ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-29 06:53:51, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_011541236 13721 bp mRNA linear PRI 05-OCT-2023 DEFINITION PREDICTED: Homo sapiens argonaute RISC component 1 (AGO1), transcript variant X1, mRNA. ACCESSION XM_011541236 VERSION XM_011541236.3 DBLINK BioProject: PRJNA168 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_000001.11) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Apr 5, 2022 this sequence version replaced XM_011541236.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_000001405.40-RS_2023_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; RefSeqFE; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/02/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..13721 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" gene 1..13721 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /note="argonaute RISC component 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 mRNAs, 32 ESTs, 2449 long SRA reads, 5 Proteins, and 92% coverage of the annotated genomic feature by RNAseq alignments, including 67 samples with support for all annotated introns" /db_xref="GeneID:26523" /db_xref="HGNC:HGNC:3262" /db_xref="MIM:606228" variation 6 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:978051547" variation 9 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645056876" variation 13 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1175381189" variation 14 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1287948787" variation 18 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1488473859" variation 19 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1220406709" variation 20..45 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="ctcgcagtgggagctgctgcaggctc" /db_xref="dbSNP:1244564144" variation 20 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1645057149" variation 21 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1489178234" variation 22 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:745709197" variation 23 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1645057343" variation 24 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1571337067" variation 25 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="t" /db_xref="dbSNP:1379140477" variation 27 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1442648369" variation 28 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1645057533" variation 32 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1160937987" variation 33 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:955272510" variation 35 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1166868030" variation 37 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1571337095" variation 38 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1321841535" variation 39 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:536512687" variation 40 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /db_xref="dbSNP:1571337106" variation 44 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:960542884" variation 45 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:988496009" variation 46..49 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="cgcg" /replace="cgcgcg" /db_xref="dbSNP:1330829239" variation 46 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:796799611" variation 47..57 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="gcggcggc" /replace="gcggcggcggc" /replace="gcggcggcggcggc" /db_xref="dbSNP:879546980" variation 47 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1296078355" variation 48 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645058154" variation 49..81 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="ggcggcggc" /replace="ggcggcggcaacggaggctgcgggggcggcggc" /db_xref="dbSNP:1645058301" variation 49 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1227464220" variation 51 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:763454879" variation 52 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1323203976" variation 54 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:968367755" variation 55 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1237075493" variation 56..57 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="gc" /replace="gctgc" /db_xref="dbSNP:1645058523" variation 57 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:978548875" variation 58 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1181076845" variation 59 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1239255916" variation 62 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1645058668" variation 65 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:867649714" variation 68..80 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="gcgg" /replace="gcgggggcggcgg" /db_xref="dbSNP:921662839" variation 69 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645058877" variation 70 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:931863745" variation 72..95 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="gggc" /replace="gggcggcggcgcgagcggccgggc" /db_xref="dbSNP:1645059013" variation 75 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1379985904" variation 78 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:941176687" variation 79 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1398233997" variation 81 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645059243" variation 83 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645059390" variation 85 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1645059442" variation 86 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1467201069" variation 87 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1333289576" variation 90 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645059570" variation 91 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1645059619" variation 98 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1645059665" variation 99 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1336348406" variation 101 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /db_xref="dbSNP:1038631951" variation 104 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1645059778" variation 105 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:918304981" variation 106 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1645059864" variation 109 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645059915" variation 112 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1645059958" variation 113 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645060009" variation 115 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1381028483" variation 116 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1256973986" variation 120 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:929736854" variation 121 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1645060253" variation 126 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /db_xref="dbSNP:1045368943" variation 127 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:547802847" variation 128 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645060435" variation 129 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:906900125" variation 132 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /db_xref="dbSNP:1003735845" variation 135 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:569338309" variation 136..140 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="gag" /replace="gagag" /db_xref="dbSNP:1645060711" variation 137 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1645060739" variation 138 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:537033546" variation 142 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1239615580" variation 143 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:2148706022" variation 144 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1571337241" variation 145 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1571337258" variation 147 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:1645060959" variation 148 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1055353380" variation 150 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645061351" variation 151 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645061389" variation 155 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:895405324" variation 156 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1011034611" variation 159 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1193238281" variation 162 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1645061557" variation 163 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:376952387" variation 164 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1478922696" variation 165 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /db_xref="dbSNP:558415281" variation 170 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1479948110" variation 171 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1331202747" variation 173..176 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="ca" /replace="caca" /db_xref="dbSNP:754610928" variation 174 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /db_xref="dbSNP:748181964" variation 176 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="aa" /db_xref="dbSNP:767091091" variation 178 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1167301864" variation 179 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1332063452" variation 181 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:374168686" variation 182 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1415108216" variation 183 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1645062143" variation 184 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:1426651719" variation 187 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1277181222" variation 188 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1022891969" variation 189 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1571337349" variation 191 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="t" /db_xref="dbSNP:570480872" variation 193 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="c" /db_xref="dbSNP:1365195293" variation 194..198 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="" /replace="cctcc" /db_xref="dbSNP:1645062511" variation 194 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:377185293" variation 195 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:369200771" variation 198 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:369830249" variation 199..200 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="" /replace="ta" /db_xref="dbSNP:1645062720" variation 199 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1227307292" variation 200 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:774749949" variation 202 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645062813" variation 203 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:746274013" variation 204 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:999650573" variation 205 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1312478731" variation 206 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="g" /replace="t" /db_xref="dbSNP:1571337398" variation 207 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="a" /replace="g" /db_xref="dbSNP:771695172" variation 210 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="c" /replace="t" /db_xref="dbSNP:1645063088" variation 211..213 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /replace="gg" /replace="ggg" /db_xref="dbSNP:1378065562" CDS 214..2796 /gene="AGO1" /gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99" /codon_start=1 /product="protein argonaute-1 isoform X1" /protein_id="XP_011539538.1" /db_xref="GeneID:26523" /db_xref="HGNC:HGNC:3262" /db_xref="MIM:606228" /translation="
MEAGPSGAAAGAYLPPLQQVFQAPRRPGIGTVGKPIKLLANYFEVDIPKIDVYHYEVDIKPDKCPRRVNREVVEYMVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRVSRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
misc_feature 313..705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="N-terminal domain of argonaute; Region: ArgoN;
pfam16486"
/db_xref="CDD:435368"
misc_feature 733..885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="Argonaute linker 1 domain; Region: ArgoL1;
pfam08699"
/db_xref="CDD:430160"
misc_feature 886..1248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
misc_feature order(1042..1044,1087..1089,1129..1131,1141..1143,
1195..1197,1216..1218,1222..1224)
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239212"
misc_feature 1381..2667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="PIWI domain, Argonaute-like subfamily. Argonaute is
the central component of the RNA-induced silencing complex
(RISC) and related complexes. The PIWI domain is the
C-terminal portion of Argonaute and consists of two
subdomains, one of which provides the...; Region:
Piwi_ago-like; cd04657"
/db_xref="CDD:240015"
misc_feature order(1801..1803,1813..1815,1849..1860,1867..1869,
1891..1893,1900..1902,1912..1914,1924..1926)
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:240015"
misc_feature order(2005..2007,2011..2013,2221..2223,2635..2637)
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/note="active site"
/db_xref="CDD:240015"
variation 220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1291952738"
variation 221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:775125489"
variation 227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1219859778"
variation 228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645063342"
variation 229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:763615615"
variation 230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1228530087"
variation 231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:776166589"
variation 233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:761778204"
variation 234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571337459"
variation 235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645063687"
variation 237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:765152517"
variation 239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:534382148"
variation 241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:12746607"
variation 242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:146814747"
variation 243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:972036410"
variation 245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:144077445"
variation 246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:140869088"
variation 247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170596078"
variation 248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645155622"
variation 255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1340212230"
variation 256..262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccccccc"
/replace="cccccccc"
/db_xref="dbSNP:752471592"
variation 258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645155750"
variation 259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206703390"
variation 260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:760951179"
variation 261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:202083240"
variation 262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557603507"
variation 263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148708759"
variation 264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:138410930"
variation 266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757285327"
variation 269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1022788713"
variation 270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1240989789"
variation 271
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1446100175"
variation 272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571342863"
variation 273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:79428335"
variation 274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:75289061"
variation 275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645156392"
variation 276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:76388453"
variation 279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645156505"
variation 281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645156570"
variation 284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645156617"
variation 286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:779432389"
variation 287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1258716583"
variation 288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1163754955"
variation 289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645156991"
variation 290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1389168609"
variation 297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424891938"
variation 298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750911996"
variation 300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:968257736"
variation 305
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758952997"
variation 307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1355653345"
variation 308
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1262459523"
variation 309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:574337653"
variation 313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645157658"
variation 315
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1179019303"
variation 316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1335156626"
variation 319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:747438396"
variation 321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1385353517"
variation 325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645157898"
variation 327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1418697160"
variation 334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1179971147"
variation 335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:926553379"
variation 339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:768283757"
variation 347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1297216732"
variation 349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:199891800"
variation 354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1337673800"
variation 356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:868103064"
variation 361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:146957455"
variation 363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:200988923"
variation 364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773153331"
variation 366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762965113"
variation 378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:143228790"
variation 388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1286109881"
variation 390
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645158647"
variation 394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1347111293"
variation 395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1448364494"
variation 396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:74665168"
variation 397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:764307761"
variation 398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1042059854"
variation 400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645159128"
variation 401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645159199"
variation 408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1321314626"
variation 412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:200676269"
variation 413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645159446"
variation 416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1251930499"
variation 417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:564776109"
variation 419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1194249910"
variation 420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:375999904"
variation 426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:755840915"
variation 429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1039211966"
variation 438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645239978"
variation 439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777119725"
variation 446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1355230423"
variation 447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645240094"
variation 448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748876689"
variation 450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294130512"
variation 460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645240210"
variation 462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:770982492"
variation 475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774432228"
variation 476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:745615692"
variation 486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645240476"
variation 500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148710841"
variation 507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487074387"
variation 513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187568812"
variation 518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:368596181"
variation 520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1373509253"
variation 521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:998200306"
variation 522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:771782526"
variation 525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:775400690"
variation 529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645243206"
variation 537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:761909595"
variation 538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:371043471"
variation 542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:773265965"
variation 546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1037229267"
variation 547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:766471361"
variation 548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:867858441"
variation 549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645251826"
variation 555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1479111626"
variation 556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645251932"
variation 559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645251969"
variation 561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:774463509"
variation 562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645252076"
variation 564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1306694761"
variation 568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557606462"
variation 583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1327559774"
variation 591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759929800"
variation 600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645252397"
variation 601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557606472"
variation 606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:768140024"
variation 613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645252575"
variation 616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:974811600"
variation 629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:748561732"
variation 632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:756518480"
variation 633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:763796047"
variation 642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645252872"
variation 643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645252917"
variation 645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140048484"
variation 646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1406926679"
variation 648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:778531571"
variation 651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:750019410"
variation 654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:551846586"
variation 655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:780052272"
variation 660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1295434292"
variation 661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1044509129"
variation 663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645253450"
variation 664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:746713624"
variation 667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1356391187"
variation 670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645253604"
variation 671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:768528277"
variation 672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:777924524"
variation 673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1348951466"
variation 674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1225740432"
variation 678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:146336392"
variation 682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1398998653"
variation 684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:771183369"
variation 685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645254066"
variation 686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774413049"
variation 688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1275859576"
variation 689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1275269608"
variation 693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645254286"
variation 697
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645254328"
variation 699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000221753"
variation 703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759723959"
variation 706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1298655751"
variation 707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645254551"
variation 708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1204721590"
variation 711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1250637242"
variation 712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481913947"
variation 715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:200107860"
variation 720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772403603"
variation 730
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757928895"
variation 733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148711333"
variation 735
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339623786"
variation 741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:935986859"
variation 742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:369913779"
variation 747..754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cttct"
/replace="cttcttct"
/db_xref="dbSNP:1553154062"
variation 749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1450839608"
variation 750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557606960"
variation 756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1216160432"
variation 758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1196584082"
variation 759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:923359271"
variation 764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1243777480"
variation 765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1054485245"
variation 776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571348661"
variation 777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:751539508"
variation 779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1553154069"
variation 780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:754921891"
variation 782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645264815"
variation 786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645264900"
variation 789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571348686"
variation 794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1388452609"
variation 795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645265183"
variation 796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148711374"
variation 797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:780934730"
variation 800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:745945344"
variation 804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148711380"
variation 808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148711383"
variation 816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390406046"
variation 821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645265474"
variation 827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1385468503"
variation 835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557607042"
variation 857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1415969084"
variation 858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320779237"
variation 861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645265786"
variation 867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:11806527"
variation 870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:11811275"
variation 880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:751072190"
variation 881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1281040808"
variation 882
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645271909"
variation 888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299243666"
variation 893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:754906190"
variation 894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2296470"
variation 899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645272259"
variation 904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571349090"
variation 907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1266180488"
variation 908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:372933409"
variation 911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1204384593"
variation 913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1255631567"
variation 915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:201138355"
variation 918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1184303864"
variation 925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645272758"
variation 927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1364687783"
variation 932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778966083"
variation 933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645272959"
variation 937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:17855789"
variation 939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758584590"
variation 942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1362228512"
variation 946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645273227"
variation 948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1010672520"
variation 952
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1422475379"
variation 954
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645273440"
variation 955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1018151324"
variation 957
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645273614"
variation 959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470621142"
variation 960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:780175783"
variation 961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1400919651"
variation 965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645273887"
variation 971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645273962"
variation 972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:747113992"
variation 973
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645274152"
variation 978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:769226315"
variation 987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1350821626"
variation 998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:770562881"
variation 999..1000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:34232554"
variation 1000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645278321"
variation 1005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645278406"
variation 1010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:773882882"
variation 1014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1191695845"
variation 1017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1428675136"
variation 1020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1166366490"
variation 1028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645278705"
variation 1031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759010563"
variation 1044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:372555392"
