgagaggctgcatcctgagaaataccagctggtgttttggaatggttatttttgcaggtcctgacactaaactaatgcagaatagtggtaagacaaagtttaaaaggacaagcattgatagattgatgaatactctagtactatggatttttgggtttctgatatgcttgggaattattcttgcaataggaaattcaatctgggagagtcaaactggggaccaattcagaactttcctcttttggaatgaaggagagaagagctctgtgttctccggattcttaacattctggtcatatattattattctcaatacagttgtacccatttccttatatgtgagtgtggaagtaattcgtctaggacacagttattttataaactgggaccggaagatgtattattctcgaaaagcaatacctgcagtggctcgaacgaccacgctcaatgaggaactggggcagattgagtacattttctccgacaaaacgggtaccctcactcaaaacatcatgacctttaaaagatgttccattaatgggagaatctatggtgaagtacatgatgacctggatcagaagacagaaataactcaggaaaaagagcctgtggatttctcagtcaaatctcaagcggatagagaatttcagttctttgaccacaatctgatggaatccattaaaatgggtgatcccaaagttcatgaattccttaggttacttgctctctgccacactgtaatgtcagaagagaatagcgcaggagagctgatttaccaagttcagtcacctgatgaaggggctctagtgactgccgctagaaattttgggttcatttttaaatcccggaccccagagaccataacaatagaagaattgggaacactagttacttatcaattacttgcctttttggatttcaacaacaccagaaaaaggatgtctgtcatagttcgaaacccagaaggacagataaagctttattccaaaggagcagatactattctgtttgaaaaacttcatccttccaatgaagtccttttgtctttgacgtcagaccacctcagtgaatttgcaggggaaggccttcggaccttggccatcgcatacagagacctggatgacaagtactttaaagagtggcataagatgcttgaagatgcgaatgctgccacagaagagagggatgaacgaatagctgggctatatgaagaaattgaaagagatttgatgagcagagaaatttgctgtgaagaatggggctacagttctaaaccatcctaagccatgagattctgatgatatctgtgctatccagagcatggtctattctaaaaaccactcttacctgaagccccagtggccaggaatacctcacccactgtgaggtactagagagtatgctttgctcaacttttgatgaaaaatcgtggccgggcgcggtggctcacacctgtaatcccagcacttcaggaggccgaggtgggcggatca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]