ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-29 19:11:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_047416992 8377 bp mRNA linear PRI 05-OCT-2023
DEFINITION PREDICTED: Homo sapiens Rho GTPase activating protein 26
(ARHGAP26), transcript variant X36, mRNA.
ACCESSION XM_047416992
VERSION XM_047416992.1
DBLINK BioProject: PRJNA168
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_000005.10) annotated using gene prediction method: Gnomon,
supported by mRNA and EST evidence.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Updated annotation
Annotation Name :: GCF_000001405.40-RS_2023_10
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.2
Annotation Method :: Best-placed RefSeq; Gnomon;
RefSeqFE; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 10/02/2023
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..8377
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
gene 1..8377
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/note="Rho GTPase activating protein 26; Derived by
automated computational analysis using gene prediction
method: Gnomon. Supporting evidence includes similarity
to: 1 mRNA, 1 EST, 89 long SRA reads, 1 Protein, and 97%
coverage of the annotated genomic feature by RNAseq
alignments, including 2 samples with support for all
annotated introns"
/db_xref="GeneID:23092"
/db_xref="HGNC:HGNC:17073"
/db_xref="MIM:605370"
misc_feature 1
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/experiment="COORDINATES: cap analysis [ECO:0007248]"
/note="transcription start site"
variation 2
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:959505454"
variation 4
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1239639291"
variation 5
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1334096413"
variation 8
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1013410495"
variation 12
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152790602"
variation 14
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:906034214"
variation 16
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1268799691"
variation 18
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025338181"
variation 32
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1301763803"
variation 33
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777425171"
variation 40
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1479709114"
variation 43
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1001673252"
variation 54
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598580581"
variation 55
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598580601"
variation 61
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777427262"
variation 65
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:562263759"
variation 71
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777428038"
variation 72..73
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1777428830"
variation 72
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027815798"
variation 75
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:952301735"
variation 76
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777429732"
variation 77
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:983684493"
variation 78..79
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="a"
/db_xref="dbSNP:1365097533"
variation 78
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777431144"
variation 86
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:966596423"
variation 90
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:977979524"
variation 93
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777433804"
variation 94
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777434439"
variation 96
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1432027751"
variation 98
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777435552"
variation 100
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777436154"
variation 101
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:566361086"
variation 109
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1201443338"
variation 111
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777438236"
variation 114
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777438833"
variation 116
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:976578508"
variation 117
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1285001265"
variation 119
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:868575438"
variation 122
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1204823375"
variation 130
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1348789553"
variation 131
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777443179"
variation 135
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1214981957"
variation 144
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777444736"
variation 145
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1239868313"
variation 146
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1330537283"
variation 150
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1281955149"
variation 152
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1407263615"
variation 154
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1346591942"
variation 163
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1297957786"
variation 164
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:957324106"
variation 176
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777450121"
variation 179
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152791085"
variation 182
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777450739"
variation 188
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:990680555"
variation 191..192
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1465125496"
variation 191
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:910631390"
variation 192
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777455222"
variation 193
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1178554130"
variation 206
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777456532"
variation 212
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1480711954"
variation 216
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1262282931"
variation 222
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400075701"
variation 223
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:935276125"
variation 224
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448450695"
variation 228
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777459807"
variation 236
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1301920426"
variation 238..239
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1777461142"
variation 238
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:943563013"
variation 243
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1205892145"
variation 244
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598581382"
variation 246
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1322958010"
variation 247
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1261312446"
variation 250
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406645739"
variation 251
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:182961874"
variation 253
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777465784"
variation 255
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1040529141"
variation 259
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777466999"
variation 260
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:923420931"
variation 262
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1598581546"
variation 263
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1324881781"
variation 265
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1316091671"
variation 269
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1238673771"
variation 271
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1429075460"
variation 274
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777471202"
variation 281
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:746374347"
variation 283
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777472429"
variation 284
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1328512809"
variation 286
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1318596804"
variation 294
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1259177130"
variation 295
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:929576302"
variation 304
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1338119009"
variation 305
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:772354475"
variation 306
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152791515"
variation 310
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777477688"
variation 311
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:949047078"
variation 317
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1166030941"
variation 318
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777479466"
variation 319
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:3776370"
variation 322
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777480867"
variation 332
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1373392468"
variation 341
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1194227273"
variation 344
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1490011329"
variation 347
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1461028488"
variation 351
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:574708028"
variation 354
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005881184"
variation 358
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777485241"
variation 361
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1055315027"
variation 369
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152791672"
variation 371
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:143043349"
variation 374
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:904975022"
variation 375
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:995650206"
variation 377
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:894880149"
variation 378
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1013858305"
variation 379
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:151133517"
variation 385
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777488525"
variation 389
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777488853"
variation 390
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1244870170"
variation 391
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:577450348"
variation 393
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1380122545"
variation 394
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338222590"
variation 398
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:2152791806"
variation 400
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1452748726"
variation 405..408
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:1562241379"
variation 405
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374753259"
variation 408
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1689140570"
variation 409
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777491674"
variation 410
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268557793"
variation 411
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1398862857"
variation 413
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:746649579"
variation 422
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:966441008"
variation 425
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:3776369"
variation 426
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1381786023"
variation 428
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1442476555"
variation 430
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1032220671"
variation 432
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:957393139"
variation 433
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:990154798"
variation 438
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777495898"
variation 440
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:564881785"
variation 448..449
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ga"
/db_xref="dbSNP:1777496677"
variation 450
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777497024"
variation 451
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777497371"
variation 452
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777497742"
variation 453
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:527488919"
variation 456
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1232339028"
variation 459
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:964843243"
variation 462
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777499258"
variation 465
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:2152792086"
variation 473
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:976547129"
variation 474
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426521123"
variation 480..482
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1777500435"
variation 485
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:140205060"
variation 486
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:929439088"
variation 487
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:925138146"
variation 500
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1222226212"
variation 503
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777502569"
variation 505
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777502963"
variation 507
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777503313"
variation 508
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:533290940"
variation 512
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:956511036"
variation 513..517
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aga"
/replace="agaga"
/db_xref="dbSNP:1777504405"
variation 516
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:116088779"
variation 526
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1246208595"
variation 527
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11744069"
variation 528
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1336282104"
variation 537..538
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="t"
/db_xref="dbSNP:1777506660"
variation 538
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777507016"
variation 539
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1379422211"
variation 544
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:549399396"
variation 547
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1302404082"
variation 552
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777508428"
variation 553
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:941718912"
variation 554
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1422534667"
variation 557
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1367159974"
variation 568
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1054778636"
variation 570
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425508562"
variation 572
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777511195"
variation 574
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:894777846"
variation 575
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1291182233"
variation 580
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598583032"
variation 582
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373695559"
variation 585
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1044763732"
variation 587
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777514926"
variation 588
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777515294"
variation 595
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1471164299"
variation 596
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:569401280"
variation 599
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:926262525"
variation 600
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146944215"
variation 601..605
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1562241709"
variation 602
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777517540"
variation 609
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152792506"
variation 610
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777517929"
variation 612
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1224503930"
variation 613
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777518733"
variation 619
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777519140"
variation 626
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489971361"
variation 630
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294364359"
variation 631
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1222833927"
variation 650
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:138006748"
variation 651
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1046145898"
variation 652
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:931095282"
variation 653
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:566100266"
variation 655
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1282593700"
variation 656
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:887951539"
variation 661
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1005012612"
variation 662
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777523428"
variation 666..672
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tta"
/replace="ttactta"
/db_xref="dbSNP:142364270"
variation 666
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777523819"
variation 668
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:902125538"
variation 669
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="c"
/db_xref="dbSNP:1777525673"
variation 669
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:999355936"
variation 679
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="c"
/db_xref="dbSNP:1777526039"
variation 680
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152792743"
variation 682
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777526420"
variation 684
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777526734"
variation 686
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:7725832"
variation 687
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1412748864"
variation 692
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1176387445"
variation 701
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376173806"
variation 702
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:568801271"
variation 706
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1271586348"
variation 708
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1200606725"
variation 710
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1485712253"
variation 714
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777530269"
variation 719
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:769205327"
variation 724
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777531060"
variation 726
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1217440998"
variation 728
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1017620515"
variation 729
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1382912619"
variation 731
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:965039499"
variation 732
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:73796700"
variation 733
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777533682"
variation 734
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:77506353"
variation 738
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777534511"
variation 742
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="g"
/db_xref="dbSNP:1283778245"
variation 753
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777535462"
variation 756
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="t"
/db_xref="dbSNP:1777535860"
variation 757
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:773138717"
variation 759
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1598583821"
variation 760..768
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaaa"
/replace="aaaataaaa"
/db_xref="dbSNP:1213791621"
variation 760
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1359549194"
variation 764
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:188402586"
variation 765
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:557434412"
variation 772
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1030371759"
variation 773
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777538523"
variation 774
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:950918313"
variation 776
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:956541874"
variation 777
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777539622"
variation 780
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777539998"
variation 792
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:763054357"
variation 793
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1460357849"
variation 799
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777541283"
variation 801
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:987975468"
variation 804
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:577310634"
variation 805
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1333155109"
variation 808
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1468236314"
variation 815
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400718910"
variation 816
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1177361556"
variation 820
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:909490011"
variation 821
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:942313457"
variation 826
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777544828"
variation 827
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777545158"
variation 829
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777545505"
variation 830
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777545856"
variation 833
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:991451032"
variation 837
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777546601"
variation 841
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1417770122"
variation 843..848
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="accaca"
/replace="accacagattcagagagaccaca"
/db_xref="dbSNP:1777548275"
variation 843
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777547900"
variation 844
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1314616474"
variation 845
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777549159"
variation 846
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380761419"
variation 849
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:245846"
variation 850
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1201239503"
variation 853
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:571603009"
variation 855
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263706633"
variation 862
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777551314"
variation 863
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777551650"
variation 864
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:981072105"
variation 866
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777552401"
variation 867
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777552777"
variation 868
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1305591835"
variation 869
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777553572"
variation 873
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1307451583"
variation 875
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:926320675"
variation 876
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216608235"
variation 877
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598584347"
variation 878..935
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="ggtcagaacaaatttatagacaaaaaaaaaaaaaaaaaaaaaggaaag
tgacgtacgg"
/db_xref="dbSNP:1562242270"
variation 881
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777555615"
variation 882
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777556036"
variation 883
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1366205649"
variation 886
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:371918067"
variation 887
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1450568658"
variation 891
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777558690"
variation 892..898
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="tatagac"
/db_xref="dbSNP:1408337087"
variation 892
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:2152793530"
variation 893..900
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="atagacaa"
/db_xref="dbSNP:1458480595"
variation 893
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1777559528"
variation 894
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1461899013"
variation 895..902
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="agacaaaa"
/db_xref="dbSNP:1777562731"
variation 895
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1777562077"
variation 895
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777561468"
variation 896
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1183727762"
variation 897..905
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="acaaaaaaa"
/db_xref="dbSNP:758951500"
variation 897..904
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="acaaaaaa"
/db_xref="dbSNP:752461040"
variation 897..903
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="acaaaaa"
/db_xref="dbSNP:1554192561"
variation 897
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1172979997"
variation 897
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1445963876"
variation 898..899
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ca"
/replace="caa"
/db_xref="dbSNP:1479610206"
variation 898
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="c"
/db_xref="dbSNP:1256206492"
variation 898
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:374741411"
variation 898
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1181321286"
variation 899..919
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaaaaaa"
/replace="aaaaaaaaa"
/replace="aaaaaaaaaa"
/replace="aaaaaaaaaaa"
/replace="aaaaaaaaaaaa"
/replace="aaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
"
/replace="aaaaaaaaaaaaaaaaaaaaaaagaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaa"
/db_xref="dbSNP:rs144058530"
variation 899
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aga"
/db_xref="dbSNP:1777568891"
variation 899
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1426142774"
variation 900..964
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="aaaaaaaaaaaaaaaaaaaaggaaagtgacgtacggaaatcagaagta
aggtacaaaaacaactg"
/db_xref="dbSNP:1562242475"
variation 900
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777575703"
variation 901..902
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aataa"
/db_xref="dbSNP:2152793817"
variation 901
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777577185"
variation 902..903
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="t"
/db_xref="dbSNP:2152793836"
variation 902
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="ata"
/db_xref="dbSNP:2152793827"
variation 903
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1483994464"
variation 904
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777578098"
variation 905
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598584951"
variation 906
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777579399"
variation 907
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777580003"
variation 908..909
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aacaa"
/db_xref="dbSNP:1777581374"
variation 908
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1598584980"
variation 915
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426701425"
variation 918..919
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="g"
/db_xref="dbSNP:1172705532"
variation 918
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1180461376"
variation 919..920
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ag"
/db_xref="dbSNP:1777584257"
variation 919
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1252604143"
variation 920..921
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="gg"
/db_xref="dbSNP:1777585639"
variation 920..921
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:61349814"
variation 920
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1475515750"
variation 922..924
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaa"
/replace="aaaaaa"
/db_xref="dbSNP:1777586282"
variation 923
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777586898"
variation 926
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1357659795"
variation 929
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:553445526"
variation 930
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1490136106"
variation 932..938
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="acggaaa"
/db_xref="dbSNP:1303533291"
variation 933
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:930931926"
variation 937
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:935176117"
variation 939
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1598585342"
variation 946
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777591213"
variation 949..951
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ggt"
/replace="ggtggt"
/db_xref="dbSNP:370387981"
variation 953
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2152794045"
variation 954..958
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1361325053"
variation 955
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152794060"
variation 959
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1361851194"
variation 962
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:758971493"
variation 965
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777594193"
variation 974
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1238442766"
variation 980
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777595628"
variation 981
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1315158472"
variation 982
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1053637545"
variation 983
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777597424"
variation 984..986
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1777598006"
variation 987
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1410947449"
variation 992
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:893601730"
variation 993
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777599402"
variation 1000
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1006819262"
variation 1002
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777600556"
variation 1004
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777601109"
variation 1006
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1406461826"
variation 1007
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:572116540"
variation 1013
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777602918"
variation 1014
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1562242799"
variation 1015
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1018571293"
variation 1016
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777604626"
variation 1017
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:245847"
variation 1018
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777605989"
variation 1019
