2025-07-15 21:19:04, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_054336760 3318 bp mRNA linear PRI 26-AUG-2024 DEFINITION PREDICTED: Homo sapiens ATPase Na+/K+ transporting subunit alpha 4 (ATP1A4), transcript variant X1, mRNA. ACCESSION XM_054336760 VERSION XM_054336760.1 DBLINK BioProject: PRJNA807723 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_060925) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_009914755.1-RS_2024_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; RefSeqFE; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/23/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3318 /organism="Homo sapiens" /mol_type="mRNA" /isolate="CHM13" /db_xref="taxon:9606" /chromosome="1" /sex="female" /cell_line="CHM13htert" /tissue_type="hydatidiform mole" /note="haploid cell line" gene 1..3318 /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /note="ATPase Na+/K+ transporting subunit alpha 4; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 long SRA read, 66 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 5 samples with support for all annotated introns" /db_xref="GeneID:480" /db_xref="HGNC:HGNC:14073" /db_xref="MIM:607321" CDS 125..3037 /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /codon_start=1 /product="sodium/potassium-transporting ATPase subunit alpha-4 isoform X1" /protein_id="XP_054192735.1" /db_xref="GeneID:480" /db_xref="HGNC:HGNC:14073" /db_xref="MIM:607321" /translation="
MDTTWKKLQMGHSHQRAKEILTRGGPNTVTPPPTTPEWVKFCKQLFGGFSLLLWTGAILCFVAYSIQIYFNEEPTKDNLYLSIVLSVVVIVTGCFSYYQEAKSSKIMESFKNMVPQQALVIRGGEKMQINVQEVVLGDLVEIKGGDRVPADLRLISAQGCKVDNSSLTGESEPQSRSPDFTHENPLETRNICFFSTNCVEGTARGIVIATGDSTVMGRIASLTSGLAVGQTPIAAEIEHFIHLITVVAVFLGVTFFALSLLLGYGWLEAIIFLIGIIVANVPEGLLATVTVCLTLTAKRMARKNCLVKNLEAVETLGSTSTICSDKTGTLTQNRMTVAHMWFDMTVYEADTTEEQTGKTFTKSSDTWFMLARIAGLCNRADFKANQEILPIAKRATTGDASESALLKFIEQSYSSVAEMREKNPKVAEIPFNSTNKYQMSIHLREDSSQTHVLMMKGAPERILEFCSTFLLNGQEYSMNDEMKEAFQNAYLELGGLGERVLGFCFLNLPSSFSKGFPFNTDEINFPMDNLCFVGLISMIDPPRAAVPDAVSKCRSAGIKVIMVTGDHPITAKAIAKGVGIISEGTETAEEVAARLKIPISKVDASAAKAIVVHGAELKDIQSKQLDQILQNHPEIVFARTSPQQKLIIVEGCQRLGAVVAVTGDGVNDSPALKKADIGIAMGISGSDVSKQAADMILLDDNFASIVTGVEEGRLIFDNLKKSIMYTLTSNIPEITPFLMFIILGIPLPLGTITILCIDLGTDMVPAISLAYESAESDIMKRLPRNPKTDNLVNHRLIGMAYGQIGMIQALAGFFTYFVILAENGFRPVDLLGIRLHWEDKYLNDLEDSYGQQWTYEQRKVVEFTCQTAFFVTIVVVQWADLIISKTRRNSLFQQGMRNKVLIFGILEETLLAAFLSYTPGMDVALRMYPLKITWWLCAIPYSILIFVYDEIRKLLIRQHPDGWVERETYY"
misc_feature 155..3025 /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /note="alpha-subunit of Na(+)/K(+)-ATPases and of gastric H(+)/K(+)-ATPase, similar to the human Na(+)/K(+)-ATPase alpha subunits 1-4; Region: P-type_ATPase_Na-K_like; cd02608" /db_xref="CDD:319794" misc_feature order(956..958,965..967,971..973,2312..2314,2321..2323, 2396..2398) /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /note="K binding site [ion binding]; other site" /db_xref="CDD:319794" misc_feature order(971..973,2312..2314,2321..2323,2396..2398) /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /note="Na binding site [ion binding]; other site" /db_xref="CDD:319794" misc_feature order(1097..1105,1319..1321,1328..1330,1412..1417, 1421..1423,1430..1432,1436..1438,1490..1498,1619..1627, 1814..1822,2039..2041,2048..2050,2057..2059,2114..2128) /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /note="ATP-binding site [chemical binding]; other site" /db_xref="CDD:319794" misc_feature order(2297..2299,2309..2311,2408..2410,2753..2755) /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /note="Na binding site [ion binding]; other site" /db_xref="CDD:319794" misc_feature order(2309..2314,2321..2323,2396..2398,2408..2410) /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /note="K binding site [ion binding]; other site" /db_xref="CDD:319794" misc_feature order(2309..2314,2321..2323,2396..2398) /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /note="Na binding site [ion binding]; other site" /db_xref="CDD:319794" misc_feature order(2528..2533,2540..2545,2552..2554,2564..2566, 2576..2578,2588..2593,2639..2647,2651..2656,2666..2695, 2702..2707,2915..2917,2921..2926,2945..2947,2954..2956, 2966..2968,3011..3013,3020..3025) /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /note="alpha-subunit/beta-subunit interface [polypeptide binding]; other site" /db_xref="CDD:319794" misc_feature 2792..2794 /gene="ATP1A4" /gene_synonym="ATP1A1; ATP1AL2" /note="phosphorylation site [posttranslational modification]" /db_xref="CDD:319794" ORIGIN