variation 1045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645278907"
variation 1047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759416843"
variation 1048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:533050841"
variation 1050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1292791760"
variation 1052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148711775"
variation 1054..1055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:2148711782"
variation 1054
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1162477236"
variation 1056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:760596663"
variation 1059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:551240186"
variation 1060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571349540"
variation 1062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:570547124"
variation 1063
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645279527"
variation 1066
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645279588"
variation 1068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571349563"
variation 1069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571349566"
variation 1071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1364584684"
variation 1072
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:761517181"
variation 1075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645279945"
variation 1085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294234936"
variation 1086..1141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="att"
/replace="attccccttacagctggagagtggacagactgtggagtgcacagtggc
acagtatt"
/db_xref="dbSNP:1557608209"
variation 1086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753991581"
variation 1089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645296230"
variation 1091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1295256848"
variation 1092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:189586551"
variation 1103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051022486"
variation 1107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1238748148"
variation 1115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1472903106"
variation 1116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:372979737"
variation 1120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148712287"
variation 1124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645296616"
variation 1126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1306020581"
variation 1131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645296748"
variation 1136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645296815"
variation 1146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1050283350"
variation 1155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546553880"
variation 1156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1420666776"
variation 1161
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645297028"
variation 1166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:757631001"
variation 1176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:909137877"
variation 1177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411142617"
variation 1182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645297285"
variation 1188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756155452"
variation 1189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338758069"
variation 1200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645297454"
variation 1204
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759454083"
variation 1212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1359860901"
variation 1221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1447524690"
variation 1224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:778306053"
variation 1227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:149082767"
variation 1228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:151208943"
variation 1236
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1275974433"
variation 1240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148715329"
variation 1242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:775889960"
variation 1243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:200563862"
variation 1244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557612017"
variation 1249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1415960544"
variation 1255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:764062753"
variation 1257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1050570393"
variation 1258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:908985871"
variation 1259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148715349"
variation 1263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645416045"
variation 1268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1343816827"
variation 1269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753994302"
variation 1277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278173586"
variation 1278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:757689155"
variation 1283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645416400"
variation 1284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645416455"
variation 1292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645416507"
variation 1293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:199616208"
variation 1296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1200825557"
variation 1320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758791735"
variation 1324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148715372"
variation 1329
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779631833"
variation 1332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645416806"
variation 1334..1341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aggag"
/replace="aggaggag"
/db_xref="dbSNP:2148715376"
variation 1336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:762638025"
variation 1338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:746619529"
variation 1340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1430592479"
variation 1344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1168233985"
variation 1346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1369030058"
variation 1348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:754699172"
variation 1350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1274129921"
variation 1351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:780563736"
variation 1359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750947963"
variation 1360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1404044449"
variation 1361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148715571"
variation 1364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148715573"
variation 1367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1320886676"
variation 1370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645424335"
variation 1371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645424415"
variation 1373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148715578"
variation 1374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645424467"
variation 1381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645424528"
variation 1382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758951181"
variation 1386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:72661614"
variation 1389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1296302699"
variation 1392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:752028013"
variation 1395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002104589"
variation 1398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:868287969"
variation 1401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:754573452"
variation 1404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328358090"
variation 1407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542457159"
variation 1412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1284524734"
variation 1415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:780911842"
variation 1416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425246"
variation 1417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1226472292"
variation 1420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557612417"
variation 1421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425404"
variation 1423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645425456"
variation 1424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425501"
variation 1425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:747545727"
variation 1430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148715621"
variation 1432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:755717690"
variation 1433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645425695"
variation 1438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1208181934"
variation 1443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645425811"
variation 1447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571357990"
variation 1448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:376308772"
variation 1449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:377394072"
variation 1451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:544024909"
variation 1452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:142094247"
variation 1456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1472015606"
variation 1458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161925549"
variation 1467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:745684571"
variation 1470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:61751003"
variation 1471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:893311782"
variation 1473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645426498"
variation 1474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:935068063"
variation 1475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645426594"
variation 1478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571358046"
variation 1480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571358047"
variation 1483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1382173701"
variation 1485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397379451"
variation 1488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645430270"
variation 1489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779760591"
variation 1490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1258906885"
variation 1491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645430440"
variation 1494
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748337975"
variation 1495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1428424991"
variation 1502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1015543488"
variation 1506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:199936275"
variation 1512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773266381"
variation 1518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:763034859"
variation 1519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1432427531"
variation 1524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:771277669"
variation 1525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170126627"
variation 1526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645431243"
variation 1528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148715842"
variation 1530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148715846"
variation 1531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645431327"
variation 1532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1370865156"
variation 1533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774954734"
variation 1536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645431506"
variation 1539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759771963"
variation 1542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369633288"
variation 1546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645431703"
variation 1547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1387317470"
variation 1551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571358401"
variation 1553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313546401"
variation 1557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1300648006"
variation 1562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:371917876"
variation 1564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1368914800"
variation 1566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557612737"
variation 1573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753155364"
variation 1575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:760403306"
variation 1580
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645432313"
variation 1581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:375102195"
variation 1584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645432435"
variation 1585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1262161642"
variation 1586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:753328428"
variation 1593
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:919044941"
variation 1604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203451050"
variation 1615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:569514136"
variation 1617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1023867293"
variation 1623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1199479145"
variation 1629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645532937"
variation 1632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645533022"
variation 1635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:945694295"
variation 1639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:775988217"
variation 1640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:761121371"
variation 1641
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645533275"
variation 1646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:12739932"
variation 1656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763795877"
variation 1658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148718885"
variation 1659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1184426040"
variation 1666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415613590"
variation 1669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1557615824"
variation 1680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:776441734"
variation 1683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769789947"
variation 1684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1163885953"
variation 1698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1040031325"
variation 1701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:12735795"
variation 1703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:12735796"
variation 1704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:368806171"
variation 1708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1167063899"
variation 1714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645534232"
variation 1716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1458793259"
variation 1717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:998417309"
variation 1722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1340285630"
variation 1725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148718923"
variation 1726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1421049999"
variation 1727
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645534556"
variation 1729
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:201120683"
variation 1730
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645534737"
variation 1731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1466906554"
variation 1732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006126627"
variation 1733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1321275499"
variation 1734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:764770945"
variation 1737
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:749967453"
variation 1740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:758341990"
variation 1742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1341527708"
variation 1747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380272290"
variation 1748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:143395835"
variation 1749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:751289476"
variation 1751
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:200447801"
variation 1752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:754799646"
variation 1753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645535695"
variation 1755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1050019769"
variation 1761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:371346774"
variation 1765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268149326"
variation 1772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645536021"
variation 1776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1401160206"
variation 1785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645536136"
variation 1794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:749491572"
variation 1797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757463904"
variation 1815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645685994"
variation 1816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385910631"
variation 1817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:758585726"
variation 1819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645686189"
variation 1821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:780324190"
variation 1830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645686375"
variation 1833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723061"
variation 1836
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:747499045"
variation 1847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:769346828"
variation 1848
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:199790587"
variation 1857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225197236"
variation 1861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1301736040"
variation 1862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1265127399"
variation 1863..1864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ct"
/db_xref="dbSNP:1645686932"
variation 1864..1865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gggaacacaataatgac"
/db_xref="dbSNP:1645687001"
variation 1869
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:141975081"
variation 1870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:769429758"
variation 1871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645687220"
variation 1873
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1300821067"
variation 1874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571373923"
variation 1875
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:888769037"
variation 1881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645687499"
variation 1884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645687560"
variation 1885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645687616"
variation 1892..1895
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1645687661"
variation 1894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343928483"
variation 1899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723097"
variation 1903
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645687783"
variation 1908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1205604565"
variation 1920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:139495925"
variation 1927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645688251"
variation 1932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1038775292"
variation 1936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1432507106"
variation 1945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762483320"
variation 1950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778368573"
variation 1953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1223700131"
variation 1956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1247322617"
variation 1963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645688704"
variation 1965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1164256024"
variation 1971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:770625415"
variation 1972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:528425591"
variation 1974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645692834"
variation 1980
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:771935455"
variation 1995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:775325449"
variation 1996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645693020"
variation 2004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557621093"
variation 2007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:547329659"
variation 2008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645693235"
variation 2013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:753726639"
variation 2014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645693386"
variation 2016..2021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccccc"
/replace="ccccccc"
/db_xref="dbSNP:35257283"
variation 2016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1324407912"
variation 2018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557621129"
variation 2019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:150639776"
variation 2020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1284611497"
variation 2022
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149707892"
variation 2024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723245"
variation 2025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:751632923"
variation 2034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1270050276"
variation 2037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:568739814"
variation 2042..2046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="cttct"
/db_xref="dbSNP:551219785"
variation 2045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1353927503"
variation 2046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645694220"
variation 2047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:201807040"
variation 2049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1460339268"
variation 2052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:748183477"
variation 2053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:756692838"
variation 2058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397084516"
variation 2060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:981999787"
variation 2067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390797463"
variation 2069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:756572252"
variation 2072
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:754140760"
variation 2073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:757637094"
variation 2074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:779294804"
variation 2075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:745501471"
variation 2078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:72661618"
variation 2080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645715386"
variation 2083
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645715448"
variation 2084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645715524"
variation 2087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645715568"
variation 2091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1455593427"
variation 2098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:779428711"
variation 2104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:746534916"
variation 2105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571375783"
variation 2108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571375789"
variation 2112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1348772102"
variation 2114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645715985"
variation 2115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:776733250"
variation 2116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1177037855"
variation 2118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148723911"
variation 2119
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:747913193"
variation 2121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1251138878"
variation 2128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:548570122"
variation 2130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769680596"
variation 2143..2165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tcctacatggtgcgtgagctcct"
/replace="tcctacatggtgcgtgagctcctacatggtgcgtgagctcct"
/db_xref="dbSNP:1553156567"
variation 2145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:148568098"
variation 2149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:759663700"
variation 2153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:767845424"
variation 2155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645716713"
variation 2156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452226490"
variation 2160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645716848"
variation 2161
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1170223877"
variation 2163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:775362502"
variation 2166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1461384946"
variation 2169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1296384917"
variation 2172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:575591328"
variation 2181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:764455703"
variation 2183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645717324"
variation 2184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:754370001"
variation 2188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723971"
variation 2189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1369025845"
variation 2200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762360695"
variation 2201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1296692574"
variation 2202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:147571046"
variation 2203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:750855900"
variation 2205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148723986"
variation 2206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757924485"
variation 2208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779770428"
variation 2209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1267744084"
variation 2211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1165442477"
variation 2212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:750985823"
variation 2218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1213741177"
variation 2219
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:754547764"
variation 2220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1466822711"
variation 2221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645718693"
variation 2226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1190144851"
variation 2227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1262080535"
variation 2229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:780890292"
variation 2231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:12564106"
variation 2237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:769908492"
variation 2244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645719049"
variation 2247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645719104"
variation 2252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tttttttt"
/db_xref="dbSNP:1414634162"
variation 2256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756047129"
variation 2258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:565958096"
variation 2259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645758202"
variation 2261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1224957910"
variation 2264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:896742034"
variation 2266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1307134258"
variation 2268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:748984548"
variation 2269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:143104504"
variation 2277
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645758583"
variation 2280
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1282114791"
variation 2286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:778610016"
variation 2289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645758802"
variation 2292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1209966112"
variation 2300..2303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:2148725180"
variation 2304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645758944"
variation 2310
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:7512720"
variation 2319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1020631361"
variation 2320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557623594"
variation 2328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:768936737"
variation 2332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:142277966"
variation 2334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:138262926"
variation 2335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645759563"
variation 2343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:770238895"
variation 2344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148725216"
variation 2345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:773801844"
variation 2349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763410885"
variation 2359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:766745148"
variation 2366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1311510365"
variation 2375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774636073"
variation 2383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557623659"
variation 2384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645760176"
variation 2385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759256057"
variation 2387
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1439738572"
variation 2393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:373512212"
variation 2403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759990630"
variation 2405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1160280075"
variation 2412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:767227187"
variation 2417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645772040"
variation 2419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1272181556"
variation 2421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1305762819"
variation 2422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645772202"
variation 2423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1015522007"
variation 2424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1394089472"
variation 2428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438949295"
variation 2429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328128014"
variation 2431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1371847135"
variation 2432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:775311574"
variation 2434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:962129831"
variation 2442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278891860"
variation 2443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645772715"
variation 2445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:760440138"
variation 2451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:763635186"
variation 2462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645772906"
variation 2464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1191993432"
variation 2466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:370393930"
variation 2469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:757155977"
variation 2474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148725560"
variation 2475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:765103292"