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777606587"
variation 1020
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777607164"
variation 1021
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777607709"
variation 1023
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598585687"
variation 1025
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777608809"
variation 1027
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1451034084"
variation 1028
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777609721"
variation 1030
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777610305"
variation 1036
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1364995002"
variation 1038
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:552831972"
variation 1044
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1036562070"
variation 1045
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1421236858"
variation 1046
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598585797"
variation 1047
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:192077666"
variation 1049
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777613099"
variation 1050
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598585827"
variation 1051
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:933607088"
variation 1054
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777614394"
variation 1060
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451904847"
variation 1063
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777615164"
variation 1071
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:764372728"
variation 1075..1098
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="taggt"
/replace="taggtaaattttcctaagttaggt"
/db_xref="dbSNP:1777616314"
variation 1075
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:543009622"
variation 1076
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777616695"
variation 1077
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777617047"
variation 1080..1082
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1562242909"
variation 1080
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004896853"
variation 1082
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051088380"
variation 1084
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1016397498"
variation 1085
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1229610244"
variation 1087
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1323447372"
variation 1089
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1281860088"
variation 1092
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777619949"
variation 1104
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:963845150"
variation 1115
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777620723"
variation 1119
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777621104"
variation 1120..1121
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1331998547"
variation 1121
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1317251304"
variation 1126
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195843823"
variation 1132
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777622974"
variation 1133
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380147206"
variation 1137
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263819372"
variation 1139
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1320629906"
variation 1141
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:182938883"
variation 1142
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2152794552"
variation 1143
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1427128014"
variation 1145
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1178444166"
variation 1146
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:563036598"
variation 1147
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777627504"
variation 1148
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777627908"
variation 1149
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1562243016"
variation 1150
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777628996"
variation 1153
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:754029421"
variation 1155
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1372261657"
variation 1156
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1192812174"
variation 1159
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777631456"
variation 1162
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:991088992"
variation 1163
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426948135"
variation 1165
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1209447403"
variation 1173
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:889133293"
variation 1174
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777634640"
variation 1175
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:2152794696"
variation 1177
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1480037249"
variation 1179
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:916814672"
variation 1180
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1202667495"
variation 1182
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:187559174"
variation 1189
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:981755926"
variation 1191
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1269962925"
variation 1192
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777639058"
variation 1193
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1168803431"
variation 1198
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1423368862"
variation 1200
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:75416705"
variation 1201
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777641095"
variation 1205
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1451304380"
variation 1206
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:192378896"
variation 1207
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338669456"
variation 1211
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777642717"
variation 1212
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1024825917"
variation 1214
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1344749260"
variation 1225
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:970936876"
variation 1227
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="g"
/db_xref="dbSNP:1300046845"
variation 1235
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1053501375"
variation 1239
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1476233139"
variation 1243
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777645393"
variation 1244
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777645738"
variation 1245
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1404834326"
variation 1246
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:879534712"
variation 1247
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777646824"
variation 1249
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777647196"
variation 1251
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1392272830"
variation 1259
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1273483000"
variation 1260
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777648286"
variation 1264
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152794933"
variation 1266
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1189401750"
variation 1269
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:980719685"
variation 1272
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777649734"
variation 1273
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777650132"
variation 1278
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777650620"
variation 1280
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:528659429"
variation 1288
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777651339"
variation 1289..1290
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1777651727"
variation 1292
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:915085021"
variation 1295
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1219506051"
variation 1296
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1033975334"
variation 1299
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777653323"
variation 1305
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777654141"
variation 1307
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777654542"
variation 1310
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1283113520"
variation 1311
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777655656"
variation 1313
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598586920"
variation 1314
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:548801646"
variation 1319
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1039659795"
variation 1325
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1344694174"
variation 1327
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:952603667"
variation 1329
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1244753028"
variation 1337
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777659785"
variation 1343
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:568762448"
variation 1344
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152795122"
variation 1352
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777661159"
variation 1354
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:537790979"
variation 1355
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:144035316"
variation 1360
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051731541"
variation 1361
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1490175620"
variation 1363
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2152795180"
variation 1379
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:570822949"
variation 1380
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:117219572"
variation 1382
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1370903287"
variation 1383
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1248295970"
variation 1385
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1424247624"
variation 1387
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777667446"
variation 1389
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:765234450"
variation 1391
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777668162"
variation 1395
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1016722868"
variation 1400..1404
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1777668957"
variation 1401
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1232830947"
variation 1402
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1192066254"
variation 1404
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:976885436"
variation 1406
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152795296"
variation 1411
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777670561"
variation 1415
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1221360855"
variation 1431
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777671429"
variation 1439
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:146732386"
variation 1440
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:963617614"
variation 1441
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1012820419"
variation 1445
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1466939002"
variation 1446
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1023914694"
variation 1448
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1228409917"
variation 1451
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777674028"
variation 1457
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777674362"
variation 1459
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:750935654"
variation 1463
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:970988104"
variation 1465
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:982331897"
variation 1470
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1160561416"
variation 1476
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:728465"
variation 1481
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1562243577"
variation 1482
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777676633"
variation 1486..1487
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="a"
/db_xref="dbSNP:1411559680"
variation 1486
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1350941760"
variation 1487
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:728464"
variation 1488
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1402796910"
variation 1498
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1348367506"
variation 1502
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777679471"
variation 1505
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1167116968"
variation 1513
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777680492"
variation 1514
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:534509796"
variation 1515
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406054509"
variation 1518
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777681471"
variation 1522
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777681851"
variation 1523..1526
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cttc"
/db_xref="dbSNP:889406695"
variation 1527
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1322131489"
variation 1528
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:373583446"
variation 1529
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777683350"
variation 1532
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:936918156"
variation 1536
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777684026"
variation 1543
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:574297288"
variation 1545
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1562243700"
variation 1558
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152795596"
variation 1563
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413249235"
variation 1565
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777685579"
variation 1566
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777685946"
variation 1567
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777686288"
variation 1569
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777686617"
variation 1573
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:75903547"
variation 1576
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1374228399"
variation 1577
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598588070"
variation 1581
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1221797799"
variation 1582
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1445964679"
variation 1584
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1039921959"
variation 1593
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777690008"
variation 1598
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:774350794"
variation 1601
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:933920417"
variation 1602
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1046881100"
variation 1611
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:906368671"
variation 1612
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152795727"
variation 1613
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1208055492"
variation 1617
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="t"
/db_xref="dbSNP:1777693069"
variation 1621
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2152795749"
variation 1623
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1291937875"
variation 1624
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1452048950"
variation 1626
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:563257326"
variation 1628
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1598588292"
variation 1630
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1295543106"
variation 1634
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777696635"
variation 1635
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1230921603"
variation 1636
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777697555"
variation 1639
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1344747860"
variation 1648..1652
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aca"
/replace="acaca"
/db_xref="dbSNP:1002485728"
variation 1651
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:886443852"
variation 1652
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004837641"
variation 1658
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777699734"
variation 1660
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2152795880"
variation 1665
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438106562"
variation 1671
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1431834331"
variation 1672
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:780842501"
variation 1674
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1598588484"
variation 1675
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777701906"
variation 1679
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152795926"
variation 1680
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598588503"
variation 1683
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1381060833"
variation 1686
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:728463"
variation 1692
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777704038"
variation 1693
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161467395"
variation 1694
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598588590"
variation 1696
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777705334"
variation 1699
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1005455409"
variation 1700
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777706206"
variation 1704
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406411278"
variation 1705
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1464914347"
variation 1706
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777708099"
variation 1707
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1015288410"
variation 1710
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1201652548"
variation 1715
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777709671"
variation 1720
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1313791335"
variation 1723
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301709089"
variation 1729
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220105124"
variation 1735
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777711339"
variation 1736
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1012310277"
variation 1738
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1398520798"
variation 1740
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152796132"
variation 1742
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777712716"
variation 1744
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777713129"
variation 1745
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777713569"
variation 1746
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777714019"
variation 1747
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777714475"
variation 1754
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777714880"
variation 1756
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598588803"
variation 1759
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777715724"
variation 1761..1771
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="agaagaag"
/replace="agaagaagaag"
/db_xref="dbSNP:371412446"
variation 1763
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777716624"
variation 1770
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1331598577"
variation 1771
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:75276279"
variation 1775
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1437394509"
variation 1776
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1381494606"
variation 1782
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1024237878"
variation 1783
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2152796262"
variation 1784
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:906666995"
variation 1791
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:922308121"
variation 1792
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1464970343"
variation 1797..1800
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="at"
/replace="atat"
/db_xref="dbSNP:1777721255"
variation 1797
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1285394789"
variation 1799
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:953820072"
variation 1802
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777722440"
variation 1804
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1003802331"
variation 1808
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1031258642"
variation 1811
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1177250004"
variation 1821
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1409690867"
variation 1822
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:866803746"
variation 1824
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:989539928"
variation 1830
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777726196"
variation 1834
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:936941110"
variation 1838
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777727073"
variation 1842
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1022066252"
variation 1847
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1181742460"
variation 1851
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:769345605"
variation 1853
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1484193934"
variation 1858
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1053932297"
variation 1859
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598589261"
variation 1860
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:185698260"
variation 1864
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1305502507"
variation 1868
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777730832"
variation 1877
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:975158397"
variation 1878..1881
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ca"
/replace="caca"
/db_xref="dbSNP:768795371"
variation 1879
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777732244"
variation 1882
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:772658618"
variation 1888
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:139377014"
variation 1889
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:771033789"
variation 1894
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:149423081"
variation 1898
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:532070294"
variation 1899
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2152796531"
variation 1906
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1429988486"
variation 1907..1911
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ttttt"
/replace="tttttt"
/db_xref="dbSNP:1170145006"
variation 1907
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777736211"
variation 1908
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1005486470"
variation 1914
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1384143649"
variation 1915
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:562220270"
variation 1917
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1424986530"
variation 1919
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777739231"
variation 1920
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1185540842"
variation 1922
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777740124"
variation 1928..1935
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="ttccctat"
/db_xref="dbSNP:1176512149"
variation 1930
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1370228617"
variation 1931
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777741595"
variation 1934
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:144687412"
variation 1936
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1038125678"
variation 1938
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777743135"
variation 1939
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:759356367"
variation 1940
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777743964"
variation 1941
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598589716"
variation 1942
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598589740"
variation 1945
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777745323"
variation 1946
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:767228366"
variation 1961
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777746215"
variation 1964
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1242728856"
variation 1968..1977
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaaaaaaaa"
/replace="aaaaaaaaaa"
/replace="aaaaaaaaaaa"
/db_xref="dbSNP:571624113"
variation 1968
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1223691597"
variation 1969
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1045117053"
variation 1974
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:958163268"
variation 1978
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:776844986"
variation 1980..1988
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="acc"
/replace="accacaacc"
/db_xref="dbSNP:1777750006"
variation 1980
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:989691004"
variation 1981
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777750612"
variation 1982
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:148076523"
variation 1983
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:375278163"
variation 1986
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:551265121"
variation 1987
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:906741268"
variation 1988
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1393886772"
variation 1991
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1003708813"
variation 1992
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1335665039"
variation 1995
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1471562985"
variation 1997
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152796878"
variation 1999
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777756703"
variation 2010
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414004798"
variation 2017
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1340523985"
variation 2025
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777758471"
variation 2026
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777759085"
variation 2028
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1430001903"
variation 2029
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777760198"
variation 2030
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2152796933"
variation 2031
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777760771"
variation 2034..2035
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1777761302"
variation 2038
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777761866"
variation 2039
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777762434"
variation 2044
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777762901"
variation 2045
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1276220677"
variation 2047
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1490111054"
variation 2055
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777764524"
variation 2056
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1266979920"
variation 2057
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1208253053"
variation 2061
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777766485"
variation 2073
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777767139"
variation 2074
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1489532488"
variation 2075
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777768509"
variation 2083
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777769111"
variation 2087
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777770046"
variation 2089
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1266092685"
variation 2091
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777771292"
variation 2096
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1319823552"
variation 2100
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1219025638"
variation 2102
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1031288357"
variation 2103
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777773152"
variation 2105
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777773554"
variation 2110
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777773977"
variation 2113
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1327711630"
variation 2114
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1344620380"
variation 2116
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1229424754"
variation 2117
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:892706254"
variation 2119
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1345229572"
variation 2122
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1277274939"
variation 2129
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777777159"
variation 2130
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1298792213"
variation 2131
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598590410"
variation 2134
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:945640698"
variation 2135
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152797244"
variation 2140
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152797251"
variation 2142
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1287784343"
variation 2143
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777779048"
variation 2145..2152
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tttg"
/replace="tttgtttg"
/db_xref="dbSNP:748415547"
variation 2148
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777779948"
variation 2154
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390774280"
variation 2155
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1258415494"
variation 2156
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777781155"
variation 2157
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777781543"
variation 2159
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777781951"
variation 2161
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:571187624"
variation 2162
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:368241153"
variation 2165
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777783089"
variation 2169
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777783458"
variation 2170
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1046860304"
variation 2178
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777784246"
variation 2179
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1375696019"
variation 2182
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197095900"
variation 2183
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1435122329"
variation 2188
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1011132655"
variation 2189
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:927967417"
variation 2192
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1261664767"
variation 2193
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1022390399"
variation 2198
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1270609267"
variation 2200
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777786881"