tgaggaggcagagagtctccaactctgactgtgaggctgccaggacaaaagctgaactaggaatccagccccctaacttcaagtccaacgttcccacccctcaccctctgcctggccacgttccatggacactacctggaaaaagctgcaaatgggccatagccaccaaagggcaaaggaaatcctgactcgaggtggacccaatactgttaccccaccccccaccactccagaatgggtcaaattctgtaagcaactgttcggaggcttctccctcctactatggactggggccattctctgctttgtggcctacagcatccagatatatttcaatgaggagcctaccaaagacaacctctacctgagcatcgtactgtccgtcgtggtcatcgtcactggctgcttctcctattatcaggaggccaagagctccaagatcatggagtcttttaagaacatggtgcctcagcaagctctggtaattcgaggaggagagaagatgcaaattaatgtacaagaggtggtgttgggagacctggtggaaatcaagggtggagaccgagtccctgctgacctccggcttatctctgcacaaggatgtaaggtggacaactcatccttgactggggagtcagaaccccagagccgctcccctgacttcacccatgagaaccctctggagacccgaaacatctgcttcttttccaccaactgtgtggaaggaaccgcccggggtattgtgattgctacgggagactccacagtgatgggcagaattgcctccctgacgtcaggcctggcggttggccagacacctatcgctgctgagatcgaacacttcatccatctgatcactgtggtggccgtcttccttggtgtcactttttttgcgctctcacttctcttgggctatggttggctggaggctatcatttttctcattggcatcattgtggccaatgtgcctgaggggctgttggctacagtcactgtgtgcctgaccctcacagccaagcgcatggcgcggaagaactgcctggtgaagaacctggaggcggtggagacgctgggctccacgtccaccatctgctcagacaagacgggcaccctcacccagaaccgcatgaccgtcgcccacatgtggtttgatatgaccgtgtatgaggccgacaccactgaagaacagactggaaaaacatttaccaagagctctgatacctggtttatgctggcccgaatcgctggcctctgcaaccgggctgactttaaggctaatcaggagatcctgcccattgctaagagggccacaacaggtgatgcttccgagtcagccctcctcaagttcatcgagcagtcttacagctctgtggcggagatgagagagaaaaaccccaaggtggcagagattccctttaattctaccaacaagtaccagatgtccatccaccttcgggaggacagctcccagacccacgtactgatgatgaagggtgctccggagaggatcttggagttttgttctacctttcttctgaatgggcaggagtactcaatgaacgatgaaatgaaggaagccttccaaaatgcctatttagaactgggaggtctgggggaacgtgtgctaggcttctgcttcttgaatctgcctagcagcttctccaagggattcccatttaatacagatgaaataaatttccccatggacaacctttgttttgtgggcctcatatccatgattgaccctccccgagctgcagtgcctgatgctgtgagcaagtgtcgcagtgcaggaattaaggtgatcatggtaacaggagatcatcccattacagctaaggccattgccaagggtgtgggcatcatctcagaaggcactgagacggcagaggaagtcgctgcccggcttaagatccctatcagcaaggtcgatgccagtgctgccaaagccattgtggtgcatggtgcagaactgaaggacatacagtccaagcagcttgatcagatcctccagaaccaccctgagatcgtgtttgctcggacctcccctcagcagaagctcatcattgtcgagggatgtcagaggctgggagccgttgtggccgtgacaggtgacggggtgaacgactcccctgcgctgaagaaggctgacattggcattgccatgggcatctctggctctgacgtctctaagcaggcagccgacatgatcctgctggatgacaactttgcctccatcgtcacgggggtggaggagggccgcctgatctttgacaacctgaagaaatccatcatgtacaccctgaccagcaacatccccgagatcacgcccttcctgatgttcatcatcctcggtatacccctgcctctgggaaccataaccatcctctgcattgatctcggcactgacatggtccctgccatctccttggcttatgagtcagctgaaagcgacatcatgaagaggcttccaaggaacccaaagacggataatctggtgaaccaccgtctcattggcatggcctatggacagattgggatgatccaggctctggctggattctttacctactttgtaatcctggctgagaatggttttaggcctgttgatctgctgggcatccgcctccactgggaagataaatacttgaatgacctggaggacagctacggacagcagtggacctatgagcaacgaaaagttgtggagttcacatgccaaacggccttttttgtcaccatcgtggttgtgcagtgggcggatctcatcatctccaagactcgccgcaactcacttttccagcagggcatgagaaacaaagtcttaatatttgggatcctggaggagacactcttggctgcatttctgtcctacactccaggcatggacgtggccctgcgaatgtacccactcaagataacctggtggctctgtgccattccctacagtattctcatcttcgtctatgatgaaatcagaaaactcctcatccgtcagcacccggatggctgggtggaaagggagacgtactactaaactcagcagatgaagagcttcatgtgacacaggggtgttgtgagagctgggatggggccagagattataagtttgacacaacatctgagacactaggatgaattatcttggatgagaaagatgggcaatcctgggctggcttgagggaatcatgggcagaggatgaggtgggctgaagggaagcccagcctgcatctagctggagccccgcagggaggggcatggtcctgctgaatcccgtagccagtctagacagtaaatgtctggaaaagccctcacca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]