variation 2476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750172296"
variation 2478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1423532922"
variation 2490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:761255422"
variation 2507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557624574"
variation 2511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:765183489"
variation 2513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750331557"
variation 2523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1396473268"
variation 2526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762926752"
variation 2527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400980541"
variation 2529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1309729088"
variation 2531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1351503366"
variation 2533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:766150388"
variation 2534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:371456175"
variation 2535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1416482791"
variation 2541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293818805"
variation 2544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148725983"
variation 2547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756293606"
variation 2550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777869344"
variation 2556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:753905238"
variation 2559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1351616919"
variation 2564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148725999"
variation 2565
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:766341150"
variation 2568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1282516031"
variation 2569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571380407"
variation 2571
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:779087158"
variation 2573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645787177"
variation 2586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:746352418"
variation 2587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:144290045"
variation 2590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1316031798"
variation 2598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1009486066"
variation 2601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253810168"
variation 2611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148726029"
variation 2613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:780502108"
variation 2617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645787653"
variation 2628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:139104482"
variation 2635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1257568536"
variation 2636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1365053413"
variation 2637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:768309604"
variation 2640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645787971"
variation 2643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645788028"
variation 2646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:781573871"
variation 2650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1157651125"
variation 2651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557624739"
variation 2655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1425163970"
variation 2657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:867363147"
variation 2658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645788386"
variation 2665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:776181658"
variation 2667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1372029994"
variation 2673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1436350986"
variation 2679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571380526"
variation 2680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1318627286"
variation 2685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645788766"
variation 2688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571380871"
variation 2704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:200112017"
variation 2708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:747745215"
variation 2709
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537312381"
variation 2717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:772641687"
variation 2721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645794818"
variation 2726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1230155462"
variation 2727
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645794950"
variation 2738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1252403207"
variation 2739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1339352983"
variation 2745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:748808273"
variation 2751
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:367549238"
variation 2752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314564307"
variation 2755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:774302590"
variation 2758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759554925"
variation 2773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:371427797"
variation 2779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1009951542"
variation 2781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:778473881"
variation 2790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:764523718"
variation 2791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:775410850"
variation 2793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:761934070"
variation 2799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:765573016"
variation 2805
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:750483408"
variation 2806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645796023"
variation 2807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645796066"
variation 2810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:758585810"
variation 2814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766609131"
variation 2815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1325491422"
variation 2816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1365840620"
variation 2818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:751988702"
variation 2821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:755567551"
variation 2825
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1415466187"
variation 2829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645796465"
variation 2831
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1399336214"
variation 2837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645796571"
variation 2841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:376748083"
variation 2842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217374400"
variation 2844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343703234"
variation 2846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:748552081"
variation 2852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:965243292"
variation 2853
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:745575440"
variation 2855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438723139"
variation 2857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645796975"
variation 2858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:558595376"
variation 2866
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1369626433"
variation 2874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797129"
variation 2880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219639480"
variation 2883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645797215"
variation 2886
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797274"
variation 2891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381154"
variation 2892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797336"
variation 2896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381165"
variation 2900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645797421"
variation 2906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797468"
variation 2908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1321542247"
variation 2909..2925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aggatgccttgtttcct"
/replace="aggatgccttgtttcctaaggatgccttgtttcct"
/db_xref="dbSNP:1645797586"
variation 2910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283260848"
variation 2911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797684"
variation 2914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797727"
variation 2918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:953916295"
variation 2919
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645797820"
variation 2922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645797860"
variation 2923
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571381191"
variation 2924
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571381199"
variation 2926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645798304"
variation 2927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314872898"
variation 2929
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:983883552"
variation 2934
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:879239347"
variation 2935
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645798493"
variation 2937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:150023314"
variation 2939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381230"
variation 2940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:909582929"
variation 2941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1025410190"
variation 2946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759347470"
variation 2947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381248"
variation 2948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1211269541"
variation 2949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1485412027"
variation 2955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:972780830"
variation 2966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645799010"
variation 2967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1478628272"
variation 2972
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:372514513"
variation 2979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1406280799"
variation 2986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645799213"
variation 2987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645799270"
variation 2994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645799367"
variation 2994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1184496486"
variation 2996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1031125362"
variation 3004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1160196944"
variation 3007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645799508"
variation 3008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:958110614"
variation 3009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:949596040"
variation 3012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1263585743"
variation 3013..3016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:1645799907"
variation 3013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:989617377"
variation 3016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1351587097"
variation 3017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982388540"
variation 3018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645800054"
variation 3019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571381367"
variation 3020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381375"
variation 3022
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1278837312"
variation 3024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1348418143"
variation 3032
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:541172177"
variation 3042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571381393"
variation 3045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645800369"
variation 3047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:202115790"
variation 3049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1288662217"
variation 3051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645800533"
variation 3054
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645800586"
variation 3055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571381418"
variation 3056..3057
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:878964846"
variation 3062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:911352318"
variation 3067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426560286"
variation 3069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:181957464"
variation 3078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645800907"
variation 3080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645800952"
variation 3085..3091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="acaca"
/replace="acacaca"
/db_xref="dbSNP:977058838"
variation 3089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:922824952"
variation 3093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148726405"
variation 3095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360308850"
variation 3100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645801187"
variation 3101..3114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tgtgactcacagtg"
/db_xref="dbSNP:1645801236"
variation 3102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1183336786"
variation 3106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:938140807"
variation 3110
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:187653963"
variation 3111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571381510"
variation 3112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645801465"
variation 3115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1474331605"
variation 3117..3119
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:2148726435"
variation 3117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541984369"
variation 3121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:563307920"
variation 3128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1400788229"
variation 3131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:530845732"
variation 3133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645801740"
variation 3139
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:545735322"
variation 3140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1042351647"
variation 3143
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1411490768"
variation 3145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645801948"
variation 3149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645801989"
variation 3150
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:760505499"
variation 3155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343689135"
variation 3159
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1055654359"
variation 3160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645802314"
variation 3165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:901211923"
variation 3168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1225506641"
variation 3172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:894285520"
variation 3173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645802528"
variation 3176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1285541494"
variation 3177..3178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645802682"
variation 3177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645802635"
variation 3183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571381598"
variation 3186
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726466"
variation 3189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645802788"
variation 3191..3202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gat"
/replace="gatactttagat"
/db_xref="dbSNP:1645802823"
variation 3198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1644547952"
variation 3200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645802872"
variation 3203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645802921"
variation 3206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:564987081"
variation 3208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:949852940"
variation 3220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1213406425"
variation 3221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1273180555"
variation 3223..3225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1645803165"
variation 3228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1045673538"
variation 3229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1206364733"
variation 3230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645803305"
variation 3231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:903096962"
variation 3232
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1484869602"
variation 3233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:998051016"
variation 3237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645803490"
variation 3239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:190778316"
variation 3240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1028235058"
variation 3244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:573515805"
variation 3247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:999569691"
variation 3268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1166214313"
variation 3269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726515"
variation 3271..3278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="aggactag"
/db_xref="dbSNP:542709440"
variation 3273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:889712007"
variation 3280
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645803888"
variation 3281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1169098660"
variation 3286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645804021"
variation 3287..3294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagaa"
/replace="aagaagaa"
/db_xref="dbSNP:1645804185"
variation 3287..3288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:763151419"
variation 3292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645804239"
variation 3297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645804313"
variation 3300..3302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aaa"
/db_xref="dbSNP:1645804382"
variation 3309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645804429"
variation 3312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005763656"
variation 3313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645804548"
variation 3315
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1335784510"
variation 3317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1016780880"
variation 3318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645804829"
variation 3320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1010924348"
variation 3326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:116130930"
variation 3328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557625376"
variation 3330
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294728825"
variation 3331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645805224"
variation 3333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:972530050"
variation 3334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:977320190"
variation 3335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571381730"
variation 3336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023962631"
variation 3342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:16822444"
variation 3345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645805569"
variation 3364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1202542245"
variation 3369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645805687"
variation 3371..3376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1481124682"
variation 3377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1446614001"
variation 3379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645805834"
variation 3382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:979769602"
variation 3391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982470959"
variation 3393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:926829253"
variation 3394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645806069"
variation 3396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1406617402"
variation 3399
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1450110270"
variation 3400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645806451"
variation 3402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645806516"
variation 3404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:181016113"
variation 3406..3417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="ccaccccccacc"
/db_xref="dbSNP:1645806646"
variation 3409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:751161957"
variation 3411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1157587098"
variation 3412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:2057606"
variation 3413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1402522809"
variation 3414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766433433"
variation 3420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645807023"
variation 3422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645807088"
variation 3424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148726602"
variation 3430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148726604"
variation 3432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:915647003"
variation 3434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774454425"
variation 3436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1420740074"
variation 3439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1303406314"
variation 3440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645807432"
variation 3442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645807482"
variation 3445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645807546"
variation 3446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645807607"
variation 3447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645807682"
variation 3449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645807739"
variation 3451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329847234"
variation 3453
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645807828"
variation 3459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:945440601"
variation 3463..3469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctcc"
/replace="ctcctcc"
/db_xref="dbSNP:1235948754"
variation 3466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1275775510"
variation 3467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1350357017"
variation 3468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645808081"
variation 3470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645808119"
variation 3473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645808158"
variation 3474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:949953054"
variation 3475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045968353"
variation 3480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:759722423"
variation 3484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645808328"
variation 3487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:570108958"
variation 3488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1266648467"
variation 3492..3501
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taa"
/replace="taatacttaa"
/db_xref="dbSNP:1645808475"
variation 3498..3500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tta"
/replace="ttatta"
/db_xref="dbSNP:1431340111"
variation 3498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1302778723"
variation 3503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042485212"
variation 3506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1378011808"
variation 3508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645808743"
variation 3509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645808782"
variation 3511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1322040566"
variation 3532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363876827"
variation 3533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:767682331"
variation 3535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148726670"
variation 3539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390382219"
variation 3541..3549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cttcc"
/replace="cttccttcc"
/db_xref="dbSNP:934536365"
variation 3543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645809082"
variation 3544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1324604644"
variation 3548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:369176195"
variation 3549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:933953211"
variation 3550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1275467706"
variation 3552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148726687"
variation 3553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:544835378"
variation 3554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226871979"
variation 3556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645809561"
variation 3562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645809599"
variation 3566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645809645"
variation 3567
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1290514635"
variation 3568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:756407221"
variation 3577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1309107602"
variation 3584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1018350753"
variation 3585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:777135778"
variation 3586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645810043"
variation 3587..3590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taat"
/replace="taataat"
/db_xref="dbSNP:767987739"
variation 3587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810115"
variation 3597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1005485340"
variation 3601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645810360"
variation 3606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1267896119"
variation 3607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810475"
variation 3608..3611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:899918123"
variation 3608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998372574"
variation 3609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810616"
variation 3611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413786257"
variation 3612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645810706"
variation 3613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1017159938"
variation 3616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:897013046"
variation 3621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645810809"
variation 3622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:993907860"
variation 3626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645810891"
variation 3627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:372299339"
variation 3629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1030205426"
variation 3630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1490719297"
variation 3633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811096"
variation 3634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1366224993"
variation 3635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:764601080"
variation 3636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:983409479"
variation 3638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811328"
variation 3639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811390"
variation 3640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645811438"
variation 3650..3655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="aggtag"
/db_xref="dbSNP:756900274"
variation 3652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:564719281"
variation 3655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:11263836"
variation 3656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726754"
variation 3659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1310206743"
variation 3660..3672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ggaagaaataccc"
/db_xref="dbSNP:1645811737"
variation 3661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645811799"
variation 3664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:868386416"
variation 3666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1351444886"
variation 3669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571382102"
variation 3670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414421664"
variation 3673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1382775879"
variation 3675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645812125"
variation 3690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:537751988"
variation 3692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1310777089"
variation 3693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812276"
variation 3695..3700
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agaaag"
/db_xref="dbSNP:1323589881"
variation 3699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645812383"
variation 3700
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440689421"
variation 3702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812500"
variation 3705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:559288688"
variation 3713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812623"
variation 3714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1163258781"
variation 3721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645812827"
variation 3724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:991151309"
variation 3725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645812964"
variation 3732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813038"
variation 3741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:979737204"
variation 3742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813196"
variation 3752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645813267"
variation 3753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645813358"
variation 3755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645813438"
variation 3758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813486"
variation 3761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645813558"
variation 3763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1253742631"
variation 3767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1426728596"
variation 3771
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:570501842"
variation 3785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645813750"
variation 3789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180935385"
variation 3790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1253558654"
variation 3792
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148726822"
variation 3795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425105622"
variation 3803
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645814149"
variation 3806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1324508934"
variation 3808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:2148726831"
variation 3810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645814267"
variation 3814..3817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tctc"
/replace="tctctc"
/db_xref="dbSNP:1645814366"
variation 3814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1034039916"
variation 3815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:959872642"
variation 3817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1353978258"
variation 3818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:915698048"
variation 3819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:989776856"
variation 3822
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645814620"
variation 3829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:757779782"
variation 3834