variation 2202
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:963711122"
variation 2205
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777787733"
variation 2208
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777788114"
variation 2212
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777788458"
variation 2214
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1428985518"
variation 2215
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:975568893"
variation 2218
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777789617"
variation 2223
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1029364928"
variation 2228
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:539433715"
variation 2230
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777790829"
variation 2231
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152797530"
variation 2232
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1235047013"
variation 2241
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1173951959"
variation 2244
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1331339353"
variation 2245
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1402377800"
variation 2254
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1432295151"
variation 2257
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152797583"
variation 2259
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598590944"
variation 2263
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:547011886"
variation 2270..2271
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="cc"
/db_xref="dbSNP:1777794164"
variation 2271..2280
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tgagtg"
/replace="tgagtgagtg"
/db_xref="dbSNP:770660292"
variation 2271
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777794532"
variation 2272
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1321194008"
variation 2274
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1469215724"
variation 2276
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1399881015"
variation 2278
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1174113091"
variation 2279
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:888288819"
variation 2281
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1777797617"
variation 2285
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:566847653"
variation 2286
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:982565901"
variation 2287
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:908489688"
variation 2293
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598591209"
variation 2297
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1447782076"
variation 2299
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777800129"
variation 2301
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:372914391"
variation 2302
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777800935"
variation 2307
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777801584"
variation 2309
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:941289114"
variation 2311
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777802707"
variation 2313
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777803318"
variation 2315
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1562245037"
variation 2317
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1189846061"
variation 2318
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:973984840"
variation 2319
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1277050929"
variation 2321
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:762005858"
variation 2324
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777807017"
variation 2327
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1346098492"
variation 2328
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1438725"
variation 2337
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777809213"
variation 2338
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:555450544"
variation 2340
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225701115"
variation 2358
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:948079532"
variation 2359
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045593201"
variation 2367
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:889428939"
variation 2368
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1336040018"
variation 2369
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:906604828"
variation 2372
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:939524751"
variation 2374
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777814789"
variation 2377
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1168254748"
variation 2378
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598591577"
variation 2379
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777816811"
variation 2381
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777817442"
variation 2382
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777818103"
variation 2383..2385
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1777818663"
variation 2388
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152797975"
variation 2390
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1216007709"
variation 2401
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1392177582"
variation 2402
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1283917839"
variation 2403
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777821133"
variation 2404
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1472479375"
variation 2406
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052620861"
variation 2416
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1489577699"
variation 2418
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443399615"
variation 2419
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1195000076"
variation 2420
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777824319"
variation 2421
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:892607790"
variation 2422..2423
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:957113269"
variation 2423
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777825659"
variation 2426
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777826295"
variation 2434
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777826939"
variation 2435
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777827614"
variation 2436
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:574259419"
variation 2438
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:989641723"
variation 2452
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011580839"
variation 2457
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1438724"
variation 2458
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:967387992"
variation 2468
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777831116"
variation 2471..2473
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aca"
/db_xref="dbSNP:1777831889"
variation 2471
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:982361275"
variation 2472
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:899535204"
variation 2473
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:556816995"
variation 2474
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1377856341"
variation 2477
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1349710336"
variation 2478
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1452542222"
variation 2482
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411361991"
variation 2484
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:758867296"
variation 2485
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:577105409"
variation 2486
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1404876005"
variation 2487
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1361863367"
variation 2491..2492
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1777836635"
variation 2492
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777837021"
variation 2495
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777837336"
variation 2499
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777837620"
variation 2500..2505
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1411687546"
variation 2500
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777838002"
variation 2505
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1029394285"
variation 2506
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777839103"
variation 2507
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777839475"
variation 2509
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152798343"
variation 2512
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:548246089"
variation 2517..2521
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="actga"
/db_xref="dbSNP:1388395935"
variation 2517
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152798366"
variation 2518
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:941421053"
variation 2519
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1036897027"
variation 2525
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1388305248"
variation 2526
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1003889850"
variation 2527
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777841781"
variation 2528
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:766828118"
variation 2531
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301651530"
variation 2533
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1449425784"
variation 2538
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777843337"
variation 2539
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777843675"
variation 2540
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1291391992"
variation 2543
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1562245508"
variation 2547
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331928687"
variation 2550
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328401226"
variation 2553
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:371821755"
variation 2555
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777846916"
variation 2558
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1562245541"
variation 2560
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1239651303"
variation 2568
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1230034530"
variation 2569
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1350847376"
variation 2570
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777850044"
variation 2572
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777850612"
variation 2573
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777851183"
variation 2577
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777851537"
variation 2579
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777851878"
variation 2582
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777852214"
variation 2583..2594
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gaa"
/replace="gaactaatggaa"
/db_xref="dbSNP:1280405053"
variation 2590
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:559349576"
variation 2596
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152798546"
variation 2597
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777853366"
variation 2598
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1348279504"
variation 2602
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:962536520"
variation 2604
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1355928941"
variation 2605
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1050989626"
variation 2613
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:56883765"
variation 2616
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777855955"
variation 2619
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:752077646"
variation 2620
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157538406"
variation 2621
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006548960"
variation 2623
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777857334"
variation 2632
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1413133045"
variation 2633
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1032631743"
variation 2635
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:969824227"
variation 2636
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:980751871"
variation 2639
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:755272879"
variation 2648
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:927928723"
variation 2653..2657
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="agcag"
/db_xref="dbSNP:1777860226"
variation 2653
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598592779"
variation 2655
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1268368723"
variation 2656
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:939427971"
variation 2657
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777861314"
variation 2658
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1464015792"
variation 2662
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1438808143"
variation 2663
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152798691"
variation 2664
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1009923098"
variation 2666
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152798702"
variation 2670
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:189157931"
variation 2672
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:541872249"
variation 2674
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:76910677"
variation 2676..2677
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1777863971"
variation 2678
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1052483014"
variation 2679
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:966875608"
variation 2680
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:914057818"
variation 2681
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777865934"
variation 2682
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1276779765"
variation 2684
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:946901192"
variation 2685
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141893898"
variation 2687
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1319193641"
variation 2692
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1459273025"
variation 2700..2703
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1346233163"
variation 2700
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777869929"
variation 2701
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1175808309"
variation 2705
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1413068944"
variation 2706
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777872096"
variation 2709
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777872613"
variation 2711
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1426859531"
variation 2715
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777873678"
variation 2726
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777874208"
variation 2728
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777874753"
variation 2738
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:575896015"
variation 2749
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777875836"
variation 2752
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:544850886"
variation 2754
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:564760598"
variation 2761
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1448399266"
variation 2771
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152798861"
variation 2774
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777878251"
variation 2775
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777878806"
variation 2777
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1245647414"
variation 2778
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1366184740"
variation 2784
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1190503983"
variation 2786
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146106500"
variation 2790
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:546979998"
variation 2792
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777882269"
variation 2793
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1236771509"
variation 2794
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:959887593"
variation 2796
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293717987"
variation 2798
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:890757900"
variation 2803
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777885062"
variation 2809
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1562246005"
variation 2811
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1395358645"
variation 2813
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:545070343"
variation 2814
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:3776368"
variation 2815
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1295494793"
variation 2816
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777888789"
variation 2818..2819
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1777889335"
variation 2820
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1437289358"
variation 2821
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777890491"
variation 2823
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777891118"
variation 2825
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:192791038"
variation 2827
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:529286665"
variation 2830
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777893186"
variation 2832
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777893878"
variation 2833
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777894415"
variation 2837
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152799039"
variation 2838
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:972791096"
variation 2840
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1361235817"
variation 2845
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1173938509"
variation 2846
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:962897747"
variation 2848
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777896411"
variation 2858
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777896802"
variation 2859..2861
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="ctc"
/db_xref="dbSNP:1387864228"
variation 2861
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1319971715"
variation 2864
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:995340029"
variation 2865
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777898261"
variation 2869
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:918421959"
variation 2872
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:184674882"
variation 2874
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:188648237"
variation 2875
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777900036"
variation 2876
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777900401"
variation 2877
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:181260246"
variation 2878
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:981325314"
variation 2881
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152799137"
variation 2886
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1211949856"
variation 2889
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777902031"
variation 2901
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:544584978"
variation 2902
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:960657007"
variation 2903
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1196453282"
variation 2904
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1230735531"
variation 2905
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777903694"
variation 2908
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:988261557"
variation 2910
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:747826137"
variation 2912
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777904706"
variation 2913
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777905031"
variation 2915
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777905599"
variation 2921
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:776732885"
variation 2923
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1381874478"
variation 2929
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313871551"
variation 2930
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1054072580"
variation 2933
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2152799274"
variation 2934..2935
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ag"
/db_xref="dbSNP:1368338145"
variation 2935
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1309425641"
variation 2936
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2152799293"
variation 2940..2941
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1458089341"
variation 2943
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2152799304"
variation 2946
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777908820"
variation 2947
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:892780189"
variation 2949
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1162669750"
variation 2958
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:946903243"
variation 2960
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777910195"
variation 2962
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1418409399"
variation 2963
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:556780365"
variation 2968
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777911099"
variation 2969
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1424995690"
variation 2970
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1164884261"
variation 2975
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1471461436"
variation 2977
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777912428"
variation 2978
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777912745"
variation 2981..2982
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1777913389"
variation 2981
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1449178599"
variation 2982
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777913700"
variation 2987
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:76249035"
variation 2989
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1197749974"
variation 2990
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1481032313"
variation 2993
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777915040"
variation 2995..2997
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1264930804"
variation 2995
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219373479"
variation 3000
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:902685032"
variation 3002
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1294393132"
variation 3003
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:921408466"
variation 3008
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777916634"
variation 3010
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1172447827"
variation 3011
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:932913839"
variation 3017
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:959642086"
variation 3022
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1443436889"
variation 3024
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1562246460"
variation 3025
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152799492"
variation 3039
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:184206286"
variation 3042
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:533159476"
variation 3044
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1291293193"
variation 3048
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777920942"
variation 3049
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:553005261"
variation 3052
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:765581790"
variation 3053
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1313536161"
variation 3056
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777922010"
variation 3059
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152799539"
variation 3070
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:939682826"
variation 3071..3074
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tcat"
/db_xref="dbSNP:1158285409"
variation 3072
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598594786"
variation 3073
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:770588041"
variation 3074
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:898227444"
variation 3078
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:995643415"
variation 3093
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1016966374"
variation 3094
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777925187"
variation 3095
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777925532"
variation 3103
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1419896368"
variation 3104
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1266867481"
variation 3107
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1022812199"
variation 3108
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:905656523"
variation 3120
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1260287214"
variation 3121
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777927458"
variation 3123
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1208625217"
variation 3124
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777928114"
variation 3125
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1002790880"
variation 3127..3132
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="caca"
/replace="cacaca"
/db_xref="dbSNP:2152799680"
variation 3127
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777928803"
variation 3129
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:774372783"
variation 3132
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:188958013"
variation 3134
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:972813917"
variation 3136
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1330166179"
variation 3143
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1298681253"
variation 3147
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1388044353"
variation 3150
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777931620"
variation 3154
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1371056946"
variation 3155
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:918716009"
variation 3159
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598595249"
variation 3161
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:955633301"
variation 3163
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1598595310"
variation 3167..3180
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tcctcaccaactcc"
/replace="tcctcaccaactcctcaccaactcc"
/db_xref="dbSNP:1777935791"
variation 3167
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:960729634"
variation 3173
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777936218"
variation 3174
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1235612468"
variation 3177
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777937028"
variation 3180
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777937419"
variation 3181
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:949503239"
variation 3182
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:988125698"
variation 3183
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777938622"
variation 3187
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1598595424"
variation 3188
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1174181069"
variation 3189
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1455675789"
variation 3190
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598595473"
variation 3191..3206
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tttttt"
/replace="ttttttcttttttttt"
/db_xref="dbSNP:1777942140"
variation 3191..3205
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tttttt"
/replace="ttttttctttttttt"
/db_xref="dbSNP:1777941545"
variation 3191..3198
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ttttttct"
/replace="ttttttctgttttttttttttttttttttttttttct"
/replace="ttttttctgttttttttttttttttttttttttttttttttttttttt
tttttttct"
/replace="ttttttctgttttttttttttttttttttttttttttttttttttttt
tttttttttttttttct"
/db_xref="dbSNP:1562246743"
variation 3191..3196
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tttttt"
/replace="ttttttt"
/replace="ttttttttgtttttttt"
/db_xref="dbSNP:1777940486"
variation 3193
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777942796"
variation 3194
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:911028236"
variation 3195..3199
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tt"
/replace="ttctt"
/db_xref="dbSNP:1777944769"
variation 3195
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1262915782"
variation 3196
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777945467"
variation 3197..3198
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="g"
/db_xref="dbSNP:1777947598"
variation 3197
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="c"
/db_xref="dbSNP:1777946983"
variation 3197
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1045442020"
variation 3198..3219
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tttttttttt"
/replace="ttttttttttt"
/replace="ttttttttttttt"
/replace="tttttttttttttt"
/replace="ttttttttttttttt"
/replace="tttttttttttttttt"
/replace="ttttttttttttttttt"
/replace="tttttttttttttttttt"
/replace="ttttttttttttttttttt"
/replace="tttttttttttttttttttt"
/replace="ttttttttttttttttttttt"
/replace="tttttttttttttttttttttt"
/replace="ttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttt"
/replace="ttttttttttttttttttttttttt"
/db_xref="dbSNP:rs34154406"
variation 3198..3199
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="g"
/db_xref="dbSNP:59498324"
variation 3198
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777948178"
variation 3198
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tgt"
/replace="tgtt"
/replace="tgttt"
/replace="tgtttt"
/replace="tgttttttt"
/replace="tgtttttttt"
/replace="tgttttttttt"
/replace="tgtttttttttt"
/replace="tgttttttttttt"
/replace="tgtttttttttttt"
/replace="tgttttttttttttt"
/replace="tgtttttttttttttttttttttttttttttttttt"
/db_xref="dbSNP:rs772059084"
variation 3199
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11167796"
variation 3200
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:76994992"
variation 3201
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1476583683"
variation 3202
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:865982895"
variation 3203
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1423935934"
variation 3204
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1378465721"
variation 3205
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1273400438"
variation 3206
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1410832639"
variation 3207..3208
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="g"
/db_xref="dbSNP:1777961652"
variation 3207
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1175813551"
variation 3208
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1357865010"
variation 3209
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777962846"
variation 3210
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1468024405"
variation 3211
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1338554056"
variation 3212
