GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-12-09 12:54:25, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_047447183            1198 bp    mRNA    linear   PRI 05-AUG-2025
DEFINITION  PREDICTED: Homo sapiens WAS protein family homolog 6-like
            (LOC124908905), partial mRNA.
ACCESSION   XM_047447183
VERSION     XM_047447183.1
DBLINK      BioProject: PRJNA807723
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060948) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_009914755.1-RS_2025_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/01/2025
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 1% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..1198
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /isolate="NA24385"
                     /bio_material="CORIELL:NA24385"
                     /db_xref="taxon:9606"
                     /chromosome="Y"
                     /sex="male"
                     /tissue_type="B-Lymphocyte"
     gene            <1..1198
                     /gene="LOC124908905"
                     /note="WAS protein family homolog 6-like; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 6 ESTs, 18 long SRA reads, and 99% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     38 samples with support for all annotated introns"
                     /db_xref="GeneID:124908905"
     CDS             <1..906
                     /gene="LOC124908905"
                     /codon_start=1
                     /product="WAS protein family homolog 6-like isoform X1"
                     /protein_id="XP_047303139.1"
                     /db_xref="GeneID:124908905"
                     /translation="
DFKQVGGVGQRWRQVQWPRALPELFSSQGCWAPYSTHGRCTQGLVGCPCRSLSPLTCPCLILQVPENYFYVPDLGQVPEIDVPSYLPDLPGIANDLMYIADLGPGIAPSAPGTIPELPTFHTEVAEPLKADLQDGVLTPPPPPPPPPPAPEVLASAPPLPPSTAAPVGQGARQDDSSSSTSPSVQGAPREVVDPSGGWATLLESIRQAGGIGKAKLRSMKERKLEKKKQKEQEQVRAMSQGGHLMSDLFNKLVMRRKGISGKGPGAGEGPGGAFARVSDSIPPVPPPQQPQAEEDEDDWES"
     misc_feature    <187..399
                     /gene="LOC124908905"
                     /note="WAHD domain of WASH complex; Region: WASH_WAHD;
                     pfam11945"
                     /db_xref="CDD:463408"
     polyA_site      1198
                     /gene="LOC124908905"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
gacttcaagcaggtgggaggggtgggacagaggtggagacaggtgcagtggcccagggccttgccagagctcttctccagtcaaggctgttgggccccttattccacccatgggaggtgcacacaaggtcttgttggctgcccctgcaggtccctgtcacctctcacatgtccctgcctaatcttgcaggtcccagagaactacttctatgtgccagacctgggccaggtgcctgagattgatgttccatcctacctgcctgacctgcccggcattgccaacgacctcatgtacattgccgacctgggccccggcattgccccctctgcccctggcaccattccagaactgcccaccttccacactgaggtagccgagcctctcaaggcagacctacaagatggggtactaacaccacccccaccgcccccaccaccacccccagctcctgaggtgctggccagtgcacccccactcccaccctcaaccgcggcccctgtaggccaaggcgccaggcaggacgacagcagcagcagcacgtctccttcagtccagggagctcccagggaagtggtcgacccctccggtggctgggccactctgctagagtccatccgccaagctgggggcatcggcaaggccaagctgcgcagcatgaaggagcgaaagctggagaagaagaagcagaaggagcaggagcaagtgagagccatgagccaaggtgggcacttgatgtcggatctcttcaacaagctggtcatgaggcgcaagggcatctctgggaaaggacctggggctggtgaggggcccggaggagcctttgcccgcgtgtcagactccatccctcctgtgcccccaccgcaacagccacaggcagaggaggacgaggacgactgggaatcctagggggctccatgacaccttcccccccagacccagacttgggctgttgctctgacatggacacagccaggacaagctgctcagacctgcttccctgggagggggtgacggaaccagcactgtgtggagaccagcttcaaggagcggaaggctggcttgaggccacacagctggggcggggacttctgtctgcctgtgctccatggggggacggctccacccagcctgcgccactgtgttcttaagaggcttccagagaaaacggcacaccaatcaataaagaactgagcagaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]