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645814719"
variation 3835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148726853"
variation 3838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1440196918"
variation 3840..3847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cctggcct"
/replace="cctggcctggcct"
/db_xref="dbSNP:1645814975"
variation 3840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1299799751"
variation 3842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645815037"
variation 3843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571382230"
variation 3849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815140"
variation 3852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726863"
variation 3856
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645815205"
variation 3857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:534583086"
variation 3858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1381602990"
variation 3859..3882
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cctccttttctccttattcctcct"
/replace="cctccttttctccttattcctccttttctccttattcctcct"
/db_xref="dbSNP:1553157181"
variation 3862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1396729640"
variation 3870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294910497"
variation 3871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815599"
variation 3874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726875"
variation 3875
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363066192"
variation 3878
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815689"
variation 3881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1226112037"
variation 3883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:981302878"
variation 3885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645815832"
variation 3887
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1342612616"
variation 3889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:778328049"
variation 3890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:745361943"
variation 3892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645816080"
variation 3894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1312596434"
variation 3895
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645816207"
variation 3898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645816260"
variation 3905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726894"
variation 3906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645816341"
variation 3907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148726901"
variation 3913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:934611109"
variation 3914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645816494"
variation 3917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1361359690"
variation 3918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645816630"
variation 3921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1182044331"
variation 3922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645816747"
variation 3924
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1246905719"
variation 3930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:922654018"
variation 3931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1228516462"
variation 3933..3934
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tt"
/db_xref="dbSNP:377610395"
variation 3939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:780857425"
variation 3944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414319373"
variation 3947..3949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:546902781"
variation 3947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206085009"
variation 3949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1466769406"
variation 3955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645817287"
variation 3956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1320079218"
variation 3959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645817432"
variation 3960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726946"
variation 3961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645817503"
variation 3962..3966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tct"
/replace="tctct"
/db_xref="dbSNP:1645817555"
variation 3963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645817611"
variation 3964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:914485906"
variation 3965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11544095"
variation 3967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1645817850"
variation 3968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645817948"
variation 3968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1039642957"
variation 3969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:911246481"
variation 3974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645818052"
variation 3975
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645818125"
variation 3976
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1218478003"
variation 3978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1383747021"
variation 3981
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645818278"
variation 3988
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1474000510"
variation 3991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:544171570"
variation 3992
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645818496"
variation 3993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645818573"
variation 3996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210403066"
variation 3998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1267025830"
variation 4000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645818774"
variation 4001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:941259690"
variation 4002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210045144"
variation 4010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557625954"
variation 4011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998653464"
variation 4016
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148726995"
variation 4020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1419147558"
variation 4021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051283965"
variation 4025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645819124"
variation 4030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:574493933"
variation 4031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645819228"
variation 4033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645819305"
variation 4034..4040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aga"
/replace="agaga"
/replace="agagaga"
/db_xref="dbSNP:1408443115"
variation 4034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541523978"
variation 4035
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645819519"
variation 4040..4048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaacaaaa"
/db_xref="dbSNP:1645819640"
variation 4040..4043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:2148727018"
variation 4040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1158708063"
variation 4045..4048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaaa"
/db_xref="dbSNP:1410026095"
variation 4046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645819731"
variation 4049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645819774"
variation 4050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:896976019"
variation 4053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1172827157"
variation 4059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1401165263"
variation 4060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645819984"
variation 4064
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1451767701"
variation 4065
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645820089"
variation 4068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645820124"
variation 4069..4070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tt"
/db_xref="dbSNP:1345756099"
variation 4074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1334655869"
variation 4075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004367048"
variation 4077
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1219582033"
variation 4082
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1287397808"
variation 4087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645820515"
variation 4091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:372998612"
variation 4094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1017237893"
variation 4097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645820656"
variation 4101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:373319406"
variation 4103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645820760"
variation 4104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1229745842"
variation 4105
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1268251248"
variation 4111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645820953"
variation 4112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645821031"
variation 4114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645821074"
variation 4115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727056"
variation 4123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:993969649"
variation 4129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1012596617"
variation 4131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645821231"
variation 4132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1448552286"
variation 4135
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045604964"
variation 4136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:906930863"
variation 4138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645821420"
variation 4141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645821491"
variation 4149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489048022"
variation 4164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727077"
variation 4165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645821607"
variation 4166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1181892531"
variation 4172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:557125243"
variation 4175
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645821728"
variation 4177..4178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1645821768"
variation 4178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001311726"
variation 4179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1473677704"
variation 4190..4194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1645822036"
variation 4191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1034417264"
variation 4193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645822170"
variation 4194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1413184561"
variation 4195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571382638"
variation 4198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571382641"
variation 4202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:957094857"
variation 4203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011572868"
variation 4207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645822564"
variation 4208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645822629"
variation 4209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:971191188"
variation 4211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1022507355"
variation 4213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727119"
variation 4215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:756144267"
variation 4216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645822899"
variation 4222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645822953"
variation 4226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:575345163"
variation 4229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978201284"
variation 4231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557626132"
variation 4233..4234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645823176"
variation 4234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411307035"
variation 4239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1322270306"
variation 4240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727135"
variation 4246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:924373359"
variation 4247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203565985"
variation 4251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:922791500"
variation 4257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645823580"
variation 4260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645823649"
variation 4261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727146"
variation 4262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546120621"
variation 4263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645823762"
variation 4266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645823818"
variation 4268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1444486087"
variation 4270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1204943412"
variation 4272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:564025142"
variation 4274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727163"
variation 4275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376079873"
variation 4277..4293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcact"
/replace="ctgcactgtcctgcact"
/db_xref="dbSNP:1645824056"
variation 4278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645824109"
variation 4279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1250105760"
variation 4282
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:989931107"
variation 4287
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645824277"
variation 4289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1183169742"
variation 4290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645824454"
variation 4292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645824508"
variation 4304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645824577"
variation 4307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1237116217"
variation 4312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1471885737"
variation 4321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:780741067"
variation 4322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727183"
variation 4325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:576855548"
variation 4328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645824874"
variation 4331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541050685"
variation 4333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148727191"
variation 4342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1425259445"
variation 4343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1196156313"
variation 4345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424382195"
variation 4347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431327702"
variation 4348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329204468"
variation 4362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:2148727201"
variation 4364..4369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtgt"
/replace="gtgtgt"
/db_xref="dbSNP:1645825345"
variation 4364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:943249793"
variation 4373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:749624548"
variation 4375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645825509"
variation 4377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:921234759"
variation 4385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645825620"
variation 4388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571382858"
variation 4395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645825732"
variation 4398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1382833814"
variation 4406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:933993252"
variation 4407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645825989"
variation 4411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645826036"
variation 4413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645826076"
variation 4416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1344840620"
variation 4418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1291821976"
variation 4418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148727232"
variation 4423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727237"
variation 4426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645826237"
variation 4427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1206299477"
variation 4428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051641159"
variation 4438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645826361"
variation 4451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1440880750"
variation 4452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:559288072"
variation 4459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1404346706"
variation 4460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645826631"
variation 4461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645826690"
variation 4463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1238149641"
variation 4466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645826756"
variation 4467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571382930"
variation 4468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1414972830"
variation 4469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645826919"
variation 4471..4472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645827004"
variation 4471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571382944"
variation 4472..4473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ct"
/db_xref="dbSNP:1645827093"
variation 4472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1199589770"
variation 4473..4492
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttttt"
/replace="tttttttttt"
/replace="ttttttttttt"
/replace="ttttttttttttt"
/replace="tttttttttttttt"
/replace="tttttttttttttttttt"
/replace="ttttttttttttttttttt"
/replace="tttttttttttttttttttt"
/replace="ttttttttttttttttttttt"
/replace="tttttttttttttttttttttt"
/replace="ttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttt"
/replace="ttttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttt"
/replace="ttttttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttttt"
/replace="ttttttttttttttttttttttttttttt"
/db_xref="dbSNP:rs34158936"
variation 4473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1317317471"
variation 4483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1645827510"
variation 4487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1645827572"
variation 4490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645827616"
variation 4491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645827660"
variation 4492..4493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/replace="ttttttttttttttg"
/db_xref="dbSNP:1645827744"
variation 4492
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1433708088"
variation 4493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1324502726"
variation 4493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645827857"
variation 4493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:78160010"
variation 4494..4496
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:2148727293"
variation 4495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:80323450"
variation 4497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttttttat"
/db_xref="dbSNP:1344308844"
variation 4498..4508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gagacatgggg"
/db_xref="dbSNP:1571383009"
variation 4498..4503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gagaca"
/db_xref="dbSNP:1645828118"
variation 4498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1221227537"
variation 4499..4500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ttt"
/db_xref="dbSNP:1571383021"
variation 4499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1264465139"
variation 4500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645828282"
variation 4502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1347685404"
variation 4503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1246135635"
variation 4505..4508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gggg"
/db_xref="dbSNP:1201553074"
variation 4508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383053"
variation 4509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571383061"
variation 4512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1202415337"
variation 4514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1446323086"
variation 4516
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645828685"
variation 4518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645828732"
variation 4519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645828797"
variation 4520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645828866"
variation 4522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645828904"
variation 4523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645828946"
variation 4524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1038777167"
variation 4526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645829095"
variation 4527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206886008"
variation 4529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:887198165"
variation 4531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383099"
variation 4533..4534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1246165335"
variation 4536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1466173006"
variation 4537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148727341"
variation 4538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004418882"
variation 4539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645829765"
variation 4540
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148727347"
variation 4541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283953973"
variation 4542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376878725"
variation 4544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:185636267"
variation 4549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645830052"
variation 4549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1038514020"
variation 4550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:548345110"
variation 4556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645830216"
variation 4559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1429539161"
variation 4564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:141020163"
variation 4566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1317924229"
variation 4575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045574832"
variation 4576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390154190"
variation 4579..4584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccccc"
/replace="cccccc"
/replace="ccccccc"
/db_xref="dbSNP:1264240367"
variation 4579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:907066780"
variation 4582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:531001823"
variation 4583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1235875938"
variation 4585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645830802"
variation 4585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1480146316"
variation 4587..4589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1571383214"
variation 4587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645830860"
variation 4591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001277575"
variation 4595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197277733"
variation 4596
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1379454699"
variation 4597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1022652520"
variation 4599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157971224"
variation 4600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1382485104"
variation 4601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:971502052"
variation 4602..4604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1205659617"
variation 4603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1298430299"
variation 4604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:552938102"
variation 4605
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645831457"
variation 4606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1266582286"
variation 4607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645831573"
variation 4608..4614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/replace="ttttttttttttt"
/db_xref="dbSNP:1364497161"
variation 4614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645831800"
variation 4619..4622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:1645831867"
variation 4621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1002538732"
variation 4623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1031870725"
variation 4624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1472079739"
variation 4626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955779820"
variation 4631
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1302700761"
variation 4637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383330"
variation 4638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645832314"
variation 4642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645832379"
variation 4646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:3767701"
variation 4647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645832571"
variation 4648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727431"
variation 4652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645832655"
variation 4655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413552657"
variation 4657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1453774936"
variation 4660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1163253086"
variation 4666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:535305390"
variation 4667..4669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="ttttt"
/db_xref="dbSNP:1645833042"
variation 4669
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1388934119"
variation 4670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:546631807"
variation 4674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:989942450"
variation 4675..4685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gcctgggcttg"
/db_xref="dbSNP:1645833247"
variation 4678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:892881648"
variation 4679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571383382"
variation 4687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645833421"
variation 4688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1011206378"
variation 4689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:567921238"
variation 4691
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:966909637"
variation 4693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:914383203"
variation 4696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383404"
variation 4699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:999755697"
variation 4705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1264842778"
variation 4711..4712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645833861"
variation 4713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1354127015"
variation 4715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645833991"
variation 4720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:529226907"
variation 4727
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1224575972"
variation 4728
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148727485"
variation 4738
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:11263837"
variation 4740..4756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tggagg"
/replace="tggaggccagctggagg"
/db_xref="dbSNP:1482570994"
variation 4741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955570714"
variation 4747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645834334"
variation 4749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1490230038"
variation 4750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1252219325"
variation 4762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571383462"
variation 4763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:985943795"
variation 4766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:147872657"
variation 4768..4770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1367279967"
variation 4776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645834800"
variation 4778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645834859"
variation 4779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645834930"
variation 4783
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645835003"
variation 4787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:575432473"
variation 4792
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148727526"
variation 4793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1164723063"
variation 4796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557626633"
variation 4802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180986599"
variation 4805
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:538396559"
variation 4806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1441473989"
variation 4807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645835457"
variation 4811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645835540"
variation 4812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645835612"
variation 4816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1158965724"
variation 4817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645835712"
variation 4820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645835761"
variation 4822
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:768629161"
variation 4826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1422319454"
variation 4828
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645835966"
variation 4829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:539225992"
variation 4838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390797034"
variation 4839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645836125"
variation 4845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390373559"
variation 4847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1328762082"
variation 4848..4854
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atc"
/replace="atctatc"
/db_xref="dbSNP:1248093606"
variation 4848
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940048856"
variation 4849..4851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1341276282"
variation 4851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645836434"
variation 4852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:549478819"
variation 4855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645836515"
variation 4858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:981391115"
variation 4862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645836622"
variation 4863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:928450240"
variation 4867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571383569"
variation 4870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645836781"
variation 4879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645836821"
variation 4885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645836891"
variation 4885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:937119553"
variation 4888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:898638537"
variation 4890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:948854920"
variation 4893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1045068402"
variation 4895
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1056043426"
variation 4897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383595"
variation 4900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002958675"
variation 4901
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:374604719"
variation 4903
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:891564764"