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1777964933"
variation 3216
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1294908153"
variation 3217..3220
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ttta"
/db_xref="dbSNP:2152800082"
variation 3218
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:74783873"
variation 3219
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:62382764"
variation 3220..3221
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="aa"
/db_xref="dbSNP:1398267582"
variation 3220..3221
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1777967065"
variation 3220
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1219707140"
variation 3221
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1341382049"
variation 3223
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1307611913"
variation 3224..3227
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="gcag"
/db_xref="dbSNP:1218362722"
variation 3224
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1387253102"
variation 3225
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1398704068"
variation 3226
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598596282"
variation 3231..3233
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ctc"
/db_xref="dbSNP:1276242414"
variation 3231
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313799598"
variation 3233
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210702405"
variation 3236
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777971832"
variation 3237
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021479616"
variation 3238
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1486999317"
variation 3239
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2152800175"
variation 3241..3246
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ct"
/replace="ctctct"
/db_xref="dbSNP:567460083"
variation 3241
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777972505"
variation 3243
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1263380814"
variation 3246..3252
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tat"
/replace="tatttat"
/db_xref="dbSNP:1367171367"
variation 3247
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1190536096"
variation 3249
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:541872747"
variation 3251
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1250666157"
variation 3254
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777975382"
variation 3255
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1777975724"
variation 3256
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:867784216"
variation 3258
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777976528"
variation 3260
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1598596537"
variation 3265
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:921444917"
variation 3266
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1273091239"
variation 3269
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777978043"
variation 3271
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777978468"
variation 3274
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:932819138"
variation 3276
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1354182408"
variation 3282
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1423484757"
variation 3283
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777979981"
variation 3288
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777980369"
variation 3298..3302
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ccc"
/replace="ccccc"
/replace="cccccc"
/db_xref="dbSNP:1233709293"
variation 3298
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1598596656"
variation 3299
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1435326631"
variation 3301
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777982156"
variation 3302
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:181873684"
variation 3303
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598596766"
variation 3304
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:942638229"
variation 3308
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1337686305"
variation 3310
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152800355"
variation 3311
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:987048426"
variation 3312
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777984530"
variation 3319
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1404787563"
variation 3320
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777985294"
variation 3323
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1054270781"
variation 3332
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1562247236"
variation 3334
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1167692529"
variation 3341
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152800405"
variation 3342
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1174776078"
variation 3348
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777987216"
variation 3350
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777987591"
variation 3352
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1360479919"
variation 3356
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:745803763"
variation 3357
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1179652801"
variation 3358
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1470961424"
variation 3362
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233038150"
variation 3364
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:914247583"
variation 3366
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:939714500"
variation 3369
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777990672"
variation 3372
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777991058"
variation 3373
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777991430"
variation 3375
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1345935645"
variation 3376
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777992179"
variation 3377
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1036720943"
variation 3378
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:78881628"
variation 3381
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1436015143"
variation 3382
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777993799"
variation 3387
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11750827"
variation 3388
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1777994543"
variation 3390
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:931083521"
variation 3399
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:775204600"
variation 3400
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777995649"
variation 3408
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777996015"
variation 3410
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598597226"
variation 3413
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1328295147"
variation 3416
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1266007034"
variation 3425
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1777997434"
variation 3426
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777997832"
variation 3427
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1041774171"
variation 3428
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1777998625"
variation 3430
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152800603"
variation 3431
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1234793301"
variation 3432
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308381263"
variation 3434
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1777999835"
variation 3436
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778000180"
variation 3438
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778000554"
variation 3442
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:762070526"
variation 3445
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1435896431"
variation 3449
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1368844545"
variation 3450
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:905732237"
variation 3451
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598597413"
variation 3463
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778002865"
variation 3464
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1218081617"
variation 3465
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/db_xref="dbSNP:2152800678"
variation 3465
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778003568"
variation 3466
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598597447"
variation 3468
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1328585174"
variation 3470
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778004848"
variation 3475
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1442279398"
variation 3477
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778005597"
variation 3479
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778006161"
variation 3482
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002697277"
variation 3483
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778007409"
variation 3485
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157394049"
variation 3486
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1402753971"
variation 3487
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1035635852"
variation 3493
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:560245216"
variation 3494
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778010792"
variation 3505
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598597611"
variation 3511
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1003024041"
variation 3515
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:2152800760"
variation 3520
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056661200"
variation 3521
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1464393553"
variation 3528
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1246059724"
variation 3536
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778014122"
variation 3543
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1317257657"
variation 3544
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1285276265"
variation 3546
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1010133576"
variation 3547
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:895294529"
variation 3550
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:116787713"
variation 3555..3559
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gag"
/replace="gagag"
/db_xref="dbSNP:1778018276"
variation 3559
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:968414400"
variation 3562
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:979580339"
variation 3564
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1433381452"
variation 3571
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1028818872"
variation 3572
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:954241211"
variation 3577
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778021604"
variation 3578
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778022105"
variation 3579
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1333165387"
variation 3587
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:962952776"
variation 3594
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1194673666"
variation 3598
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1396444524"
variation 3603
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778024872"
variation 3606
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1173738483"
variation 3607
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448303822"
variation 3608
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380158924"
variation 3613
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:986913737"
variation 3615
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1188176165"
variation 3618
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778027188"
variation 3624
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1236674796"
variation 3631
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1207679340"
variation 3632
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778028328"
variation 3633
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1562247715"
variation 3635
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:994211754"
variation 3639
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598598242"
variation 3643
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778029819"
variation 3649
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:912708401"
variation 3653
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:955507511"
variation 3654
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294122753"
variation 3661
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778031200"
variation 3665
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778031522"
variation 3666
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="a"
/db_xref="dbSNP:548953277"
variation 3669
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1404881794"
variation 3675
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1598598360"
variation 3676
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1321785934"
variation 3677
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778033405"
variation 3678
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1351859951"
variation 3684
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:564655046"
variation 3685
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778034544"
variation 3686
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778034920"
variation 3690
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:973363560"
variation 3693
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778035663"
variation 3696
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1283980975"
variation 3699
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1413265339"
variation 3702
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1376926471"
variation 3706
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1441289252"
variation 3709
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2152801140"
variation 3714
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:987265895"
variation 3716
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1352244241"
variation 3718
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778037787"
variation 3719
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1172524922"
variation 3721
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778038461"
variation 3731
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1778039682"
variation 3731
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778039337"
variation 3732
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152801179"
variation 3734
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1429052406"
variation 3739
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1412906731"
variation 3750
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1185560479"
variation 3751
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:533370157"
variation 3754
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1330430301"
variation 3759
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778042083"
variation 3760
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778042725"
variation 3769
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:963812132"
variation 3772
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778044049"
variation 3773
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778044638"
variation 3775
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1211842213"
variation 3778
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:990029260"
variation 3785
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778046461"
variation 3787
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778047093"
variation 3789
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778047711"
variation 3793
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1249687271"
variation 3795
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778048970"
variation 3800
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:543383464"
variation 3805..3806
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ag"
/db_xref="dbSNP:1778051049"
variation 3805
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372823934"
variation 3815
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:914531625"
variation 3819
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:140073672"
variation 3822
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1280112415"
variation 3827
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1357732939"
variation 3828
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1293588061"
variation 3832
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:560643662"
variation 3836
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778054844"
variation 3837
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778055471"
variation 3838
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:928273286"
variation 3842
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1370638057"
variation 3846
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:114938849"
variation 3850
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1349258437"
variation 3853
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226145426"
variation 3856
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:528488810"
variation 3857
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:927014882"
variation 3860
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1462864840"
variation 3861
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1418292575"
variation 3863..3865
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cac"
/db_xref="dbSNP:1189006116"
variation 3865
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1335085107"
variation 3867
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1418729426"
variation 3868
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1248623926"
variation 3869
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778063871"
variation 3876
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:938517749"
variation 3877
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1237943512"
variation 3881
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:549001436"
variation 3882
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1212349288"
variation 3883
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1181019403"
variation 3885
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1030173297"
variation 3891
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:569002646"
variation 3894
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:245848"
variation 3899
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1330111174"
variation 3900
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778071195"
variation 3903
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778071679"
variation 3907
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778072106"
variation 3908
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1010161809"
variation 3909
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228106126"
variation 3911
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778073317"
variation 3916
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314787576"
variation 3917
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778074272"
variation 3918
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778074658"
variation 3919
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:79934145"
variation 3920
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1161549026"
variation 3922
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778076021"
variation 3926
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:144116660"
variation 3929..3932
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1462158976"
variation 3932
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1554193474"
variation 3933
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778077762"
variation 3936
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:903887347"
variation 3939
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778078563"
variation 3940
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778078957"
variation 3941
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:948239876"
variation 3944
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1158170141"
variation 3948
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778080164"
variation 3950
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397820584"
variation 3965
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1451301604"
variation 3966
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778081379"
variation 3971
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778081735"
variation 3974
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778082157"
variation 3975
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2152801638"
variation 3981
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001261650"
variation 3982
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1161521166"
variation 3988
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448766358"
variation 3990
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1394550782"
variation 3991
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:116660451"
variation 3994
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339822890"
variation 3995
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:145993863"
variation 3996
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1485079655"
variation 4000
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1262177368"
variation 4001..4006
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="agg"
/replace="aggagg"
/db_xref="dbSNP:1239302849"
variation 4001
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778086313"
variation 4004
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1008239461"
variation 4007
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778087690"
variation 4011
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598599849"
variation 4015
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:2152801758"
variation 4015
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1334986038"
variation 4024
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1019750446"
variation 4025
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1255807716"
variation 4028
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1371674510"
variation 4030
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:767904835"
variation 4030
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cc"
/db_xref="dbSNP:2152801799"
variation 4031
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:973045516"
variation 4032
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:553208339"
variation 4034
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217973188"
variation 4037
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152801823"
variation 4041
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="a"
/db_xref="dbSNP:1778092441"
variation 4041
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1454628628"
variation 4043
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778093036"
variation 4048..4049
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1778094345"
variation 4048
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1442354965"
variation 4056
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778095023"
variation 4057
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:533788296"
variation 4058
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778096273"
variation 4059
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:920162585"
variation 4060
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778097130"
variation 4063
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1394918840"
variation 4065..4068
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:891091511"
variation 4065
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1239270444"
variation 4066
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1455998152"
variation 4070..4073
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tc"
/replace="tctc"
/db_xref="dbSNP:1778099631"
variation 4070
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778099241"
variation 4072
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="t"
/db_xref="dbSNP:1778100676"
variation 4072
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1475604160"
variation 4073..4074
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1778101698"
variation 4073
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778101323"
variation 4074..4076
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="cga"
/db_xref="dbSNP:1778102987"
variation 4074..4075
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="a"
/replace="aa"
/replace="aaaa"
/replace="aaaaaa"
/replace="t"
/db_xref="dbSNP:rs1562248543"
variation 4074..4075
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="cg"
/db_xref="dbSNP:1491125602"
variation 4074
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1264127629"
variation 4075..4084
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="gaaaaaaaaa"
/db_xref="dbSNP:1778111772"
variation 4075..4083
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="gaaaaaaaa"
/db_xref="dbSNP:796340411"
variation 4075..4082
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="gaaaaaaa"
/db_xref="dbSNP:1212891658"
variation 4075..4081
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="gaaaaaa"
/db_xref="dbSNP:1778110556"
variation 4075..4080
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="gaaaaa"
/db_xref="dbSNP:1562248660"
variation 4075..4078
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="gaaa"
/db_xref="dbSNP:373767920"
variation 4075..4077
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="gaa"
/db_xref="dbSNP:760257959"
variation 4075..4076
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ga"
/replace="t"
/db_xref="dbSNP:1778112173"
variation 4075..4076
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ga"
/db_xref="dbSNP:35266419"
variation 4075
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="g"
/db_xref="dbSNP:1206010538"
variation 4075
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:112905698"
variation 4075
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1491548771"
variation 4076..4097
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaaaaaaa"
/replace="aaaaaaaaaaa"
/replace="aaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaa"
/replace="aaaaaaaaaaaaaaaaaaaaaaaaaa"
/db_xref="dbSNP:rs34602049"
variation 4076
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:980156016"
variation 4077..4079
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaa"
/replace="aaagaaa"
/db_xref="dbSNP:1491437518"
variation 4077
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1008319305"
variation 4078
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778114453"
variation 4079
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487493363"
variation 4080
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778115180"
variation 4082
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1421796123"
variation 4083
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778115982"
variation 4084
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1189819484"
variation 4090
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:926920977"
variation 4091
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:938424806"
variation 4093
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1466943936"
variation 4095
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1194065647"
variation 4096
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1340834542"
variation 4097
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1168292064"
variation 4098
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="g"
/db_xref="dbSNP:1778120040"
variation 4098
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401320328"
variation 4099
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1412678838"
variation 4100
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778120493"
variation 4101
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1336148000"
variation 4104
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1056867652"
variation 4113
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778121765"
variation 4117
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:568443493"
variation 4119
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:913109672"
variation 4121
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778123286"
variation 4126
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232260768"
variation 4129
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:139642413"
variation 4130
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1043008678"
variation 4137
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1356576880"
variation 4139
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778125431"
variation 4140
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778125841"
variation 4141
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1328750893"
variation 4142
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:904421375"
variation 4145
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:245849"
variation 4147
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778127799"
variation 4151
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1398684315"
variation 4154
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1562248972"
variation 4160
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778128962"
variation 4166
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:989976576"
variation 4167
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1562248996"
variation 4170
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1049732859"
variation 4172..4174
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="ttt"
/db_xref="dbSNP:567400074"
variation 4173
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:117785724"
variation 4174
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1415966909"
variation 4175
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1008272018"
variation 4178..4179
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1342004873"
variation 4179
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1019652141"
variation 4185
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778133256"
variation 4186
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1271132372"
variation 4189
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1250557824"
variation 4192
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1344822792"
variation 4195
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1274657165"
variation 4196
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1598601311"
variation 4197
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598601329"
variation 4200
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1233584207"
variation 4209
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:575313356"
variation 4211
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2152802426"
variation 4212
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:928335199"
variation 4220
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778137724"
variation 4223
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1440592065"
variation 4224
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778138564"
variation 4226
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283134556"
