2024-05-02 02:49:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_047447058 531 bp mRNA linear PRI 05-OCT-2023 DEFINITION PREDICTED: Homo sapiens putative double homeobox protein 3 (LOC124908437), mRNA. ACCESSION XM_047447058 VERSION XM_047447058.1 DBLINK BioProject: PRJNA807723 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_060946) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_009914755.1-RS_2023_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; RefSeqFE; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/02/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..531 /organism="Homo sapiens" /mol_type="mRNA" /isolate="CHM13" /db_xref="taxon:9606" /chromosome="22" /sex="female" /cell_line="CHM13htert" /tissue_type="hydatidiform mole" /note="haploid cell line" gene 1..531 /gene="LOC124908437" /note="putative double homeobox protein 3; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins" /db_xref="GeneID:124908437" CDS 1..531 /gene="LOC124908437" /codon_start=1 /product="putative double homeobox protein 3" /protein_id="XP_047303014.1" /db_xref="GeneID:124908437" /translation="
MPAEVHGSPPASLCPCPSVKFRPGLPAMALLTALDDTLPEEAQGPGRRMILLSTPSQSDALRACFERNLYPGIATKEQLAQGIDIPEPRVQIWFQNERSCQLRQHRRQSRPWPGRRDPQKGRRKRTAITGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARH"
misc_feature 160..297 /gene="LOC124908437" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cl00084" /db_xref="CDD:444687" misc_feature order(364..378,382..384,433..435,451..453,490..492, 496..501,508..513,517..525) /gene="LOC124908437" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 370..528 /gene="LOC124908437" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(370..372,379..381,499..501,508..513,520..522) /gene="LOC124908437" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" ORIGIN
atgccggctgaggtgcacgggagcccgcccgcctctctctgcccgtgtccgtccgtgaaattccggccggggctccctgcgatggccctcctgacagctttggacgacaccctccccgaggaagcccagggaccgggaaggcgaatgatactcctttcgaccccgagtcaaagcgatgccctgcgagcctgctttgagcggaacctgtacccgggcattgccaccaaagaacagctggcccagggcatcgacattccggagcccagggtccagatttggtttcagaatgagagatcatgccagttgaggcagcaccggcggcaatctcggccctggcccgggagacgcgacccgcaaaaaggcagacgaaagcggactgccatcaccggatcccaaaccgccctgctcctccgagcctttgagaaggatcgctttccaggcattgctgccagggaagagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagagccaggcactga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]