variation 4909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645837338"
variation 4911..4918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="catt"
/replace="cattcatt"
/db_xref="dbSNP:568286493"
variation 4921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:779127991"
variation 4925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645837495"
variation 4931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645837557"
variation 4941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645837592"
variation 4942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1172946442"
variation 4945..4949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taact"
/replace="taactaact"
/db_xref="dbSNP:763091191"
variation 4948..4955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctcct"
/replace="ctcctcct"
/db_xref="dbSNP:1465749168"
variation 4948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301254589"
variation 4949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1404445156"
variation 4950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:566005717"
variation 4951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645837930"
variation 4969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:557502697"
variation 4973..4980
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gc"
/replace="gctacagc"
/db_xref="dbSNP:1557626785"
variation 4975
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:776479735"
variation 4977
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1267521187"
variation 4981
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838154"
variation 4982
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645838239"
variation 4991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748073066"
variation 4993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1357140818"
variation 4995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:148920115"
variation 4998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645838456"
variation 5000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1041364990"
variation 5001..5002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645838643"
variation 5001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838592"
variation 5002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838705"
variation 5009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:551183965"
variation 5010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1307814250"
variation 5019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232095258"
variation 5021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645838886"
variation 5023
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645838928"
variation 5029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645838966"
variation 5030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253817472"
variation 5032
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:559700666"
variation 5037..5038
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1203738330"
variation 5042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645839164"
variation 5043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1247992782"
variation 5044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571383731"
variation 5047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1179212155"
variation 5048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:974546690"
variation 5054
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645839412"
variation 5055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645839464"
variation 5056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:999722784"
variation 5061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1029906678"
variation 5065
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:574738407"
variation 5066
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1432895085"
variation 5067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:891379793"
variation 5070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645839882"
variation 5071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1174300866"
variation 5083..5088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agag"
/replace="agagag"
/db_xref="dbSNP:1030698125"
variation 5087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:954617636"
variation 5094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645840096"
variation 5099..5101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="act"
/db_xref="dbSNP:1645840140"
variation 5100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645840201"
variation 5102..5103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1645840255"
variation 5103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645840310"
variation 5106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1319940523"
variation 5108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645840847"
variation 5109
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:749135264"
variation 5110
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987209249"
variation 5115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557626922"
variation 5116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571383810"
variation 5117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:908518241"
variation 5120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1362408292"
variation 5129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1298812667"
variation 5131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841240"
variation 5134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:940101447"
variation 5137
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645841340"
variation 5138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841375"
variation 5141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774314069"
variation 5142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645841478"
variation 5144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1018878974"
variation 5147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1326383796"
variation 5151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841621"
variation 5152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:962811047"
variation 5153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:569028747"
variation 5154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1218561159"
variation 5155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645841805"
variation 5157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:974593532"
variation 5166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1243192888"
variation 5167
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1488390585"
variation 5172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727754"
variation 5174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401866702"
variation 5178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727758"
variation 5185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727763"
variation 5191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1271378698"
variation 5192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1025644941"
variation 5193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:528581690"
variation 5194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645842188"
variation 5196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:759576331"
variation 5199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842281"
variation 5201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842329"
variation 5203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:919992705"
variation 5208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1409869642"
variation 5216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842477"
variation 5218..5221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:948897736"
variation 5218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645842520"
variation 5220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1161287709"
variation 5221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1382484440"
variation 5222..5238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctaggatcagggcacta"
/replace="ctaggatcagggcactaggatcagggcacta"
/db_xref="dbSNP:1645842729"
variation 5222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645842691"
variation 5224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1345701651"
variation 5226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:142820733"
variation 5230..5231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ag"
/db_xref="dbSNP:1645842850"
variation 5236
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1435560919"
variation 5238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645842923"
variation 5242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:11584551"
variation 5243
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301096853"
variation 5244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1347106387"
variation 5245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645843246"
variation 5247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1405193284"
variation 5251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:951399769"
variation 5252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1315279151"
variation 5254
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645843426"
variation 5257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645843474"
variation 5259..5260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tc"
/db_xref="dbSNP:1322495713"
variation 5268..5270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645843565"
variation 5270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148727824"
variation 5274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1044534109"
variation 5275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1285628921"
variation 5281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226998190"
variation 5282
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645843752"
variation 5283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384016"
variation 5289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1219960188"
variation 5292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1294435310"
variation 5293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645843975"
variation 5294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645844021"
variation 5295
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384041"
variation 5296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844138"
variation 5300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:907449262"
variation 5302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:536462158"
variation 5307
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:563614918"
variation 5316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1181737936"
variation 5322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1249885644"
variation 5324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:531160067"
variation 5325..5334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttctctcctt"
/replace="ttctctccttctctcctt"
/db_xref="dbSNP:1645844480"
variation 5327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844528"
variation 5332..5334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctt"
/db_xref="dbSNP:1645844611"
variation 5332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:552823877"
variation 5334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:879655926"
variation 5338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844688"
variation 5340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1404716895"
variation 5341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1161533657"
variation 5343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1367212903"
variation 5344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425058234"
variation 5346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645844925"
variation 5347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571384105"
variation 5348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645845050"
variation 5348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1307085474"
variation 5350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845099"
variation 5353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148727887"
variation 5358
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:767735487"
variation 5359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:552050201"
variation 5363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:528802065"
variation 5373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443788207"
variation 5374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845349"
variation 5376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:190099919"
variation 5377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845472"
variation 5380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256609372"
variation 5381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845584"
variation 5387
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021369384"
variation 5390
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:947143594"
variation 5396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645845708"
variation 5397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:182744550"
variation 5398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571384166"
variation 5404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1204874862"
variation 5405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645845899"
variation 5410
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148727918"
variation 5412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645845949"
variation 5417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1272814860"
variation 5420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1190613951"
variation 5425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846085"
variation 5431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846135"
variation 5435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846189"
variation 5436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:151051297"
variation 5441
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1205425860"
variation 5444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465746348"
variation 5445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1172008691"
variation 5447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384210"
variation 5448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1471812605"
variation 5452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148727946"
variation 5455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405911669"
variation 5459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645846538"
variation 5460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902852262"
variation 5461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645846623"
variation 5462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645846660"
variation 5464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:954806567"
variation 5465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645846742"
variation 5467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:983361467"
variation 5473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645846852"
variation 5479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645846900"
variation 5480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645846957"
variation 5482..5488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/db_xref="dbSNP:1645847010"
variation 5494..5497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aaga"
/db_xref="dbSNP:1645847063"
variation 5499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148727972"
variation 5505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1167691315"
variation 5507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847159"
variation 5510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1394022800"
variation 5512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:932947717"
variation 5515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645847305"
variation 5518..5520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ata"
/replace="atata"
/db_xref="dbSNP:1329050564"
variation 5520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847415"
variation 5521..5524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:1358079609"
variation 5524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772382251"
variation 5525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:550680342"
variation 5528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1384154969"
variation 5530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645847733"
variation 5531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:961395198"
variation 5533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847828"
variation 5533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645847862"
variation 5535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645847914"
variation 5537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148728004"
variation 5552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645847954"
variation 5554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:764511304"
variation 5555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1341839128"
variation 5556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:187348990"
variation 5559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1278180244"
variation 5561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440823891"
variation 5563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645848224"
variation 5564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645848273"
variation 5570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:970088425"
variation 5572
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645848359"
variation 5573..5578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtg"
/replace="gtggtg"
/db_xref="dbSNP:1645848479"
variation 5573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1276597545"
variation 5575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1461734061"
variation 5577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571384324"
variation 5578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1342434963"
variation 5584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645848655"
variation 5588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219399290"
variation 5596
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:539113284"
variation 5597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:980694120"
variation 5598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1371146862"
variation 5599..5600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="at"
/db_xref="dbSNP:1645848996"
variation 5599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:891356896"
variation 5600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645849048"
variation 5601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401665842"
variation 5605
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1310304736"
variation 5609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645849252"
variation 5623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:928789700"
variation 5626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256324753"
variation 5628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1467820619"
variation 5629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:557539448"
variation 5630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645849521"
variation 5632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148728056"
variation 5634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:754200663"
variation 5635
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645849600"
variation 5636..5637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:749776818"
variation 5645..5647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gtg"
/db_xref="dbSNP:1645849756"
variation 5645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757754773"
variation 5647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1435029828"
variation 5649..5650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1316774797"
variation 5649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1320249981"
variation 5651..5655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1328627531"
variation 5651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645849999"
variation 5652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645850105"
variation 5653
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645850140"
variation 5655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557627407"
variation 5657..5661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ccccc"
/db_xref="dbSNP:1645850330"
variation 5657..5661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:770805142"
variation 5657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1018434015"
variation 5659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645850511"
variation 5661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:898696084"
variation 5664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645850599"
variation 5665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274532947"
variation 5668
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:41308339"
variation 5673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645850811"
variation 5680..5682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1645850893"
variation 5680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645850851"
variation 5682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225535156"
variation 5684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1477947563"
variation 5685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1025695548"
variation 5687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197997922"
variation 5689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1263862850"
variation 5692
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:951451722"
variation 5694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851215"
variation 5697
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1328507462"
variation 5698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645851305"
variation 5702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002846536"
variation 5714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1204485880"
variation 5715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1035711401"
variation 5716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426622329"
variation 5717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645851511"
variation 5722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1448579369"
variation 5723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851605"
variation 5726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851648"
variation 5731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728166"
variation 5733..5735
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1193605967"
variation 5733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:958630214"
variation 5737
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851808"
variation 5741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1479270221"
variation 5748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728182"
variation 5749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1178071830"
variation 5750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645851930"
variation 5756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645851973"
variation 5760
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042669059"
variation 5762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1456242492"
variation 5765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852094"
variation 5767..5770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:759259838"
variation 5767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852142"
variation 5770..5781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgcttgcttgct"
/replace="tgcttgcttgcttgct"
/db_xref="dbSNP:900265053"
variation 5770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645852241"
variation 5771
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645852361"
variation 5775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401689084"
variation 5778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852451"
variation 5779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:191912446"
variation 5781..5782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tgctggcc"
/db_xref="dbSNP:1553157487"
variation 5782..5789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggcc"
/replace="ggccggcc"
/replace="ggccggccggcc"
/db_xref="dbSNP:1296575768"
variation 5783..5797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gccggcctgcctgcc"
/replace="gccggcctgcctgccggcctgcctgcc"
/db_xref="dbSNP:1362617855"
variation 5783..5793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gccggcctgcc"
/replace="gccggcctgccggcctgcc"
/db_xref="dbSNP:1645852668"
variation 5784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645852759"
variation 5785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:914403513"
variation 5786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:968992815"
variation 5787..5819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gcctgcctgcctg"
/replace="gcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
g"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
gcctg"
/replace="gcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcctgcct
gcctgcctg"
/db_xref="dbSNP:rs372821782"
variation 5787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1282666371"
variation 5789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645853224"
variation 5790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1365616037"
variation 5790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:977225175"
variation 5791..5797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gcctgcc"
/replace="gcctgccggcctgcc"
/db_xref="dbSNP:747270933"
variation 5791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426944064"
variation 5793..5826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgcctgcctgcctgcctgtctgcct"
/db_xref="dbSNP:1571384632"
variation 5793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301971013"
variation 5794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1370162251"
variation 5795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1389789240"
variation 5797..5826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcctgcctgcctgcctgcctgtctgcct"
/replace="ctgcctgcctgcctgcctgcctgtctgcctgcctgcctgcctgcctgt
ctgcct"
/db_xref="dbSNP:1645853684"
variation 5798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645853731"
variation 5801..5826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgcctgcctgtctgcct"
/replace="ctgcctgcctgcctgcctgtctgcctgcctgcctgcctgtctgcct"
/db_xref="dbSNP:1645853771"
variation 5802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1316118886"
variation 5803
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1309282984"
variation 5804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645854320"
variation 5805..5826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgcctgtctgcct"
/db_xref="dbSNP:1336375849"
variation 5807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384653"
variation 5808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:963254787"
variation 5809..5826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcctgtctgcct"
/replace="ctgcctgcctgtctgcctgcctgtctgcct"
/db_xref="dbSNP:1237611797"
variation 5811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645854627"
variation 5812
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:555364099"
variation 5813..5826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgtctgcct"
/replace="ctgcctgtctgcctgtctgcct"
/db_xref="dbSNP:1287917302"
variation 5813
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1292098066"
variation 5814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645854848"
variation 5815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645854897"
variation 5816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557627632"
variation 5817..5828
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctgtctgcctat"
/db_xref="dbSNP:1252062550"
variation 5817..5823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgtctg"
/replace="ctgtctgtctg"
/db_xref="dbSNP:200133723"
variation 5817..5819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgactg"
/db_xref="dbSNP:1553157504"
variation 5819..5820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="cc"
/db_xref="dbSNP:770398111"
variation 5820..5821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gc"
/db_xref="dbSNP:1645855334"
variation 5820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:112770520"
variation 5821..5826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctgcct"
/replace="ctgcctgcct"
/db_xref="dbSNP:1183589156"
variation 5822
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645855424"
variation 5823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:571445890"
variation 5825
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645855513"
variation 5842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645855558"
variation 5844
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645855603"
variation 5849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1383916478"
variation 5853
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051361821"
variation 5857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1164574343"
variation 5858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645855799"
variation 5864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1389894962"
variation 5866
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1221324706"
variation 5871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1026961947"
variation 5873
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:910240712"
variation 5876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1395510442"
variation 5877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:942960160"
variation 5879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757921944"
variation 5880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1489203442"
variation 5884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1380448830"
variation 5885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1193414679"
variation 5886
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571384799"
variation 5888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:775414815"
variation 5890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645856560"
variation 5892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1315494134"
variation 5893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:898752248"
variation 5894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1224797571"
variation 5899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:928691509"
variation 5900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1202463972"
variation 5901
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:996046803"
variation 5904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645856886"
variation 5905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148728410"
variation 5907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1419008182"
variation 5910..5911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1241877536"
variation 5910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1463077268"
variation 5911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1047275375"
variation 5912
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857163"
variation 5914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1184703413"
variation 5917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:887166316"
variation 5918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1427104575"
variation 5920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002980449"
variation 5925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1420492800"
variation 5933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857445"
variation 5942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645857490"
variation 5944..5945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645857539"
variation 5945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645857582"
variation 5948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857646"
variation 5952
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1302816968"
variation 5955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1035677605"
variation 5960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:913494355"
variation 5961