variation 4227..4232
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ttttt"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1332051536"
variation 4232
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:867185472"
variation 4234
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440261768"
variation 4235
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778140418"
variation 4236
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778140812"
variation 4245
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778141209"
variation 4247
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1392451311"
variation 4251
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1328146522"
variation 4255
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:938315786"
variation 4258
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778142866"
variation 4259..4260
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1778144664"
variation 4259
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1406926785"
variation 4263
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1156617464"
variation 4271
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778145481"
variation 4275
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778145817"
variation 4278
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778146212"
variation 4279
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778146626"
variation 4280
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:991165901"
variation 4282
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778147486"
variation 4287
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778147856"
variation 4288
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:777242371"
variation 4293
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:994729042"
variation 4294
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778149050"
variation 4296
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152802591"
variation 4297
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152802597"
variation 4299
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778149449"
variation 4305
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1193003104"
variation 4306
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1466737596"
variation 4308
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1027260374"
variation 4311
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778151847"
variation 4312
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:187653966"
variation 4314
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1486015450"
variation 4315
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:190723003"
variation 4317
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1222432629"
variation 4318
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152802647"
variation 4319
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778154277"
variation 4320
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778154632"
variation 4321
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:181010942"
variation 4322
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:186047923"
variation 4328
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778155773"
variation 4329
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:980350288"
variation 4330
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:778833816"
variation 4333
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:540500408"
variation 4336
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1328044244"
variation 4339
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1437396254"
variation 4340
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:560824626"
variation 4345
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778158410"
variation 4349
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1194243202"
variation 4350
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778159125"
variation 4351
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376837005"
variation 4353
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778159924"
variation 4354
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:959654852"
variation 4355
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778160662"
variation 4356
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1476943278"
variation 4358
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1402228620"
variation 4363
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1360993153"
variation 4374..4375
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1778162564"
variation 4374
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778162192"
variation 4378
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778162917"
variation 4379
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:574037167"
variation 4380
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778163685"
variation 4382
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778164053"
variation 4383
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:912972497"
variation 4385
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778164776"
variation 4388
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1376019508"
variation 4391..4394
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:1452545375"
variation 4391
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1396318064"
variation 4397
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778166333"
variation 4401
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778166711"
variation 4403
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:930256253"
variation 4404
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1418501747"
variation 4405
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1240002234"
variation 4412
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778168403"
variation 4414
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1217577813"
variation 4419
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4912888"
variation 4420
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598602162"
variation 4429
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376762063"
variation 4435
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210749300"
variation 4436
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778170892"
variation 4438
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1346369915"
variation 4439
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778171667"
variation 4443
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778172186"
variation 4445
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778172598"
variation 4448
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1008685889"
variation 4449
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598602260"
variation 4453
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219891135"
variation 4459
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778174198"
variation 4468
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:149734129"
variation 4474
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:756759537"
variation 4475
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598602351"
variation 4476
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778175958"
variation 4480
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1268622877"
variation 4483
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1433212999"
variation 4486
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778177283"
variation 4498
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778177668"
variation 4502
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1018223284"
variation 4503
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1300223106"
variation 4504
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:931901579"
variation 4508
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1050267180"
variation 4510
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778180314"
variation 4512
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:889821508"
variation 4517
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778181102"
variation 4519
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:778633549"
variation 4526
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778181857"
variation 4530
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1176793601"
variation 4531
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778182610"
variation 4536..4537
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1011599597"
variation 4536
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778182980"
variation 4550
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152803042"
variation 4559
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778183808"
variation 4560
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4912889"
variation 4568
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152803068"
variation 4572
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1041138471"
variation 4576
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1187876931"
variation 4582
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778185437"
variation 4584
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:918103745"
variation 4585
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1264288601"
variation 4589
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1187698103"
variation 4591
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778186943"
variation 4592
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778187325"
variation 4595
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:949474727"
variation 4603
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598602712"
variation 4607
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:967589483"
variation 4608
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1283081292"
variation 4615
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1239427868"
variation 4616
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778190224"
variation 4617
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778190727"
variation 4618
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:2152803157"
variation 4623
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:375237165"
variation 4624
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:994239377"
variation 4628
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778192167"
variation 4631
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:777597186"
variation 4632
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:888587404"
variation 4633
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1341383827"
variation 4636
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1412701980"
variation 4637
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778194897"
variation 4638
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778195265"
variation 4639
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:959974478"
variation 4645
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152803219"
variation 4655
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:115528776"
variation 4659
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152803230"
variation 4661
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598602953"
variation 4664
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1449609497"
variation 4666
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195283463"
variation 4671
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:538110857"
variation 4681
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778198537"
variation 4682
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1416722351"
variation 4686
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1424172195"
variation 4688
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778199387"
variation 4693
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1162435001"
variation 4694..4702
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ttt"
/replace="tttatgttt"
/db_xref="dbSNP:1778200198"
variation 4696..4698
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tat"
/db_xref="dbSNP:1395540055"
variation 4697
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1439002444"
variation 4701..4707
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ttg"
/replace="ttgattg"
/replace="ttgattgattg"
/db_xref="dbSNP:34758908"
variation 4701
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:372482330"
variation 4704
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:374147819"
variation 4705..4709
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="ttgct"
/db_xref="dbSNP:1778203286"
variation 4707
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778203674"
variation 4715..4720
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1562249942"
variation 4715
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1381602301"
variation 4720
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778204779"
variation 4721
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:915560416"
variation 4722
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778205628"
variation 4723
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778206022"
variation 4728
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778206370"
variation 4731
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1480608373"
variation 4732
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:577597772"
variation 4733
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778207460"
variation 4743
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1034593019"
variation 4744
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1318786666"
variation 4745
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1388156196"
variation 4747
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1231745390"
variation 4750
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778209099"
variation 4756
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:959723509"
variation 4759
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778209835"
variation 4761..4773
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tcctttcc"
/replace="tcctttcctttcc"
/db_xref="dbSNP:1778210257"
variation 4764..4766
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1778210628"
variation 4769
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778211010"
variation 4773
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778211354"
variation 4774
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:992477303"
variation 4775
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:565261323"
variation 4777
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1223097012"
variation 4778
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:533132522"
variation 4780
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:546516067"
variation 4783..4789
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tta"
/replace="ttaatta"
/db_xref="dbSNP:1778213962"
variation 4786
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778214346"
variation 4795..4798
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="agtt"
/db_xref="dbSNP:1372261883"
variation 4795
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1358594675"
variation 4799
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:930095631"
variation 4800
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:566755425"
variation 4803
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778216382"
variation 4805
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1446673064"
variation 4809
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152803499"
variation 4810
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:771950557"
variation 4811
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1318771807"
variation 4812
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1239892762"
variation 4813
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778218376"
variation 4816
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:535699704"
variation 4817
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778219176"
variation 4821
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778219568"
variation 4821
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:34112524"
variation 4822
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1370521980"
variation 4830
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:944291111"
variation 4831
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039703586"
variation 4832
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1265024797"
variation 4833
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778222581"
variation 4834
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406423881"
variation 4835
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1181128702"
variation 4844
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778223944"
variation 4852
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2152803581"
variation 4854
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1458255157"
variation 4855
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778225037"
variation 4857
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778225608"
variation 4859
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1426508863"
variation 4865
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598603836"
variation 4867
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1212017412"
variation 4869
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:925784082"
variation 4871
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:931834114"
variation 4873
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1354513018"
variation 4874
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:986042224"
variation 4875
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778228474"
variation 4876
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1043090892"
variation 4877
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1240848902"
variation 4879
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369569796"
variation 4883
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1300660521"
variation 4884
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1442584873"
variation 4886
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:903021713"
variation 4887
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778230925"
variation 4893
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:911794474"
variation 4897
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778231615"
variation 4898..4899
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ca"
/db_xref="dbSNP:1778231958"
variation 4900
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778232313"
variation 4901
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:779864378"
variation 4904
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778233033"
variation 4905
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:549307532"
variation 4907
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778233795"
variation 4908..4912
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1453487908"
variation 4909
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1253383451"
variation 4914
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778234446"
variation 4919..4925
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tttttt"
/replace="ttttttt"
/replace="tttttttt"
/db_xref="dbSNP:367794680"
variation 4929
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1303470818"
variation 4931
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778235647"
variation 4932
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:897124330"
variation 4936
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152803747"
variation 4944..4953
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gaagga"
/replace="gaaggaagga"
/db_xref="dbSNP:1457190925"
variation 4946
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1176667359"
variation 4955
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1160944990"
variation 4956
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:930058011"
variation 4962
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1048434697"
variation 4963
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778238396"
variation 4964
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:888651151"
variation 4966
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1191844699"
variation 4967
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778239494"
variation 4975
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778239988"
variation 4986
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1035512868"
variation 4988
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1163472453"
variation 4989
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778241675"
variation 4990
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:960251812"
variation 4991
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778242421"
variation 4993
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778242730"
variation 5002
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1012814465"
variation 5009..5011
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="ata"
/db_xref="dbSNP:1484757986"
variation 5009
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1001690806"
variation 5012
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1462685756"
variation 5014
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:540258537"
variation 5019
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778244754"
variation 5020
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1347087225"
variation 5021
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778245114"
variation 5025
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1389751737"
variation 5029
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1277493766"
variation 5030
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778246882"
variation 5034
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1395636690"
variation 5035
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1034625505"
variation 5037
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308768870"
variation 5039
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:896089582"
variation 5041
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598604600"
variation 5043
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:145461597"
variation 5044
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:190111973"
variation 5046
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778251705"
variation 5047
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1380211855"
variation 5049
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:967033741"
variation 5050
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:560209401"
variation 5054
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1391972365"
variation 5056
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778254623"
variation 5070
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1360265115"
variation 5075
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778255447"
variation 5076
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1312090806"
variation 5083
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1420784311"
variation 5087
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598604753"
variation 5092
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:973151516"
variation 5098
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152804019"
variation 5101
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:978960234"
variation 5105
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598604834"
variation 5106
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172390973"
variation 5107..5111
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1778258305"
variation 5127..5130
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="aggt"
/db_xref="dbSNP:2152804042"
variation 5128
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152804047"
variation 5129
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1032756635"
variation 5134
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778258975"
variation 5135
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:919040438"
variation 5136
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598604905"
variation 5137
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1378329772"
variation 5139
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778260336"
variation 5140
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1192704429"
variation 5145
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:557813060"
variation 5148
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:3776367"
variation 5150
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:983384729"
variation 5155
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:182707701"
variation 5156
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:985906152"
variation 5164..5174
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="taaa"
/replace="taaacagtaaa"
/db_xref="dbSNP:1317029533"
variation 5165
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778263391"
variation 5168
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778263942"
variation 5169
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778264509"
variation 5175
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1485263619"
variation 5176
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1196550690"
variation 5177
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:911701139"
variation 5181
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1202162744"
variation 5182..5184
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1778267722"
variation 5182
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1345075939"
variation 5185
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1250302630"
variation 5188..5189
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ttaggtt"
/db_xref="dbSNP:1778268644"
variation 5191..5192
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ctgctt"
/db_xref="dbSNP:1778268966"
variation 5193
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1778269320"
variation 5205
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1252938449"
variation 5209
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778270070"
variation 5211
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598605153"
variation 5214
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598605166"
variation 5215
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1155433"
variation 5216
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:148835701"
variation 5217
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1280418571"
variation 5219
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:918585095"
variation 5220
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778272544"
variation 5221
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1562250861"
variation 5222
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778273211"
variation 5239
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778273539"
variation 5246
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1475927036"
variation 5250
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2152804272"
variation 5251..5254
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1188176271"
variation 5252
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1311570937"
variation 5254
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:929991004"
variation 5257
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152804289"
variation 5259
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778275299"
variation 5271
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778275653"
variation 5274
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1598605335"
variation 5275
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1048985394"
variation 5276
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1352081880"
variation 5277
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:3822398"
variation 5281
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778277784"
variation 5284
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:770987217"
variation 5286
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1055987590"
variation 5293..5294
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="c"
/db_xref="dbSNP:1778279360"
variation 5296
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778279719"
variation 5297
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1462934795"
variation 5298..5299
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="tattcgat"
/replace="tattcgatgatgatattcgat"
/db_xref="dbSNP:1255195974"
variation 5299
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778280962"
variation 5300
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1442961115"
variation 5307
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:562860490"
variation 5308
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:145014916"
variation 5309
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:147597506"
variation 5310
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1562251032"
variation 5314
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778284459"
variation 5315
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598605534"
variation 5316
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778285550"
variation 5317
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1458762578"
variation 5321
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778286120"
variation 5322
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778286664"
variation 5324
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:998929056"
variation 5325
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778287424"
variation 5326
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:369251054"
variation 5327..5333
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tgtt"
/replace="tgttgtt"
/db_xref="dbSNP:1778288214"
variation 5328
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1416732525"
variation 5335
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152804443"
variation 5342
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:142040376"
variation 5345
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778289831"
variation 5346
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:902884600"
variation 5349
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1341605821"
variation 5352
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778291169"
variation 5354
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1012845345"
variation 5362..5367
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gtgt"
/replace="gtgtgt"
/db_xref="dbSNP:1778292471"
variation 5362
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1389734594"
variation 5366
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778292837"
variation 5371
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1488399823"
variation 5372
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778293725"
variation 5374
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778294245"
variation 5376
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778294860"
variation 5377
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:547872137"
variation 5378
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778295960"
variation 5380
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778296858"
variation 5381
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1208278187"
variation 5384..5385
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="cca"
/db_xref="dbSNP:1778297891"
variation 5385..5387
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="agg"
/db_xref="dbSNP:1778298636"
variation 5385
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1332267538"
variation 5386