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728446"
variation 5962
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645857860"
variation 5964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645857900"
variation 5971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557627845"
variation 5980
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645857980"
variation 5987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571384916"
variation 5988
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1174403877"
variation 5996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762492099"
variation 6001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:958990209"
variation 6002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:779696256"
variation 6004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1337231783"
variation 6010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1380300635"
variation 6014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645858678"
variation 6017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1297341203"
variation 6018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1307689490"
variation 6023
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:947601773"
variation 6027
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260732717"
variation 6033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645859042"
variation 6036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645859089"
variation 6041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1324999845"
variation 6043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1204871772"
variation 6048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1438787912"
variation 6051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645859379"
variation 6053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1021921367"
variation 6054
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:968671573"
variation 6062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763849097"
variation 6064
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645859555"
variation 6067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042724086"
variation 6068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645859650"
variation 6069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645859708"
variation 6070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:567274274"
variation 6085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:72661619"
variation 6086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:150347120"
variation 6090..6094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1431544208"
variation 6093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987216748"
variation 6094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546276346"
variation 6095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470343952"
variation 6097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:910216586"
variation 6102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1344515647"
variation 6117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645860254"
variation 6123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:192229737"
variation 6126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1290445387"
variation 6127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1362339452"
variation 6133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1403969851"
variation 6137
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645860504"
variation 6138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1244761611"
variation 6138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1287368967"
variation 6140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1037381878"
variation 6145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645860681"
variation 6149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148728519"
variation 6151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1280900615"
variation 6155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645860783"
variation 6162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1346907933"
variation 6163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:920145968"
variation 6164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645860929"
variation 6172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:528689854"
variation 6174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645861030"
variation 6175
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1284226539"
variation 6177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:931573500"
variation 6179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1315693552"
variation 6180
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:540957769"
variation 6191..6194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1221573684"
variation 6192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645861365"
variation 6197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:368046981"
variation 6199..6208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gagaa"
/replace="gagaagagaa"
/db_xref="dbSNP:1645861470"
variation 6203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1490268876"
variation 6209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231826043"
variation 6211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1457670138"
variation 6213
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220619177"
variation 6215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1271306211"
variation 6222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1047241439"
variation 6226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1004756207"
variation 6229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645861848"
variation 6236
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405839722"
variation 6244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:769653660"
variation 6251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645861970"
variation 6264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1417265705"
variation 6266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148728576"
variation 6273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1161126832"
variation 6275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360937850"
variation 6277..6281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gatcc"
/replace="gatccgatcc"
/db_xref="dbSNP:1645862149"
variation 6286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:562224713"
variation 6288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:899097755"
variation 6291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1002947890"
variation 6293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1057471908"
variation 6297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645862459"
variation 6301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645862508"
variation 6303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:138074007"
variation 6304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645862610"
variation 6312
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645862666"
variation 6314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1440747757"
variation 6317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645862778"
variation 6318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1162890296"
variation 6322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645862869"
variation 6328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:894562681"
variation 6330
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:754406043"
variation 6332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148728607"
variation 6337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:772201195"
variation 6341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148728609"
variation 6354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645863100"
variation 6355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645863154"
variation 6356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1021640249"
variation 6362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:141089342"
variation 6363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998758461"
variation 6364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1244212532"
variation 6364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1294278586"
variation 6366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1490584781"
variation 6367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:960365327"
variation 6368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:775545090"
variation 6369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1481620700"
variation 6371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:568795494"
variation 6373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380815145"
variation 6374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645863841"
variation 6378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:987268068"
variation 6386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1443819358"
variation 6389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:144915813"
variation 6391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571385299"
variation 6392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864076"
variation 6394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864138"
variation 6395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1377348939"
variation 6396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645864227"
variation 6402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:374706238"
variation 6403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:113615155"
variation 6405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864372"
variation 6410
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645864425"
variation 6411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1282216452"
variation 6417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645864544"
variation 6418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645864590"
variation 6421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405605719"
variation 6423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645864668"
variation 6425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380813945"
variation 6427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:973456920"
variation 6428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728666"
variation 6429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645864840"
variation 6430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645864882"
variation 6432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:760929529"
variation 6435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:551057779"
variation 6438
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645865280"
variation 6439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1332689680"
variation 6441
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:114256824"
variation 6442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197273641"
variation 6444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645865489"
variation 6446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:184309288"
variation 6458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:983063796"
variation 6462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260624813"
variation 6463..6467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttt"
/replace="tttttt"
/db_xref="dbSNP:1645865803"
variation 6465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1458613385"
variation 6467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645865916"
variation 6468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:922161015"
variation 6474..6482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttt"
/replace="tttttttt"
/replace="ttttttttt"
/replace="tttttttttt"
/db_xref="dbSNP:370557448"
variation 6474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1309399501"
variation 6480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645866192"
variation 6481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645866233"
variation 6482..6483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aaa"
/db_xref="dbSNP:1645866326"
variation 6482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:987536748"
variation 6483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1187213249"
variation 6484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385436"
variation 6485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1236111557"
variation 6486..6488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:911645288"
variation 6489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1473876167"
variation 6493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1181616122"
variation 6498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940409522"
variation 6505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1472999025"
variation 6508..6509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aa"
/db_xref="dbSNP:1167019359"
variation 6508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645866716"
variation 6509
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1182705289"
variation 6513..6518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gggcag"
/db_xref="dbSNP:1645866894"
variation 6515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1036208175"
variation 6520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571385482"
variation 6525
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645867033"
variation 6526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728745"
variation 6527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:555660904"
variation 6529..6535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="act"
/replace="actgact"
/db_xref="dbSNP:1422983575"
variation 6529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1404662978"
variation 6531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645867197"
variation 6535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1451113438"
variation 6536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1339192698"
variation 6538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1341515389"
variation 6541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1430446901"
variation 6544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1464188223"
variation 6546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645867423"
variation 6549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645867458"
variation 6552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645867490"
variation 6553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1364387032"
variation 6560
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645867572"
variation 6564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:572628298"
variation 6567..6568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1201765786"
variation 6571
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645867751"
variation 6575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:930444612"
variation 6577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645867836"
variation 6584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1045041411"
variation 6585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:530603610"
variation 6592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:78530614"
variation 6593..6594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="at"
/db_xref="dbSNP:1476204564"
variation 6593
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645868037"
variation 6594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:894522255"
variation 6596
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:776882598"
variation 6601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868215"
variation 6603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645868270"
variation 6605
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1448255656"
variation 6608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1269278192"
variation 6609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:948849183"
variation 6612..6613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645868454"
variation 6615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868500"
variation 6616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762170192"
variation 6618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1043438858"
variation 6621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868671"
variation 6622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385608"
variation 6626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1403509038"
variation 6627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645868786"
variation 6629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645868819"
variation 6633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:904567735"
variation 6641..6642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1400592274"
variation 6642..6649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tca"
/replace="tcatctca"
/db_xref="dbSNP:1219867000"
variation 6642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645868959"
variation 6644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645869071"
variation 6645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645869125"
variation 6647
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645869167"
variation 6648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765675340"
variation 6649..6651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1328506458"
variation 6652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571385649"
variation 6656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1319157924"
variation 6660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1343778835"
variation 6663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:557084074"
variation 6671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1036062361"
variation 6673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276584304"
variation 6678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:895920140"
variation 6680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276910052"
variation 6681..6682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1645869877"
variation 6681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:575661209"
variation 6682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645869937"
variation 6683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645869988"
variation 6686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1010249007"
variation 6688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:2148728856"
variation 6688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645870081"
variation 6689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1020314191"
variation 6690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:546362220"
variation 6699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1479199859"
variation 6701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645870356"
variation 6703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890382760"
variation 6704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1008657978"
variation 6707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:763548820"
variation 6711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157272761"
variation 6713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645870598"
variation 6714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:953725615"
variation 6718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645870679"
variation 6719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:964799598"
variation 6722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1302826706"
variation 6729
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645870815"
variation 6732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:973205940"
variation 6739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:911516959"
variation 6740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645870970"
variation 6743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195863102"
variation 6745
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424452573"
variation 6749..6754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctt"
/replace="cttctt"
/db_xref="dbSNP:1477632037"
variation 6749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:940323449"
variation 6752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:920339228"
variation 6755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1355662531"
variation 6758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170784368"
variation 6759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:930497110"
variation 6766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571385821"
variation 6769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645871464"
variation 6770
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645871530"
variation 6775
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1290634553"
variation 6777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645871697"
variation 6777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:558270328"
variation 6778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1211203653"
variation 6781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1044886782"
variation 6784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:138767681"
variation 6787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:939242447"
variation 6793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:950401389"
variation 6796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1185440121"
variation 6798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1057145760"
variation 6800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872395"
variation 6801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:895835109"
variation 6803..6807
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="cttct"
/db_xref="dbSNP:1440738836"
variation 6806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571385873"
variation 6815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:879157668"
variation 6817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872617"
variation 6825
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872675"
variation 6833
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645872766"
variation 6835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645872813"
variation 6838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645872840"
variation 6841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1163376199"
variation 6842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645872979"
variation 6843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:983116176"
variation 6846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1383722185"
variation 6847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:908759750"
variation 6849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148728950"
variation 6850
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148728953"
variation 6851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:540494493"
variation 6852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1395952822"
variation 6854
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645873310"
variation 6858
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:904610426"
variation 6859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385919"
variation 6862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148728967"
variation 6865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1326832455"
variation 6868
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:371613930"
variation 6872
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645873813"
variation 6873
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1447359167"
variation 6874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:10159166"
variation 6876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:953666043"
variation 6877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571385961"
variation 6879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1344366892"
variation 6880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874205"
variation 6884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:916104249"
variation 6886
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874331"
variation 6888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874374"
variation 6897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645874429"
variation 6898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:373746606"
variation 6900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1265650361"
variation 6902
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1009590328"
variation 6904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645874686"
variation 6905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:544844168"
variation 6911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386002"
variation 6914
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:375483845"
variation 6915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645874945"
variation 6916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1458625794"
variation 6917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1019173380"
variation 6918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875109"
variation 6919
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645875195"
variation 6921
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1273645163"
variation 6922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645875305"
variation 6925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1165828405"
variation 6927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875441"
variation 6929
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:746073637"
variation 6930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645875572"
variation 6933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645875655"
variation 6934
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875707"
variation 6936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1460567228"
variation 6945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645875815"
variation 6946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645875867"
variation 6948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645875920"
variation 6951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645875969"
variation 6953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876036"
variation 6959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1169758238"
variation 6960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:961745768"
variation 6965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:562192835"
variation 6966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1043187507"
variation 6970
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:904619927"
variation 6976
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380376895"
variation 6985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729053"
variation 6995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645876532"
variation 7000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397538632"
variation 7004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876620"
variation 7007..7009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1313037150"
variation 7013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876714"
variation 7014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487402670"
variation 7015
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645876817"
variation 7017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645876859"
variation 7019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:920349220"
variation 7023
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148729069"
variation 7026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645876981"
variation 7029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:779121299"
variation 7030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645877127"
variation 7034
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729074"
variation 7036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:532756658"
variation 7040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645877237"
variation 7042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:551094472"
variation 7048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645877341"
variation 7049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645877397"
variation 7051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645877438"
variation 7052..7053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1645877485"
variation 7053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645877531"
variation 7055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1053063998"
variation 7058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645877620"
variation 7069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1371449404"
variation 7073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:980648055"
variation 7078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1317917409"
variation 7083
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645877810"
variation 7088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203660652"
variation 7091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645877886"
variation 7093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1263954548"
variation 7093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645877939"
variation 7100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1484473665"
variation 7101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1182776319"
variation 7103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645878184"
variation 7106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890351554"
variation 7107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748582631"
variation 7108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451154583"
variation 7122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645878407"
variation 7124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1426972330"
variation 7129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645878525"
variation 7132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386195"
variation 7133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1196028282"
variation 7134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645878800"
variation 7136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1008842113"
variation 7138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645878921"
variation 7141..7146
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="caca"
/replace="cacaca"
/db_xref="dbSNP:926420699"
variation 7141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645878969"
variation 7156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1379364534"
variation 7158
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:186734072"
variation 7164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:755885015"
variation 7166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1467484723"
variation 7172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645879289"
variation 7174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:913819772"
variation 7179..7184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agc"
/replace="agcagc"
/db_xref="dbSNP:2148729156"
variation 7181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:527357395"
variation 7182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:900365728"
variation 7188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157779349"
variation 7190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:946087269"
variation 7191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645879642"
variation 7193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1378292176"
variation 7195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1222356299"
variation 7198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645879833"
variation 7199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645879888"
variation 7203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729179"
variation 7204
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:777420444"
variation 7205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314501170"
variation 7206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645880056"
variation 7208..7210
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctc"
/db_xref="dbSNP:1645880102"
variation 7210
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1041669384"
variation 7223
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386294"
variation 7224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645880326"