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1461153092"
variation 5387..5388
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ccacct"
/db_xref="dbSNP:1778300055"
variation 5387
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778299513"
variation 5392
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778300631"
variation 5394
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152804562"
variation 5396
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778301222"
variation 5397
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1415334819"
variation 5399
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1164800216"
variation 5404
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1473049522"
variation 5408
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:999848939"
variation 5409
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778303990"
variation 5410
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:560347711"
variation 5419
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:767872767"
variation 5421
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778305358"
variation 5426
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1033197387"
variation 5427
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2152804614"
variation 5429
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1216494166"
variation 5430
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:529117280"
variation 5433
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1297449098"
variation 5434
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1212636068"
variation 5435..5438
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1466875300"
variation 5435
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1307914073"
variation 5436
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1212007643"
variation 5439
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:549270699"
variation 5444
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778310101"
variation 5445
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1279471039"
variation 5446
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:77442646"
variation 5450
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1018740777"
variation 5455
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778311849"
variation 5456
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:965810799"
variation 5458
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778312541"
variation 5461
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025967465"
variation 5462
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:551669044"
variation 5465
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:760891307"
variation 5466
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:187353555"
variation 5469
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1348367400"
variation 5470
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1210999563"
variation 5471
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1325859335"
variation 5472..5473
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="a"
/db_xref="dbSNP:1778315613"
variation 5473
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:764556800"
variation 5474
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:919172886"
variation 5475
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:951484513"
variation 5480
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598606167"
variation 5482
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405726791"
variation 5487
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1384037367"
variation 5492
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778318345"
variation 5496
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1156714190"
variation 5505..5506
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1441502432"
variation 5505
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598606239"
variation 5506
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778320277"
variation 5508
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1380323773"
variation 5511
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11167797"
variation 5512
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:74859757"
variation 5515
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778322449"
variation 5518
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:3776366"
variation 5519
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1199195334"
variation 5522
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1055850081"
variation 5525
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778324514"
variation 5532
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778324997"
variation 5533..5536
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1452526109"
variation 5537
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778326221"
variation 5538
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200996861"
variation 5539
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:79208980"
variation 5540
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1175923578"
variation 5541
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11167798"
variation 5545
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778329548"
variation 5546
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778330168"
variation 5547
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598606445"
variation 5552
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:77317774"
variation 5553
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:979192511"
variation 5555
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:190822646"
variation 5563
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:749938878"
variation 5565..5566
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1778333719"
variation 5572
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="c"
/db_xref="dbSNP:1778334397"
variation 5574
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1437509112"
variation 5576
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778335554"
variation 5577
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778336029"
variation 5587
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:934753004"
variation 5592
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598606574"
variation 5595
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778337811"
variation 5598..5601
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:34797589"
variation 5598
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1296135546"
variation 5601
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778339456"
variation 5607
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1165475920"
variation 5608
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1428871358"
variation 5610
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778340650"
variation 5614
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:757955403"
variation 5620
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778341663"
variation 5621
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1173006084"
variation 5622
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778342514"
variation 5627
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1290902049"
variation 5633
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778343738"
variation 5635
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1778345160"
variation 5635
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1362353548"
variation 5636
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:576367931"
variation 5642
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1054140151"
variation 5646
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:148341755"
variation 5651
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778347465"
variation 5652
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1044242828"
variation 5653
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778348294"
variation 5656
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1007835545"
variation 5657
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778349057"
variation 5659..5664
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aaacaa"
/db_xref="dbSNP:1241835976"
variation 5661
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1191963947"
variation 5662
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1017348701"
variation 5664
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:994739081"
variation 5667
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778351543"
variation 5669
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1007265559"
variation 5682
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1026419484"
variation 5684
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1018647080"
variation 5685
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778353904"
variation 5688
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765789571"
variation 5691
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598606950"
variation 5692
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778354745"
variation 5693
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1598606965"
variation 5700
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487051710"
variation 5702
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778355868"
variation 5708
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778356286"
variation 5709
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1598607026"
variation 5714..5716
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="ata"
/db_xref="dbSNP:1217459155"
variation 5715
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152805165"
variation 5716
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1280866543"
variation 5727
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:886077765"
variation 5733
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:993326840"
variation 5735
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778358852"
variation 5736
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1275994845"
variation 5737
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1401613318"
variation 5739
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778359865"
variation 5740
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778360208"
variation 5741..5744
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1340955287"
variation 5741
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1486368719"
variation 5743
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598607154"
variation 5744..5748
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tgt"
/replace="tgtgt"
/db_xref="dbSNP:2152805230"
variation 5747
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1312171782"
variation 5751
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1026543796"
variation 5752
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:183825132"
variation 5754
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778362691"
variation 5763
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360348237"
variation 5764
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778363300"
variation 5765
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2152805268"
variation 5767
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:572412067"
variation 5768
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778363936"
variation 5772
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1018658428"
variation 5773
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:985078873"
variation 5774
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172450751"
variation 5775
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1455960378"
variation 5776
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778365446"
variation 5777
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778365761"
variation 5779
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778366085"
variation 5782
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1016947783"
variation 5786
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1174879685"
variation 5787..5788
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1424838376"
variation 5790
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1379740827"
variation 5791
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1399062185"
variation 5793
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778367617"
variation 5794
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:958691079"
variation 5795
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1346029886"
variation 5796
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1435412832"
variation 5802
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778368964"
variation 5817
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778369312"
variation 5818
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778369623"
variation 5821
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256384774"
variation 5825
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:975588952"
variation 5832
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778371181"
variation 5833
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1028427956"
variation 5840
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778372121"
variation 5842
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778372473"
variation 5845
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:541132042"
variation 5853
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152805430"
variation 5854
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778373117"
variation 5857
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:189184400"
variation 5858
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:979006610"
variation 5864
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778374293"
variation 5869
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:781024913"
variation 5870
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:924612206"
variation 5874
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778375304"
variation 5875
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1397567897"
variation 5878
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:917323306"
variation 5880
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778376205"
variation 5889
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:749493611"
variation 5890
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1465846593"
variation 5893
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:950290896"
variation 5895
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778377657"
variation 5896..5897
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ct"
/db_xref="dbSNP:1347869382"
variation 5897
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1164538484"
variation 5899
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778378833"
variation 5900
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1224989058"
variation 5903
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1299491655"
variation 5914
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778380161"
variation 5916
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1183010478"
variation 5923
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778380830"
variation 5926
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:114341532"
variation 5928
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:542878122"
variation 5929
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778381906"
variation 5933
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778382219"
variation 5936
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:924746272"
variation 5940..5947
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="caaagagc"
/db_xref="dbSNP:1236472316"
variation 5942
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:936276542"
variation 5947
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598607793"
variation 5949
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:7724648"
variation 5950..5954
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ctctc"
/replace="ctctctc"
/db_xref="dbSNP:1554194174"
variation 5953
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:563520551"
variation 5954..5960
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="cccccc"
/replace="ccccccc"
/replace="cccccccc"
/db_xref="dbSNP:766387179"
variation 5954..5955
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="t"
/db_xref="dbSNP:1044274479"
variation 5954
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:745886497"
variation 5955
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:943031993"
variation 5956
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778386636"
variation 5957
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778386971"
variation 5958
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140612062"
variation 5959
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:6864372"
variation 5960
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:993624549"
variation 5961
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="t"
/db_xref="dbSNP:1018559106"
variation 5961
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778388978"
variation 5961
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1778389258"
variation 5962
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150470697"
variation 5971
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:995856486"
variation 5972
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778390630"
variation 5973
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778391355"
variation 5978
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2152805729"
variation 5980
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1378500046"
variation 5981
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1026154088"
variation 5985
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1266929661"
variation 5986
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314140754"
variation 5988
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:887566858"
variation 5991
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778393891"
variation 5995
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:764538309"
variation 6004
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:866164978"
variation 6006
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:371974304"
variation 6008
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1033586744"
variation 6009
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778396695"
variation 6013
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1000857352"
variation 6015
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:958721759"
variation 6016
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1351440060"
variation 6018
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778398040"
variation 6019
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1287460147"
variation 6020
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1404973430"
variation 6021
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1562252428"
variation 6031
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1240234565"
variation 6033
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1031961164"
variation 6037
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1369682318"
variation 6042
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778400429"
variation 6044
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778400929"
variation 6056
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1598608350"
variation 6060
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778401571"
variation 6061
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778401929"
variation 6062
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152805885"
variation 6066
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:956481056"
variation 6071..6072
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1778402652"
variation 6073
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778403009"
variation 6076
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778403351"
variation 6077
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778403683"
variation 6080
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778404007"
variation 6081
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598608377"
variation 6083
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778404762"
variation 6085
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1298709622"
variation 6086
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:571117902"
variation 6096..6099
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1562252475"
variation 6099
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:991467253"
variation 6105
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1388191458"
variation 6108
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1024290977"
variation 6110
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2152805960"
variation 6117
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:138326683"
variation 6118
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778407555"
variation 6119
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:917236820"
variation 6121
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1399870118"
variation 6124..6125
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1778408884"
variation 6124
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1359183798"
variation 6129
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:547065191"
variation 6130
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:13186673"
variation 6135..6136
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1174171257"
variation 6137
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:936164844"
variation 6146
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778410619"
variation 6148
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778410959"
variation 6152
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1333921328"
variation 6153
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598608665"
variation 6161
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1192675280"
variation 6162
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778412358"
variation 6165
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2152806062"
variation 6170..6193
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="atcatcgtc"
/replace="atcatcgtcagcatcatcatcgtc"
/db_xref="dbSNP:1487223413"
variation 6170
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1265227418"
variation 6173
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:990396495"
variation 6174
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:536436504"
variation 6175
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:556384130"
variation 6176
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:943599956"
variation 6178
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:907822513"
variation 6179
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778415754"
variation 6180
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1302333279"
variation 6182
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1778416448"
variation 6185
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:142808538"
variation 6187
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778417191"
variation 6189
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:901471563"
variation 6190
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:168668"
variation 6191
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:757785631"
variation 6192
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371430141"
variation 6193
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778419147"
variation 6194
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1043415871"
variation 6196
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1257908643"
variation 6197
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1301185209"
variation 6203
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:903596125"
variation 6206
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778420965"
variation 6207
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1598609014"
variation 6208
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1170305504"
variation 6209
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778421997"
variation 6210
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1476703385"
variation 6212
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000403303"
variation 6215
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778423145"
variation 6216
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1441792021"
variation 6217
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:533922066"
variation 6218
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778424206"
variation 6219
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006452319"
variation 6221
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:956340147"
variation 6222
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778425409"
variation 6225
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1472533094"
variation 6232
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1257005093"
variation 6235
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1216455601"
variation 6236
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778427459"
variation 6241
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1014897345"
variation 6242
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778428159"
variation 6244
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:532529686"
variation 6249
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1228725008"
variation 6252
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1340406409"
variation 6257
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1311295417"
variation 6262
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146056187"
variation 6272
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:370165201"
variation 6273
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:553706511"
variation 6274
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:192223461"
variation 6279
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778431645"
variation 6282
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1171140319"
variation 6283
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:541443657"
variation 6284
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1472386936"
variation 6285..6286
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gt"
/replace="gtagt"
/db_xref="dbSNP:920719055"
variation 6285
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:138892627"
variation 6287
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1394153151"
variation 6291
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:575028141"
variation 6292
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:367668639"
variation 6299
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1423860394"
variation 6302
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778435332"
variation 6310
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1411574816"
variation 6314
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:754962142"
variation 6321
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1196313247"
variation 6323
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778436730"
variation 6328
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1458827036"
variation 6331
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778437413"
variation 6336
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1598609576"
variation 6338
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1024322011"
variation 6339
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:971765823"
variation 6343
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:79745224"
variation 6345
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1778439162"
variation 6356
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1356163229"
variation 6382
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1264179296"
variation 6387
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1046742690"
variation 6388
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1398985581"
variation 6390
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778468082"
variation 6392
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:907236401"
variation 6394
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1315834315"
variation 6395
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1778469155"
variation 6401
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1014522680"
variation 6406
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1218810211"
variation 6408
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1562253625"
variation 6409
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1343148743"
variation 6415
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778470996"
variation 6419
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:529692032"
variation 6420
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:547472528"
variation 6422
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001571596"
variation 6424
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778472934"
variation 6427
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1401800363"
variation 6430
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778473658"
variation 6431
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778474053"
variation 6435
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778474440"
variation 6439
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:957699339"
variation 6441
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011581910"
variation 6442
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:186695109"
variation 6443
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778475814"
variation 6445
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1426824845"
CDS 6446..7825
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/codon_start=1
/product="rho GTPase-activating protein 26 isoform X31"
/protein_id="XP_047272948.1"
/db_xref="GeneID:23092"
/db_xref="HGNC:HGNC:17073"
/db_xref="MIM:605370"
/translation="
MTEINSLASEEQVYNSNKDSQSEGTAQLDSIGFSIIRKCIHAVETRGINEQGLYRIVGVNSRVQKLLSVLMDPKTASETETDICAEWEIKTITSALKTYLRMLPGPLMMYQFQRSFIKAAKLENQESRVSEIHSLVHRLPEKNRQMLQLLMNHLANVANNHKQNLMTVANLGVVFGPTLLRPQEETVAAIMDIKFQNIVIEILIENHEKIFNTVPDMPLTNAQLHLSRKKSSDSKPPSCSERPLTLFHTVQSTEKQEQRNSIINSSLESVSSNPNSILNSSSSLQPNMNSSDPDLAVVKPTRPNSLPPNPSPTSPLSPSWPMFSAPSSPMPTSSTSSDSSPVRSVAGFVWFSVAAVVLSLARSSLHAVFSLLVNFVPCHPNLHLLFDRPEEAVHEDSSTPFRKAKALYACKAEHDSELSFTAGTVFDNAECPSASTAIFTATPKLRAPPPLTWALPLAA"
misc_feature 6476..7063
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/note="GTPase-activator protein (GAP) domain for Rho-like
GTPases found in GRAF (GTPase regulator associated with
focal adhesion kinase); Graf is a multi-domain protein,
containing SH3 and PH domains, that binds focal adhesion
kinase and influences cytoskeletal...; Region:
RhoGAP_Graf; cd04374"
/db_xref="CDD:239839"
misc_feature order(6608..6610,6734..6736,6746..6748,6953..6955,
6962..6967,7034..7036)
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/note="putative GTPase interaction site [polypeptide
binding]; other site"
/db_xref="CDD:239839"
misc_feature 6608..6610
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/note="catalytic residue [active]"
/db_xref="CDD:239839"
misc_feature 7649..>7744
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/note="Src Homology 3 domain superfamily; Region: SH3;
cl17036"
/db_xref="CDD:450141"
variation 6446
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1176779716"
variation 6449
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:537466318"
variation 6450
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1778596022"
variation 6455
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1182972102"
variation 6459
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1235440113"
variation 6460
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:935170221"
variation 6462
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778597251"
variation 6477
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1778597651"
variation 6479
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1778598026"
variation 6480
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="a"
/db_xref="dbSNP:1778598362"
variation 6482
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:899625740"
variation 6485
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:754297763"
variation 6489
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1779253810"
variation 6490
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1779254259"
variation 6492
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1420238516"
variation 6493
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1779255284"
variation 6496
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1779255917"
variation 6497..6499
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aaa"
/db_xref="dbSNP:778608938"
variation 6498
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1168784930"
variation 6502
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1779257143"
variation 6503
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1779257626"
variation 6504
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:762408939"
variation 6507
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1168567672"
variation 6508
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397058939"
variation 6513
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1453806080"
variation 6516
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:895573530"
variation 6522
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:765772526"
variation 6523
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:149675399"
variation 6525
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1262549487"
variation 6526
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1782795007"
variation 6529
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1477893586"
variation 6532
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:762894741"
variation 6533
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:766463008"
variation 6534
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:541692751"
variation 6536
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1295821921"
variation 6537
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051090107"
variation 6538
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1782797323"
variation 6540
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:755187078"
variation 6548
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1782797987"
variation 6553
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1310776075"
variation 6555
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1782798717"
variation 6556
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1345964420"
variation 6558
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:767784597"
variation 6565
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1209807834"
variation 6566
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:753572567"
variation 6568
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:776612798"
variation 6570
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329181722"
variation 6572
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1782801153"
variation 6579
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1232286999"
variation 6583
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1782801847"
variation 6585
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1783513163"
variation 6586
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:577183455"
variation 6591
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1240493049"
variation 6592
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:138560463"
variation 6593
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:368631485"
variation 6596
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1178621900"
variation 6598..6603
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="agggct"
/db_xref="dbSNP:1282933488"
variation 6598
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:559768157"
variation 6601
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426033747"
variation 6602
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1189025548"
variation 6605
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="t"
/db_xref="dbSNP:1783516762"
variation 6609
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1783517074"
variation 6612
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:765056827"
variation 6618
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1783517719"
variation 6619
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2270068"
variation 6619
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gtgggg"
/replace="t"
/db_xref="dbSNP:587778047"
variation 6620
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1783518955"
variation 6624
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:121918546"
variation 6625
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150150976"
variation 6637
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:779872777"
variation 6640
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1463887875"
variation 6643
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:746456704"
variation 6646
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1397647154"
variation 6647
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:2150151081"
variation 6649
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1310736296"
variation 6652
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1783522418"
variation 6662
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1785506656"
variation 6665
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141277545"
variation 6667
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2150256589"
variation 6676
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:780820934"
variation 6678
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1785507954"
variation 6689
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:752325217"
variation 6690
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:146954969"
variation 6692
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1420162742"
variation 6694
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1300134398"
variation 6695
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:937866652"
variation 6703
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1785509880"
variation 6705
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1358689575"
variation 6712
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:777301452"
variation 6719
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1294317975"
variation 6722
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:749596248"
variation 6731
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1785511565"
variation 6741
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1355753802"
variation 6742
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1785512217"
variation 6743
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:771226861"
variation 6745
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:779343904"
variation 6747
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:865996352"
variation 6749..6760
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="atgcttccagga"
/db_xref="dbSNP:2150274292"
variation 6750
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1272389933"
variation 6751
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1471761284"
variation 6755
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1785759318"
variation 6756
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:749523295"
variation 6760
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:147578261"
variation 6766
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:939614862"
variation 6767
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1180221937"
variation 6768
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231135797"
variation 6772
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:768641152"
variation 6775
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1785762014"
variation 6779
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1182531755"
variation 6784
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:776825752"
variation 6787
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1785763216"
variation 6790
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1157646062"
variation 6791
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390955442"
variation 6795
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:748291505"
variation 6798
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:967615552"
variation 6802
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:770211741"
variation 6803
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:202108989"
variation 6804
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1562340713"
variation 6809
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1360439426"
variation 6814
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1470770615"
variation 6822
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:773569740"
variation 6827
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:943099101"
variation 6828..6830
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1786025187"
variation 6836
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1177663859"
variation 6843
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:745615384"
variation 6844
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:370113595"
variation 6845
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1786027618"
variation 6851
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:775404572"
variation 6853..6854
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="tagctgtgacactgataagatatta"
/db_xref="dbSNP:1786028360"
variation 6854
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1418071301"
variation 6857
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1786029147"
variation 6858
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:760497830"
variation 6862
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1786029989"
variation 6864
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338465482"
variation 6865
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1598834708"
variation 6871
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1786031141"
variation 6874
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1598834725"
variation 6876
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:764158418"
variation 6880
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:775989661"
variation 6881
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1786034298"
variation 6884
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1786034645"
variation 6887
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:761318223"
variation 6888
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1210262739"
variation 6889
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1786036058"
variation 6890
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1263929134"
variation 6896
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200233602"
variation 6902
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1786037435"
variation 6905
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:750098628"
variation 6920
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1796063109"
variation 6925
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1319294045"
variation 6927
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:761258345"
variation 6928
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1306099224"
variation 6930
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1796064260"
variation 6931
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1033031186"
variation 6932
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1796064819"
variation 6933
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:142172254"
variation 6934
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1484503256"
variation 6937
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1212411605"
variation 6938
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:753910315"
variation 6945
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1485178041"
variation 6946
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:35015063"
variation 6949
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1421450503"
variation 6954
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1599107730"
variation 6957
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1426538345"
variation 6962
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:778955495"
variation 6964
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:750638067"
variation 6978
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:200735964"
variation 6980
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1436447934"
variation 6992
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:758588683"
variation 6998
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1374924807"
variation 7003
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:944882821"
variation 7012
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1286975030"
variation 7016
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1796071680"
variation 7019
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:781036613"
variation 7020
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1562463808"
variation 7024
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:148277580"
variation 7031
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1796073461"
variation 7037
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:755992247"
variation 7043
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141872257"
variation 7051
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1796074391"
variation 7054
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:748759273"
variation 7061
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:930412391"
variation 7062
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:770495318"
variation 7066
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:112919594"
variation 7067
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:374932134"
variation 7071
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1346490355"
variation 7074
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1405875819"
variation 7077
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1797642115"
variation 7081
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:778477834"
variation 7084
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:367794102"
variation 7085
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:771697394"
variation 7090
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1007597016"
variation 7091
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:775284912"
variation 7092
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1797644001"
variation 7095
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1797644269"
variation 7097
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1332646086"
variation 7098
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1797644941"
variation 7100
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:190103100"
variation 7101
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1444971373"
variation 7102
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1797645928"
variation 7104
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:965736142"
variation 7105
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:769121957"
variation 7107
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:527459078"
variation 7108
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:762378594"
variation 7109
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:138201954"
variation 7110
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1336441992"
variation 7118
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1234378582"
variation 7119
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773289106"
variation 7123
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1280102386"
variation 7127
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:762950382"
variation 7128
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:751805271"
variation 7134
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:755239975"
variation 7136
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1231299447"
variation 7137
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:763842100"
variation 7141
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1188698233"
variation 7146
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:369464916"
variation 7149
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:587778048"
variation 7151
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:753638895"
variation 7155
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:757204903"
variation 7156
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:749880605"
variation 7157
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:758011894"
variation 7159
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:142719570"
variation 7160
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:563141037"
variation 7162
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:757288826"
variation 7165
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:778542742"
variation 7166
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:781680770"
variation 7174
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1312884552"
variation 7177
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:748477815"
variation 7179
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:770272847"
variation 7180
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773625546"
variation 7187
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1185101939"
variation 7190
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:770972810"
variation 7191
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1797658829"
variation 7192
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774451783"
variation 7193
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:182686164"
variation 7196
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1599164668"
variation 7197
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150899215"
variation 7198
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150899229"
variation 7202
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:767782413"
variation 7203
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200573018"
variation 7204
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:761517423"
variation 7205
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1797660972"
variation 7211
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1484850928"
variation 7213
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:761619141"
variation 7219
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1171415162"
variation 7220
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1385232335"
variation 7223
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1402068557"
variation 7225
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:972664912"
variation 7229
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:764910895"
variation 7236
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1799280294"
variation 7239
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1799280646"
variation 7242
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:750299791"
variation 7245
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1799281439"
variation 7247
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:762972613"
variation 7253
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766434176"
variation 7255
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:751050015"
variation 7257
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1799283274"
variation 7261
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1799283694"
variation 7262
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:754569626"
variation 7264
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:767153955"
variation 7265..7266
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="t"
/replace="tcggt"
/db_xref="dbSNP:1158863667"
variation 7265
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1799285094"
variation 7267
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203612755"
variation 7269
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1284059655"
variation 7275
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1469205859"
variation 7278
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:2150982041"
variation 7279
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1215898678"
variation 7282
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:752272942"
variation 7292
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025539992"
variation 7293
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197611926"
variation 7298
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:755826959"
variation 7299
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="aa"
/db_xref="dbSNP:757651552"
variation 7299
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1336267009"
variation 7301
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:777992228"
variation 7302
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:749708150"
variation 7305
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:757700614"
variation 7306
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1387397659"
variation 7307
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:779395323"
variation 7308
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:772066864"
variation 7310
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1409512182"
variation 7311
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1392219494"
variation 7313
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1799291144"
variation 7316
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:775686952"
variation 7319
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1799291709"
variation 7321
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:61749638"
variation 7323
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:768981723"
variation 7325
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1236907613"
variation 7327
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1562506903"
variation 7328
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1279218265"
variation 7330
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1302105335"
variation 7333
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1562506956"
variation 7336
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:756327010"
variation 7343
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1799294121"
variation 7344
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:142158613"
variation 7349
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:35543343"
variation 7350
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:189592386"
variation 7353
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1468477869"
variation 7356
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1262925193"
variation 7357
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150982428"
variation 7363..7368
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ccccc"
/replace="cccccc"
/db_xref="dbSNP:1298538973"
variation 7363
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:758774663"
variation 7364
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:866743500"
variation 7366
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:780617450"
variation 7367
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1808698400"
variation 7368
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1262319806"
variation 7369
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:751554467"
variation 7373
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:755110899"
variation 7374
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1200713108"
variation 7377
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1808700584"
variation 7379
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1020629047"
variation 7380
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1808701446"
variation 7382
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:781473038"
variation 7385
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1808702484"
variation 7387
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1599517671"
variation 7388
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1808703349"
variation 7391
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:748353535"
variation 7392
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1358374857"
variation 7395
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:770211962"
variation 7396
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:201177393"
variation 7399
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1808705771"
variation 7400
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:778834142"
variation 7407
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161529765"
variation 7408
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343609688"
variation 7409
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1457075635"
variation 7410
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:745684629"
variation 7412
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1808708347"
variation 7416
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:771835850"
variation 7417
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:577329290"
variation 7419
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:148592957"
variation 7420
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:79503222"
variation 7428
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1223806659"
variation 7429
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1321002382"
variation 7430
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1599517971"
variation 7433
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:776158322"
variation 7436..7438
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:34190521"
variation 7438
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1808712765"
variation 7439
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1413899732"
variation 7442
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1165831956"
variation 7443
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:761442291"
variation 7449
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:373829603"
variation 7450
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:142973666"
variation 7454
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:750689105"
variation 7455
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1219245612"
variation 7456
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:151153991"
variation 7457
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:919252044"
variation 7458
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:200244300"
variation 7459
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:139465573"
variation 7462
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:755481989"
variation 7463
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:912641769"
variation 7464
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1808719558"
variation 7468
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:781421564"
variation 7469
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:144980456"
variation 7476
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1215760366"
variation 7481
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1808721629"
variation 7482..7488
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="cagggtt"
/db_xref="dbSNP:754483039"
variation 7484
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:778143214"
variation 7485
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1355582413"
variation 7486
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2151354297"
variation 7488
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:147594828"
variation 7494
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:771922181"
variation 7502
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1808724124"
variation 7505
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1348305569"
variation 7510
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:573461169"
variation 7511..7516
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="gtt"
/replace="gttgtt"
/db_xref="dbSNP:1808726086"
variation 7511
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:138930924"
variation 7514
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="g"
/db_xref="dbSNP:1808726545"
variation 7519
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:776062506"
variation 7520
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:747661745"
variation 7521
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1272654528"
variation 7522
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1808728377"
variation 7524
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:769398528"
variation 7527
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1044591557"
variation 7528
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:772940874"
variation 7529
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:762565787"
variation 7530
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766737289"
variation 7531
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1808731432"
variation 7532
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:774650330"
variation 7542
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:562055157"
variation 7544..7545
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="ta"
/db_xref="dbSNP:1808732830"
variation 7545..7546
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="cgcttcttctggcctgtcaaaaagca"
/db_xref="dbSNP:1808733276"
variation 7547
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1808733705"
variation 7553
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1359248362"
variation 7556
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:184478142"
variation 7561
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:752754507"
variation 7562
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:367738404"
variation 7566
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:764360414"
variation 7567
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1412121055"
variation 7574..7580
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="cc"
/replace="ccctgcc"
/db_xref="dbSNP:1562611577"
variation 7574
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:754066085"
variation 7577
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1599518976"
variation 7580
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:891524472"
variation 7585
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1258173654"
variation 7588
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1428761863"
variation 7589
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1808739134"
variation 7593
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:779894814"
variation 7594
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371525720"
variation 7607
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1021385645"
variation 7610
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1445551668"
variation 7613
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:754844573"
variation 7614
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1269661891"