variation 7225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645880377"
variation 7229
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645880421"
variation 7234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645880469"
variation 7238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645880596"
variation 7246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645880650"
variation 7257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1639867973"
variation 7258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:558373845"
variation 7259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:904621610"
variation 7264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1485093351"
variation 7267
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1219140446"
variation 7278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000206497"
variation 7282
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729205"
variation 7283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772267788"
variation 7285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1027366153"
variation 7288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197401612"
variation 7294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148729212"
variation 7296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:889305740"
variation 7297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:749293608"
variation 7298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645881473"
variation 7300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645881534"
variation 7316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1176622861"
variation 7319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363083094"
variation 7321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:548918631"
variation 7325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1019646938"
variation 7326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1004521790"
variation 7332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1324961860"
variation 7335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360735202"
variation 7336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1333275975"
variation 7337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:567411609"
variation 7348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369010287"
variation 7349..7352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgta"
/replace="tgtatgta"
/db_xref="dbSNP:1442309469"
variation 7350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220376437"
variation 7353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645882353"
variation 7354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:770825835"
variation 7355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645882492"
variation 7356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027300752"
variation 7357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1287140063"
variation 7362..7363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gt"
/db_xref="dbSNP:1490253808"
variation 7363
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645882705"
variation 7366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951788921"
variation 7371
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:980959266"
variation 7376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1488846783"
variation 7379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1352008025"
variation 7380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645882980"
variation 7381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645883030"
variation 7383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1249705353"
variation 7384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645883150"
variation 7389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:544330785"
variation 7392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645883275"
variation 7394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645883329"
variation 7396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1413972925"
variation 7402..7403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645883489"
variation 7402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:960864590"
variation 7407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:537750959"
variation 7409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:993129847"
variation 7411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:916062408"
variation 7412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1351170931"
variation 7415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645883831"
variation 7417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149237486"
variation 7419..7423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ca"
/replace="catca"
/db_xref="dbSNP:913831161"
variation 7419..7420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ca"
/replace="cagca"
/db_xref="dbSNP:539061324"
variation 7421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:144443110"
variation 7422..7444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cagcagcagca"
/replace="cagcagcagcagca"
/replace="cagcagcagcagcagca"
/replace="cagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagcagcagca"
/replace="cagcagcagcagcagcagcagcagcagcagcagca"
/db_xref="dbSNP:rs889197162"
variation 7422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1355722293"
variation 7423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1203872063"
variation 7424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:575056563"
variation 7428..7429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ttgttgt"
/db_xref="dbSNP:1269588845"
variation 7431..7432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ctatggct"
/db_xref="dbSNP:1452072720"
variation 7433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1177987270"
variation 7437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1456405949"
variation 7440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cttc"
/db_xref="dbSNP:1645885688"
variation 7440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645885640"
variation 7442..7443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gc"
/replace="gcggc"
/db_xref="dbSNP:1645885789"
variation 7442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1180372984"
variation 7445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645885837"
variation 7446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645885889"
variation 7450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645885938"
variation 7451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148729327"
variation 7452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:934766659"
variation 7459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645886069"
variation 7461..7463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1645886176"
variation 7461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645886118"
variation 7462
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645886223"
variation 7464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:539822482"
variation 7465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645886321"
variation 7467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645886384"
variation 7469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729344"
variation 7470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:191490961"
variation 7471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645886496"
variation 7472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645886526"
variation 7473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:147996549"
variation 7478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:534259020"
variation 7479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:944611441"
variation 7480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571386624"
variation 7481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645886834"
variation 7484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571386633"
variation 7485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1367463573"
variation 7486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645887018"
variation 7487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:184023415"
variation 7492
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:574175798"
variation 7493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:544618983"
variation 7495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571386676"
variation 7499..7503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tctct"
/db_xref="dbSNP:1645887327"
variation 7503..7511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/replace="ttttttttt"
/replace="tttttttttt"
/replace="ttttttttttt"
/db_xref="dbSNP:rs796351016"
variation 7509..7510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:2148729387"
variation 7510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645887490"
variation 7511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:867387436"
variation 7512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1390866641"
variation 7519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571386715"
variation 7520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1286216662"
variation 7521..7524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:2148729393"
variation 7521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:188911199"
variation 7526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645887831"
variation 7529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1214158289"
variation 7532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256255072"
variation 7533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645887970"
variation 7537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645888019"
variation 7538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:960456203"
variation 7542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645888120"
variation 7544
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1048938605"
variation 7546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:182195447"
variation 7550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:577246142"
variation 7551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645888320"
variation 7552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645888365"
variation 7558
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1004657513"
variation 7561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207790449"
variation 7576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1238937216"
variation 7584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1472929518"
variation 7588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645888623"
variation 7589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645888676"
variation 7590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:770258663"
variation 7594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645889020"
variation 7595..7596
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1420923125"
variation 7595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1034669992"
variation 7598
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1172080513"
variation 7604
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:960444785"
variation 7612..7615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tcat"
/db_xref="dbSNP:1413226399"
variation 7615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1336586532"
variation 7618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:979339120"
variation 7622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1430287896"
variation 7624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1276524536"
variation 7625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1340047651"
variation 7626..7627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:746001460"
variation 7627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:925197893"
variation 7631
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571386829"
variation 7636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1267273030"
variation 7638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1219290317"
variation 7641
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645889940"
variation 7643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1282674801"
variation 7648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645890236"
variation 7652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645890277"
variation 7655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645890320"
variation 7659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1344247107"
variation 7661..7664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:1645890475"
variation 7661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:773678037"
variation 7663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645890524"
variation 7664
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1280477276"
variation 7667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645890662"
variation 7668
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1442783041"
variation 7674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197921213"
variation 7675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:986114472"
variation 7677
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645890878"
variation 7679
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645890925"
variation 7680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260563689"
variation 7686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891060"
variation 7695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891097"
variation 7701
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645891142"
variation 7703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1489008222"
variation 7704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763601554"
variation 7705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:766939124"
variation 7707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1477336117"
variation 7711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645891407"
variation 7713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1178959666"
variation 7714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1255242825"
variation 7717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891545"
variation 7718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023183515"
variation 7720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1189238389"
variation 7731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645891676"
variation 7736
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891738"
variation 7739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1296624955"
variation 7740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645891932"
variation 7741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:970729207"
variation 7743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:978931276"
variation 7747
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:185476341"
variation 7749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645892133"
variation 7751
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645892172"
variation 7754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645892214"
variation 7755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:956112691"
variation 7756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1477240493"
variation 7757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:759023126"
variation 7763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645892407"
variation 7764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1302643848"
variation 7774
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645892494"
variation 7776..7780
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aatga"
/db_xref="dbSNP:2148729521"
variation 7777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645892547"
variation 7778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:911887757"
variation 7779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:898025322"
variation 7782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:72661620"
variation 7783
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049380833"
variation 7787..7789
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gga"
/replace="ggagga"
/db_xref="dbSNP:1645892854"
variation 7787..7788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:764616411"
variation 7788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1239124372"
variation 7792..7793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645892937"
variation 7796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1283570239"
variation 7798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039451250"
variation 7802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:921842803"
variation 7803
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645893134"
variation 7805
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1355436608"
variation 7806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:527401943"
variation 7809
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1467667265"
variation 7810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645893334"
variation 7813..7815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:71573710"
variation 7821..7823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1201704138"
variation 7823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645893459"
variation 7830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1048906465"
variation 7835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1299064106"
variation 7838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1247766098"
variation 7839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:549014350"
variation 7841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1157249630"
variation 7843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:752455063"
variation 7848
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645893821"
variation 7852
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1394491176"
variation 7859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:888029350"
variation 7860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:141708021"
variation 7871..7877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggag"
/replace="ggaggag"
/db_xref="dbSNP:1330261261"
variation 7874
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:896232710"
variation 7876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571387090"
variation 7884
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645894291"
variation 7888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571387095"
variation 7888
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645894397"
variation 7894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645894441"
variation 7898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1388570987"
variation 7899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645894524"
variation 7903
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011886579"
variation 7904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1325493005"
variation 7911
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1033313595"
variation 7912
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1218020464"
variation 7918
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1023742547"
variation 7920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:906099748"
variation 7923
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:896245769"
variation 7926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645895127"
variation 7927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1013363402"
variation 7930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645895229"
variation 7931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1353691617"
variation 7933
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000435153"
variation 7934
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:529304195"
variation 7935
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542691451"
variation 7937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645895540"
variation 7940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645895647"
variation 7940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:988939718"
variation 7944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:979226030"
variation 7945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1018993608"
variation 7949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645895806"
variation 7951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645895843"
variation 7953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1183272091"
variation 7958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1032227537"
variation 7959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:11800878"
variation 7962
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:367583172"
variation 7963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753609764"
variation 7964
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465046339"
variation 7966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645896209"
variation 7968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1329223357"
variation 7971..7973
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1645896334"
variation 7971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645896294"
variation 7981
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645896399"
variation 7982
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1378916834"
variation 7983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:190765482"
variation 7985..7988
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1645896590"
variation 7985
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1311690893"
variation 7986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:984738697"
variation 7988
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148729640"
variation 7994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:944691489"
variation 8003
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729643"
variation 8004..8006
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aga"
/db_xref="dbSNP:1256497507"
variation 8004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1487758792"
variation 8005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148729650"
variation 8008
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645897182"
variation 8010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729652"
variation 8017
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645897231"
variation 8018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:976189008"
variation 8020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645897326"
variation 8025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1190800512"
variation 8028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:115528846"
variation 8029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197366841"
variation 8031
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1260527645"
variation 8036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:551808585"
variation 8037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1200272100"
variation 8039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645897780"
variation 8042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645897836"
variation 8045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645897877"
variation 8048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645897924"
variation 8051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645897970"
variation 8053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1254452984"
variation 8055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1425796858"
variation 8056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778783444"
variation 8067..8071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aca"
/replace="acaca"
/db_xref="dbSNP:1423093406"
variation 8068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645898281"
variation 8069
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:940472965"
variation 8073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1476877414"
variation 8074
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645898453"
variation 8076
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049227178"
variation 8077
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1402407879"
variation 8084
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:909460062"
variation 8085..8086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1557630020"
variation 8085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1302059480"
variation 8086
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1571387308"
variation 8087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645898841"
variation 8088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645898886"
variation 8091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:147293577"
variation 8092..8094
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:1397482627"
variation 8092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645898996"
variation 8098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645899069"
variation 8100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645899120"
variation 8101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645899171"
variation 8102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:938255812"
variation 8107
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:11263838"
variation 8109
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645899415"
variation 8110
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645899471"
variation 8111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1216218597"
variation 8114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645899572"
variation 8115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:663163"
variation 8116..8117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ttata"
/db_xref="dbSNP:1645899747"
variation 8117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645899797"
variation 8120..8122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1645899845"
variation 8122..8123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tt"
/db_xref="dbSNP:1013199093"
variation 8125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1042160042"
variation 8131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645900020"
variation 8137..8139
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1645900073"
variation 8137..8138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:796743131"
variation 8142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557630078"
variation 8147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900249"
variation 8149
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1044725499"
variation 8150
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645900359"
variation 8152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:902232968"
variation 8153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557630092"
variation 8163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645900525"
variation 8167..8171
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1645900560"
variation 8169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376232788"
variation 8170..8181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagagaa"
/replace="aagagaagagaa"
/db_xref="dbSNP:1424350327"
variation 8173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900712"
variation 8174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000663554"
variation 8179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900811"
variation 8185
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1032148243"
variation 8186..8187
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gt"
/db_xref="dbSNP:1645900894"
variation 8188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645900937"
variation 8189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729767"
variation 8190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:34764544"
variation 8191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148729770"
variation 8192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:903552001"
variation 8194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1000404100"
variation 8197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313153284"
variation 8203..8205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aaa"
/db_xref="dbSNP:1006832383"
variation 8210
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:781125965"
variation 8214
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645901266"
variation 8220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397696222"
variation 8221
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:748441732"
variation 8222..8226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:966105029"
variation 8222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:892052895"
variation 8227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645901541"
variation 8233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1342494143"
variation 8241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1314362355"
variation 8244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645901702"
variation 8248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:919342755"
variation 8249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645901799"
variation 8256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645901848"
variation 8263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1010329201"
variation 8266..8268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1557630174"
variation 8268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1215065727"
variation 8269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:769882762"
variation 8271
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571387463"
variation 8272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:574185625"
variation 8273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1264075715"
variation 8283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:975260157"
variation 8285..8291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttgttt"
/db_xref="dbSNP:1645902274"
variation 8288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:538411096"
variation 8291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:773731413"
variation 8292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951987747"
variation 8293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729816"
variation 8294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645902459"
variation 8295
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1280795884"
variation 8296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729822"
variation 8300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645902565"
variation 8301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148729825"
variation 8306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1265144990"
variation 8307..8326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtaggagaagaaatcagagt"
/replace="gtaggagaagaaatcagagtgtaggagaagaaatcagagt"
/db_xref="dbSNP:1553157891"
variation 8311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645902976"
variation 8319
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487736618"
variation 8322
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645903083"
variation 8323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:749626639"
variation 8325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1417491401"
variation 8325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:938167185"
variation 8326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645903330"
variation 8327..8334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agaag"
/replace="agaagaag"
/db_xref="dbSNP:1160082662"
variation 8327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645903375"
variation 8333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1345332379"
variation 8336
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645903513"
variation 8338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1214054853"
variation 8346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645903616"
variation 8350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:907765237"
variation 8354..8360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaca"
/replace="aacaaca"
/db_xref="dbSNP:1456950828"
variation 8355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645903841"
variation 8358
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645903885"
variation 8359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645903931"
variation 8362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148729859"