variation 7619
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:781141034"
variation 7620
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:199750999"
variation 7621
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:769273950"
variation 7623
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1808744737"
variation 7625
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1341570957"
variation 7626
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1211638930"
variation 7627
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:111255704"
variation 7628
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1808746420"
variation 7633
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1808746780"
variation 7635
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1282743966"
variation 7636
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1216422892"
variation 7637
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:369671615"
variation 7638
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1440850373"
variation 7640
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1247959500"
variation 7642
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1809927558"
variation 7643
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:751316229"
variation 7644
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:754791440"
variation 7645
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:781016419"
variation 7649
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:748049685"
variation 7650
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:749105278"
variation 7651
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1408211161"
variation 7654
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1809930509"
variation 7656
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1809930881"
variation 7657..7660
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aa"
/replace="aaaa"
/db_xref="dbSNP:1458620897"
variation 7659
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:567856399"
variation 7660
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1387888762"
variation 7661..7662
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="tt"
/db_xref="dbSNP:1441541073"
variation 7662
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1809932860"
variation 7664
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1809933252"
variation 7665
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328055146"
variation 7666
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1329395179"
variation 7670
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1599551117"
variation 7672
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1232562520"
variation 7675
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1809935135"
variation 7683
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1809935530"
variation 7685
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="c"
/db_xref="dbSNP:1809935909"
variation 7687
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1280395053"
variation 7688
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1809936681"
variation 7689
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1353037884"
variation 7691
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1164230771"
variation 7693
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:770691224"
variation 7694
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2151395700"
variation 7698
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:2151395728"
variation 7701
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:182566788"
variation 7702
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:76863574"
variation 7703
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1809939516"
variation 7705
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1216070993"
variation 7706
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:778457148"
variation 7707
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1421749362"
variation 7709
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1449405597"
variation 7713
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150150241"
variation 7716
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:201921386"
variation 7717
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197465355"
variation 7723
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:746182844"
variation 7724
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:587778049"
variation 7729
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:258819"
variation 7731
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1372457165"
variation 7735
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:923613614"
variation 7736
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1296239078"
variation 7739
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1427843722"
variation 7740
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:765419769"
variation 7745
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810329168"
variation 7746
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1005437678"
variation 7749
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200828890"
variation 7751
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1398168483"
variation 7755
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810330663"
variation 7757
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1810331006"
variation 7760
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1311009247"
variation 7761
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1340469548"
variation 7764
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810332087"
variation 7773
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1228753424"
variation 7774
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:756737380"
variation 7778
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:778613255"
variation 7779
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:532041418"
variation 7781
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:73796994"
variation 7782..7784
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1810334982"
variation 7782
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1485763342"
variation 7783
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1202028352"
variation 7786
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:370551709"
variation 7790
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810336155"
variation 7791
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1810336544"
variation 7792
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1810336881"
variation 7793
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253817385"
variation 7797
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1423218434"
variation 7798
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1357304073"
variation 7800
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1193832189"
variation 7803
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1810338635"
variation 7805
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1391895488"
variation 7807
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810339338"
variation 7813
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:771916442"
variation 7814
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1167974317"
variation 7817
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1376355117"
variation 7819
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:879599945"
variation 7820
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:774962641"
variation 7824
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1292512779"
variation 7825
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1599560247"
variation 7832
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1401915868"
variation 7834
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1422228160"
variation 7839
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:752934240"
variation 7842
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1300488656"
variation 7843
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1363564009"
variation 7844
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1225568186"
variation 7845
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810344778"
variation 7849
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1296212857"
variation 7850
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2151417057"
variation 7852
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1312483275"
variation 7855
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1363701576"
variation 7857
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:935684900"
variation 7859..7863
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="cccc"
/replace="ccccc"
/replace="ccccccc"
/db_xref="dbSNP:1253830500"
variation 7859
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:145952236"
variation 7860
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1005097220"
variation 7862
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1205430500"
variation 7863..7866
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1810348314"
variation 7865
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1249830270"
variation 7868
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1489920564"
variation 7869
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1463478378"
variation 7872
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1810349776"
variation 7875
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:772366595"
variation 7878
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:557164481"
variation 7879
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:963573588"
variation 7884
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:527710170"
variation 7886
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1240922160"
variation 7887
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1319499948"
variation 7888
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:916766896"
variation 7893
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810352752"
variation 7896
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:185141055"
variation 7897
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810353431"
variation 7898
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:760283585"
variation 7899
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:148611502"
variation 7900
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:536347113"
variation 7903
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:555544432"
variation 7906
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:775060340"
variation 7908
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1418504777"
variation 7915..7917
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:34715200"
variation 7917
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810356347"
variation 7925
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810356753"
variation 7929
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:568922101"
variation 7930
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1599560731"
variation 7931
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1046546321"
variation 7932
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:35995107"
variation 7938
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1250175923"
variation 7940
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:938095114"
variation 7943
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:142129688"
variation 7945..7952
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ttac"
/replace="ttacttac"
/db_xref="dbSNP:1199115109"
variation 7946
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1413378581"
variation 7947
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1810359791"
variation 7948
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:888428994"
variation 7950
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:151165641"
variation 7957..7959
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:11300501"
variation 7961
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:540270516"
variation 7962
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1428796957"
variation 7963
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039920049"
variation 7965
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2151417712"
variation 7966
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:901026940"
variation 7970
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1810362648"
variation 7971
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1810362946"
variation 7974
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:258821"
variation 7977
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1351303888"
variation 7983
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1442326469"
variation 7987
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1221439501"
variation 7988
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:761430737"
variation 7992
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:258822"
variation 7993
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:757771730"
variation 7994
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1398866188"
variation 7999
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:542317314"
variation 8005
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810366285"
variation 8006
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:750440189"
variation 8008
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810366960"
variation 8009
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1315303390"
variation 8011
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:985205699"
variation 8014..8015
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="gc"
/db_xref="dbSNP:1360620994"
variation 8015
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1033179407"
variation 8016
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431724280"
variation 8019
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:957027063"
variation 8023
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:531392765"
variation 8026
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1240497435"
variation 8027
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1273129524"
variation 8029
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:190382803"
variation 8030
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1447559337"
variation 8041
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2151418082"
variation 8047
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1016506025"
variation 8048
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:963938796"
variation 8056
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1237022907"
variation 8057
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:966914460"
variation 8059
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1599561389"
variation 8063
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810375113"
variation 8066
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1213701111"
variation 8067
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1012511767"
variation 8069
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1023774315"
variation 8071
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:970886616"
variation 8074
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:545562921"
variation 8078
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:981854066"
variation 8082
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1562630529"
variation 8083
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810378108"
variation 8084
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1030789230"
variation 8086
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140559694"
variation 8093..8103
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="ct"
/replace="ctaacaattct"
/db_xref="dbSNP:1448669432"
variation 8099
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1409647567"
variation 8100
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810379860"
variation 8104
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1417608010"
variation 8106..8107
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace=""
/replace="aa"
/db_xref="dbSNP:1169742181"
variation 8107
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810381006"
variation 8110
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1055174182"
variation 8112
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1810381700"
variation 8113
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1384536324"
variation 8116
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2151418371"
variation 8117
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1810382392"
variation 8120
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810382734"
variation 8121
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1181744130"
variation 8125
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:766207317"
variation 8127
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810383764"
variation 8128
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810384128"
variation 8129
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:941486664"
variation 8130
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1421352411"
variation 8131
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:527970897"
variation 8134
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:942583615"
variation 8136
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810386038"
variation 8145
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:975365560"
variation 8146
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810386653"
variation 8153
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:922401136"
variation 8158
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:751429925"
variation 8159
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150028606"
variation 8165
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810387998"
variation 8168
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1810388304"
variation 8172
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:886556714"
variation 8177
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:940685473"
variation 8183
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2151418614"
variation 8188
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810389824"
variation 8190
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1312262095"
variation 8195
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:748803811"
variation 8197
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:889589293"
variation 8200
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385575304"
variation 8201
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2151418700"
variation 8202
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1285205269"
variation 8206
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1441869272"
variation 8210
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:754585928"
variation 8213
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1454053818"
variation 8216
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1353006375"
variation 8218
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1007143815"
variation 8220
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1410613647"
variation 8221
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1038076296"
variation 8222
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810394901"
variation 8223
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1336996987"
variation 8230
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363945467"
variation 8234
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1810395996"
variation 8236
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1810396418"
variation 8240
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1434862893"
variation 8241
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:560904988"
variation 8247
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1464493036"
variation 8250
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810397365"
variation 8251
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1468350784"
variation 8253
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:957346441"
variation 8256
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2151419030"
variation 8260
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810398352"
variation 8263..8268
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="cc"
/replace="ccagcc"
/db_xref="dbSNP:1810398955"
variation 8263
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:530224456"
variation 8276
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1023931415"
variation 8283
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1490082897"
variation 8285
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1289007944"
variation 8287
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810400144"
variation 8288
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810400466"
variation 8289
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1224040255"
variation 8291
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1278460587"
variation 8293
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1019893762"
variation 8296
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:971051053"
variation 8299
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:906691537"
variation 8303
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810402422"
variation 8307
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810402739"
variation 8308
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1810403061"
variation 8312
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1652519633"
variation 8320
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:982306216"
variation 8322
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147746184"
variation 8329..8332
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="cacc"
/db_xref="dbSNP:1810405019"
variation 8329
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:928220251"
variation 8330
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810405511"
variation 8333
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1410716649"
variation 8337
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:181802116"
variation 8338
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:528422542"
variation 8339
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1599562364"
variation 8340
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1264027676"
variation 8343
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1810408608"
variation 8346
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1464647948"
variation 8352
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810409612"
variation 8355
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:991387261"
variation 8356
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1158213544"
variation 8357
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810411292"
variation 8362
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810411787"
variation 8366
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:910088481"
variation 8373..8376
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1409973947"
variation 8374
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1810413296"
variation 8376
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1030738485"
variation 8377
/gene="ARHGAP26"
/gene_synonym="GRAF; GRAF1; OPHN1L; OPHN1L1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1479933364"
ORIGIN
agtgttaataatcccagaacagttagcctgtgcctaattcaccagaaccaaaaacaagttaaaataaatggcctactccttcactggttattggggtgtgacctaccacctacatgctccaggaggagctgtttcaccttttctcttgaaactatatcagcttaatttgaaatttctcacagagaactgcggtaagtgccagtgacactcaaaatgtgaaagcattgccataaggataatttgctcatcaaggtcatcatgacctgcctctgacctgcagagaaagacccagacgaaggaatgcgcatccttaagccccttgtcctttaatgaggaataatttcttggacactgaatatatgcaaacatttagatgccgcatagatcacttcccctaaaccctgccccatagaaatgtaaaattaaccttgattggagattggaaatgataagaatgaaaaattttatttggaagtattaaattctgtagaatatagactgtaggagcagtaagagatcaaagaaacgagagattaaggttgtctgcagccatcaagtaagttaggaaatatttgtggagtaaggaaaagggaaataacgtttttgagcacctccagtccctgtgataactattttaaattctgttaatactctcataagtattattacttagctctactttgcaatgagaaagcagactcggaaatgttgaatgattatctaagggcgcatagttcaaaagtggtagaaccaggtgacaaaataaaaacttcatccagattaaatttaaaggagtttaattgagctatgaacaatttgcgaattgggcagcccccagaatcaccacacattcagagagactccagggatgcctcgtggtcagaacaaatttatagacaaaaaaaaaaaaaaaaaaaaaggaaagtgacgtacggaaatcagaagtaaggtacaaaaacaactggattggttacagcttggtgtttgccttatttgaacatagtttgaacactcatcagtgtataagtggttgaggtatggctgctgggattggccaagactcagctgttgttataggtaaattttcctaagttaggttttcaaccttgtctacctattaagttaggttacagttagtccacaaggactcagatataggagcatggagtccttctcaggccatatttagtttgctttaacacagaccttaatgccaagtttccaaagccacagcatgctccatccaccacttgactcaacttcatccaaatccatttctccctgttttggaatctgtccagggcctataccagtgaaagggttaggctgacaatgattaaaccccaaatgcagcgaaattaatcagcccaggaatgcccgggatgccttctagacagaagggggcttaggtctgtgtgtaagaggatgctgggtcagcctcctgctttagtggaccatgaagagctcctgtcagtcatttatgttcggctgaaatctgccttcctggggactccaccctgaccttcatctctgttcagcacaataagatttcccctttgtcacatcactgccctttgagaatctgaagactggtattgtgatgttttgaagccttctcttctccaaccaacactgtggtttagggaaacacatcttgcagagcaagtgagcagagccagagggtggagccaacaagaaccaggatatagccaatgtcaaggtctaggtgagaaggcaaaaacaatctgaccttgggcaatagaagaagaagtggggatgaggaataggttcaagacatatgaaagtaatagaagtgatacaactaggaactgattggatatgtgaggtagaaggaatgggaaattcaaggatgacagcacagtttctcgttcaactttgttgcacatttttctccttcactctagagttccctataaagcacaagtaggcttttctgtcatgcacttaaaaaaaaaattaccacaacccttgtctgtgagcaacagaaacacaactaaaaaataaaaagtatgttattgatatactatagaaagagcagggatgagcttctgatatgttaagataaaagggctcaaatgataccatcagaatcccatgtcccttcattcatggccctgcatttctttgtttgaccttttctgctcaaggctttgcctgtgtggtagccgaagttggcctcaaaagcttcaggtatgcatcctgttttcctagcaacacaaggcctcatttcccatagttgtaataaaaaatgagtgagtgtcatcggctgagtttggcttgggccaatcatatgtgcagtaggatgcatagtctggatcacatgcaacaaacctgaagatggagttgggatcagccccacccaaaccatatgaacttgccttggcagggaggtggctccccaaggaaaatgagggtggtatccctggaaaaagaggtgcatggatgttgaacagtagtattcacgggtgtccagagcacttttttcccccaatgttactgaggaataatactaagagataagttgcttatatccacaaggtacaaagcaacaggcaatgcttgaactaatggaaaagaaagtttatttttctattcatcatcattgttgtaatcatgttttgaacagcaagcagcagtttttattcaccagcaagaacgcttccggggctgttaaaagactctgtcttttggatggctgtaggagcacagccatttggtcactttttattgggccattttctaagagactgcctagtcttgagatgcctctgattgtgtaggggaagggactcggcaccaacaggtacagaacccctttcttagcccttatttcagaactccccagtggtaccataggcttcaaaactattagaagcattcgttgtcacctggtggatgtagagctaacacacaggggtggaacatagaaaataaatggctatgtgagggattttgatagccttgagttaagccaaataagataaatctgtatcctgttttctcttaggaaggcctgaattgtctgtttccactcccttgtaagaaagattcatagagaatttgccaggtgttggggagaacaaagcggtcacctggacacctgagcacacatctagctttccttttctgtctggccaatgcattgtcctcaccaactccacctttagtgttttttcttttttttttttttttttttttaattgcagtttctctcttatgctctctatttatccaatcagtactttctgagtggctggctatgtgctagttactgaaccccctttatgtataattctacagggtaagagcaaggtcttgacattggttcaggaatcggtctttgggaagtgccatcaactatatttttattggtttcacatttgagggagcctccctaagacagcaagtacaacagtggtagcagtggaaagggaaagcctggcagagtattgtcagctgagaaacagaaaagtagcaacagccatcttatttttgctccactgagcacatttcaccactcagaccatggtgatgagagtcacatttctgatgggaggaggaggaagaaccaatagctggctccctggctctgaccccttgagttgagacacatccttatttactccaggctattcatgcttcagattcaaacaattccttcccaaaagcttttccaagtgtggcctgtggcccatgggtgaaaagagaagtcctgatctagaaaaatcatgtccattcatgggtggcattccacagactaagggtgtcttacagtaacttctcaggggtgttattaaaagttcctaagcctgggcacagtggctcatgcctgtaatcctagcactttgggaggccgaggcgggtggattgcctgagctcaggagttcggtgaaaccccatctctactaaaatacaaaaaattagccaggtgtggcctgtagtcccagctgctcaggagacaggtgaatcgcttgaacccaggaggcagaagttgcagtgagccgagatcgcaccactgcactccagcctggttgacagcaagactctgtctccgaaaaaaaaaaaaaaaaaaaaaagttcctaaatttagcctgtattagtgtttgccgagcattctaatgtgttcaactgagaaatctgccacagagtctttggcaaccctggccagttctctctgtatgtgctgataggttttaggagggttgttttttgggcatcctaaaatgtctcaagctggttgtggtttttaattactgccacacttgtattaattggaagtttgtagaattcctgttatgcttaaattgggtggaaattttgttattacataatggttgcattgttgccattttaattactgcttagcctcttttgagttctttgttaattggcaggctgtttttcctctggaaagcaggactgggtggagaagttgtatgaagttgtggctgagtacagactctactgtgctctgcctaaatcgaatcctggctctgtaatttgctagtatgtaacctttggaaagttaattaacccatatgatgctatgaaatagaggcaggtgtagtaccccataggcttgaggatgaaataaaatcattcgtttaaacgcttagtatggtgtttggcacataattgatagtgaaaaagtggttggtggcaggtggctatttttatgtttgattgctgttttaaaaaagattaagaaccattgatttaaacgttgaccttagattgtctcctttcctttcccttcatctcttaattagtttcagttggttatattacattgccaacaagaccaatgccacagggtccctcaaatgacatttcccatccttagccatttatcccataggggatacatttccatcaccagaagaggctttttgttttgtttttttaaacacaaagtgggaagagaaggaaggaggaaaatgacagtgatgaagatgaaagttaatccttatagaatgttcaataggccatagaatttacattcagtgctgtgttgaatattgtatatctatgattccatttaattattacaacaatcctaagtggtggagagtgttactatccccctttttcagatggcaagactgaggtctagggatgataactgatgtgcatgttagccaataaacagtaaagttggactttgaacctaagcagtagattactacaaatctgtcgccactgacagacacaattcaaaagagcaagctgttttgattctagtgatggtggacccactttgtcatgcagaggagatgagatgatattcgatggtgtagaaccagcctgttgttttaagatgttgacacattgccttattcagtgtgtctccacattggtacatcaggggaacagccaggtgggaggagacttggagaaaacctcaggggatcatagagtttggatgtgcatttgggtaaagatggtgcagtttagagaggagcatcagttttaaacaaatttccttatgaacctatttccccagcatctttattttgtccagattttgatccaaagtgtggtatggctaagctctaatgcagctgtgtgtgaaagggaaaagttagattgttttgtcaaatttttgctttacttatgtctttaatatctacatttgaaaaacaagcctctctgttttctcagtatggcttggataatggtaataaaggtactcatagaaaaattctgggaatccagatgactctgtgtattctctgttaattctgtagggacatgtaaactgaactggctcagcagtgaacagaatttattgcaaaatcacatcttggtgcagaggaagcatatgaaggctttcctcgccctcctttgatttattaaattgtactttcattgcagcttctgggtaaggactcagaattgcagtgccctgtgatttgtatcaaagagctactctccccccctggtgtttatcgtcaggatcgaaccctgtggttcagagagaatatgaagtgttacttctatactagatgccagctggttgcatgggttggtggtaaatactccaggctagaatcagaaggctgttcccagtttcattttctttctgactcagggcaagttcttccttccggtgattcacctgcccagctgcccacaacatctcacctttatcatcgtcagcatcatcatcgtcgtcattgtcatcatcgtcatcacaatgacttattgatcatgtggttagtggttaagtgcttgggctctggagacagaccgtgggagttcctgtctggactctgcccatttccagctgtctgaccttggccatgtgacctaacttctctaatgcctcagttttctcatctctgtgaaaggaataattaggctgaagcatatacttgaaaatagatacttgttggcacggatctttaacaaatcttcatatacaatgacagagattaacagcctggcctcagaggagcaggtctacaactcgaacaaagacagccagagtgaagggactgcgcagttggacagcattggcttcagcataatcaggaaatgcatccatgctgtggaaaccagagggatcaacgagcaagggctgtatcgaattgtgggtgtcaactccagagtgcagaagttgctgagtgtcctgatggaccccaagactgcttctgagacagaaacagatatctgtgctgaatgggagataaagaccatcactagtgctctgaagacctacctaagaatgcttccaggaccactcatgatgtaccagtttcaaagaagtttcatcaaagcagcaaaactggagaaccaggagtctcgggtctctgaaatccacagccttgttcatcggctcccagagaaaaatcggcagatgttacagctgctcatgaaccacttggcaaatgttgctaacaaccacaagcagaatttgatgacggtggcaaaccttggtgtggtgtttggacccactctgctgaggcctcaggaagaaacagtagcagccatcatggacatcaaatttcagaacattgtcattgagatcctaatagaaaaccacgaaaagatatttaacaccgtgcccgatatgcctctcaccaatgcccagctgcacctgtctcggaagaagagcagtgactccaagcccccgtcctgcagcgagaggcccctgacgctcttccacaccgttcagtcaacagagaaacaggaacaaaggaacagcatcatcaactccagtttggaatctgtctcatcaaatccaaacagcatccttaattccagcagcagcttacagcccaacatgaactccagtgacccagacctggctgtggtcaaacccacccggcccaactcactccccccgaatccaagcccaacttcacccctctcgccatcttggcccatgttctcggcgccatccagccctatgcccacctcatccacgtccagcgactcatcccccgtcaggtctgttgcagggtttgtttggttttctgttgctgccgttgttctctcattggctcggtcctctcttcatgcagtgttcagcctcctcgtcaactttgttccctgccatccaaacctgcacttgctttttgacaggccagaagaagcggtacatgaagactccagcacaccgttccggaaggcaaaagccttgtatgcctgcaaagctgaacatgactcagaactttcgttcacagcaggcacggtcttcgataacgcagagtgtccttcagcttccacagccatcttcactgccacaccgaagctccgggcacctccacctctcacctgggcacttccactggccgcctgacacatcttctcacatctgctcttgctgccataaccccctctttacagagcagcgagagtgatctttgaaaaacggaaatggcattaaagcccttcagtggcctcccattgctctgagaattacttacaaggccctccagggcccagttcctgcccctctgacctcacgccctcacttgacatactacagcctcatgccttcttcatgttctcaagcaaggtcggcaaactatgacctgcccgtcaaatccaacctgccacctgtcacctaacaattctgtaactgctcccacatacaacatggtcgtcatcataaatcctataggtattgttgagagcaggaggaaagtttggttgagtgagtgagagaccttacccaagccttcctgtggtctctaggagtcatggcagagttcgctgacactggtctgcttttaaccagccttgccagtgacctttcaaattccctgaggagcaaaaggccaaattgaacctgaaagaaaacacctctcagtgttgactgagttgcagtagaaaatggacctgacaaaac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]