variation 8365..8366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aa"
/db_xref="dbSNP:371771654"
variation 8368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571387555"
variation 8369
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645904086"
variation 8372..8377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agag"
/replace="agagag"
/db_xref="dbSNP:1645904193"
variation 8372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645904133"
variation 8374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:556310027"
variation 8382..8383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1264683629"
variation 8383..8385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:2148729868"
variation 8383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645904356"
variation 8385..8393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttttt"
/replace="ttttttttt"
/replace="tttttttttt"
/db_xref="dbSNP:557690955"
variation 8388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:577932548"
variation 8389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645904533"
variation 8391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187611390"
variation 8392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1267197074"
variation 8393..8395
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1491398912"
variation 8393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645904691"
variation 8394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:375747906"
variation 8394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431961690"
variation 8395..8401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgtgt"
/replace="tgtgtgt"
/db_xref="dbSNP:949060752"
variation 8396
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:771565242"
variation 8397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645905040"
variation 8398
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1396098897"
variation 8400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1419295127"
variation 8401..8410
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="ttttaccttt"
/db_xref="dbSNP:1645905198"
variation 8405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645905238"
variation 8407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1042002877"
variation 8413
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645905349"
variation 8414
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1286980669"
variation 8415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1321236834"
variation 8419
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645905480"
variation 8427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645905516"
variation 8429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1219505196"
variation 8430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571387653"
variation 8432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1267249623"
variation 8434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:369684987"
variation 8439
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645905767"
variation 8440..8443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1194112655"
variation 8443..8445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tat"
/db_xref="dbSNP:1237414549"
variation 8443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645905861"
variation 8446..8457
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gacttacttacg"
/db_xref="dbSNP:1645905983"
variation 8447..8456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="acttac"
/replace="acttacttac"
/db_xref="dbSNP:750086957"
variation 8447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645906029"
variation 8450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:917773706"
variation 8451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645906224"
variation 8451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645906185"
variation 8455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1362524771"
variation 8456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645906455"
variation 8456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:61555210"
variation 8457
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293016194"
variation 8458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774945280"
variation 8468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1045258462"
variation 8477
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1351045545"
variation 8481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645906718"
variation 8482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571387722"
variation 8483
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:565480687"
variation 8484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:182177708"
variation 8488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331242413"
variation 8495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645906985"
variation 8497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:572003492"
variation 8502
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1398619650"
variation 8505..8508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:754918941"
variation 8507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1280462375"
variation 8511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:936305098"
variation 8514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1226766659"
variation 8516
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1052060548"
variation 8524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1352780824"
variation 8528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:892022079"
variation 8529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314948396"
variation 8532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:542039100"
variation 8534..8539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cac"
/replace="caccac"
/db_xref="dbSNP:1645907567"
variation 8535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645907624"
variation 8536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645907679"
variation 8541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645907731"
variation 8542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571387811"
variation 8548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1040534105"
variation 8551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902042514"
variation 8554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645907910"
variation 8562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645907960"
variation 8564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908010"
variation 8566
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571387839"
variation 8570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645908075"
variation 8572..8577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aataaa"
/db_xref="dbSNP:1317146102"
variation 8575..8583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaac"
/replace="aaacaaaac"
/db_xref="dbSNP:997523767"
variation 8579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:767123720"
variation 8582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571387863"
variation 8587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571387867"
variation 8592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645908405"
variation 8594..8601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tcctagcc"
/db_xref="dbSNP:1645908448"
variation 8600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908497"
variation 8603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aatatta"
/db_xref="dbSNP:1645908602"
variation 8603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1029459149"
variation 8609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571387884"
variation 8610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:774834541"
variation 8619
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908777"
variation 8620..8621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645908887"
variation 8620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645908816"
variation 8621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233198421"
variation 8622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645908978"
variation 8623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645909028"
variation 8625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730012"
variation 8630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909071"
variation 8636..8641
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tag"
/replace="tagtag"
/db_xref="dbSNP:1645909107"
variation 8640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909150"
variation 8648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:762839218"
variation 8649..8657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tattt"
/replace="tatttattt"
/db_xref="dbSNP:1179746891"
variation 8650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909344"
variation 8654..8655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="at"
/replace="ataat"
/db_xref="dbSNP:1263195438"
variation 8659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645909441"
variation 8660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1475235403"
variation 8661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645909532"
variation 8662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909578"
variation 8663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645909620"
variation 8665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006202972"
variation 8668..8674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tctt"
/replace="tcttctt"
/db_xref="dbSNP:1170643933"
variation 8672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645909760"
variation 8673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571387944"
variation 8676
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1422145745"
variation 8683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:375451995"
variation 8688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645909930"
variation 8702
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1014957927"
variation 8705..8709
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tat"
/replace="tatat"
/db_xref="dbSNP:909283444"
variation 8706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:961944436"
variation 8711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1196097951"
variation 8712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645910202"
variation 8712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645910166"
variation 8715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645910251"
variation 8718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253996075"
variation 8720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:992521972"
variation 8721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645910417"
variation 8727
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645910458"
variation 8728
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645910515"
variation 8730
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:991359427"
variation 8731..8732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ag"
/db_xref="dbSNP:1645910622"
variation 8733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:917757843"
variation 8734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:969590169"
variation 8736
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1218063131"
variation 8739
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1439531364"
variation 8744
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645911357"
variation 8748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557630522"
variation 8749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:980636381"
variation 8750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1316018304"
variation 8754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645911565"
variation 8755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:925003738"
variation 8758
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645911655"
variation 8759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1176998308"
variation 8764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645911744"
variation 8765
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:936440744"
variation 8766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645911840"
variation 8771
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645911885"
variation 8774
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1216184695"
variation 8782..8783
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1645911975"
variation 8784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1273527169"
variation 8785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645912066"
variation 8786
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645912107"
variation 8788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645912153"
variation 8792
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1441615560"
variation 8793..8796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:1207643714"
variation 8794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:918185284"
variation 8795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1485770805"
variation 8801
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1192327329"
variation 8804
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:949611226"
variation 8808
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1479091509"
variation 8809
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:977746888"
variation 8810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645912933"
variation 8811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1168993980"
variation 8815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1401515206"
variation 8820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645913138"
variation 8821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571388106"
variation 8823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645913242"
variation 8829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:923632669"
variation 8832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1178558224"
variation 8836
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645913385"
variation 8841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:185191307"
variation 8842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1348252754"
variation 8847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645913563"
variation 8850
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645913592"
variation 8855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1459362590"
variation 8863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:913598862"
variation 8867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1296441105"
variation 8870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1255355390"
variation 8872
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1053574204"
variation 8881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645914337"
variation 8889..8890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tacatta"
/db_xref="dbSNP:1645914441"
variation 8889
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645914395"
variation 8890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:946293747"
variation 8891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cattatc"
/db_xref="dbSNP:1645914549"
variation 8893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645914597"
variation 8897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730137"
variation 8900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645914643"
variation 8901
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571388164"
variation 8905
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1344082505"
variation 8907
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1041064870"
variation 8908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645914949"
variation 8916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148730146"
variation 8917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:902102576"
variation 8922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1348171002"
variation 8925
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1041242279"
variation 8930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260498192"
variation 8936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645915204"
variation 8940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1488977942"
variation 8942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:996721403"
variation 8944
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1246608446"
variation 8950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645915401"
variation 8956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1050633707"
variation 8960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645915497"
variation 8961..8967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tggt"
/replace="tggtggt"
/db_xref="dbSNP:1645915544"
variation 8963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:372984594"
variation 8966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1193311041"
variation 8967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1311204694"
variation 8971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645915762"
variation 8976
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557630747"
variation 8978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571388234"
variation 8981
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:760427087"
variation 8989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1025546631"
variation 8992
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1419395934"
variation 8994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:561018703"
variation 9001..9002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645916191"
variation 9003
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1362587577"
variation 9011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645916291"
variation 9013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645916333"
variation 9019..9029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttgttatttct"
/db_xref="dbSNP:886475700"
variation 9023
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763687211"
variation 9025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1016353899"
variation 9030
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:531279755"
variation 9042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:959688040"
variation 9051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645916654"
variation 9052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645916697"
variation 9061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645916781"
variation 9067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:962078524"
variation 9068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:868779519"
variation 9070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917001"
variation 9072
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571388284"
variation 9073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1239056012"
variation 9075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645917148"
variation 9076
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917198"
variation 9078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025076280"
variation 9080
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1287091044"
variation 9087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917377"
variation 9088
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917438"
variation 9092
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645917492"
variation 9093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645917535"
variation 9099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1323048375"
variation 9100
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917625"
variation 9102
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917669"
variation 9106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645917718"
variation 9110
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645917769"
variation 9113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645917834"
variation 9114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1013592131"
variation 9117
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025276256"
variation 9120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645918010"
variation 9122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645918050"
variation 9124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1645918116"
variation 9126..9132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttcctct"
/db_xref="dbSNP:1645918165"
variation 9131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:969343335"
variation 9132..9147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tg"
/replace="tggaggccaagtgttg"
/db_xref="dbSNP:531097561"
variation 9134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645918352"
variation 9141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1288469844"
variation 9147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1457711634"
variation 9152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:924187437"
variation 9153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:936380126"
variation 9155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645918640"
variation 9157
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1439445401"
variation 9158
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:980987145"
variation 9163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:188289018"
variation 9164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645918843"
variation 9165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645918909"
variation 9167
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1470605990"
variation 9172
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:375321641"
variation 9180..9182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1234983001"
variation 9182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645919134"
variation 9183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645919188"
variation 9184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1403601243"
variation 9189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1327825640"
variation 9190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:910981528"
variation 9191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645919439"
variation 9192..9203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agccagccagcc"
/replace="agccagccagccagcc"
/db_xref="dbSNP:1181550295"
variation 9193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1411707007"
variation 9195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557630912"
variation 9198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:957770044"
variation 9200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645919705"
variation 9202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:942413140"
variation 9204
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1337188989"
variation 9206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1040900849"
variation 9209..9214
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctt"
/replace="cttctt"
/db_xref="dbSNP:1645919966"
variation 9211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1283098745"
variation 9212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645920093"
variation 9216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730297"
variation 9217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1353624234"
variation 9222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1476268804"
variation 9226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:901028900"
variation 9230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1457678064"
variation 9240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645920365"
variation 9242
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1197180703"
variation 9250..9254
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ga"
/replace="gaaga"
/replace="gaagaaga"
/db_xref="dbSNP:140864"
variation 9250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645920503"
variation 9251..9252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:34307163"
variation 9252..9255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:35814364"
variation 9252..9253
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="ga"
/db_xref="dbSNP:869263455"
variation 9252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:201441860"
variation 9256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:550020187"
variation 9258
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1438623533"
variation 9259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1047055048"
variation 9260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:888328294"
variation 9268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645921198"
variation 9269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730337"
variation 9273
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1006231276"
variation 9281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645921275"
variation 9283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645921336"
variation 9286
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:181116037"
variation 9288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645921436"
variation 9290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1167074194"
variation 9291
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333074315"
variation 9293..9294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645921609"
variation 9294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645921660"
variation 9295
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1016651001"
variation 9296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645921779"
variation 9298..9300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="ata"
/db_xref="dbSNP:555724154"
variation 9298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:756987293"
variation 9299
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645921958"
variation 9304
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571388519"
variation 9306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557631025"
variation 9310
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1012769642"
variation 9311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730355"
variation 9312..9313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:2148730356"
variation 9313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987884081"
variation 9314
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1391670109"
variation 9320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:550717064"
variation 9321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025002346"
variation 9327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333064396"
variation 9328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730365"
variation 9329..9334
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaagaa"
/db_xref="dbSNP:1645922504"
variation 9329
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:970904019"
variation 9331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730371"
variation 9332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1338243940"
variation 9337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148730372"
variation 9338..9342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agcag"
/db_xref="dbSNP:978227204"
variation 9340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645922642"
variation 9342..9346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1557631060"
variation 9343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645922737"
variation 9345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:115162190"
variation 9346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557631064"
variation 9347..9348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1557631076"
variation 9347
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1557631071"
variation 9349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645922998"
variation 9350..9359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aggagga"
/replace="aggaggagga"
/db_xref="dbSNP:1645923047"
variation 9357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1317848508"
variation 9358
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645923174"
variation 9360
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:958496568"
variation 9362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1253510461"
variation 9364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:943662728"
variation 9365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:547713014"
variation 9366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233292745"
variation 9373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923581"
variation 9376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923620"
variation 9377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645923674"
variation 9379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:976459592"
variation 9380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645923769"
variation 9381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923803"
variation 9382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1188783541"
variation 9388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923894"
variation 9389
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:369522490"
variation 9394
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645923987"
variation 9399
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:923494918"
variation 9400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1477460562"
variation 9401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1317790452"
variation 9404..9405
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tg"
/db_xref="dbSNP:1645924240"
variation 9404
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645924190"
variation 9406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:369678188"
variation 9408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645924382"
variation 9408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645924334"
variation 9409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:750425416"
variation 9411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:932276397"
variation 9415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1399655616"
variation 9421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645924654"
variation 9421
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645924616"
variation 9423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:910853352"
variation 9428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730433"
variation 9429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:536927360"
variation 9431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:566794455"
variation 9434..9435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="aa"
/db_xref="dbSNP:1645924872"
variation 9435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645924925"
variation 9442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645924976"
variation 9443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339261076"
variation 9445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1209679291"
variation 9446..9452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aagttaa"
/db_xref="dbSNP:1645925240"
variation 9446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:942092258"
variation 9450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645925297"
variation 9451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645925351"
variation 9455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1233011649"
variation 9456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645925450"
variation 9461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1235883822"
variation 9465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557631171"
variation 9468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1254587948"
variation 9469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:963726070"
variation 9470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645925755"
variation 9471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1211791579"
variation 9473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645925844"
variation 9474
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645925905"
variation 9477
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:976524051"
variation 9478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1285469149"
variation 9480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645926152"
variation 9481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487344556"
variation 9484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:922346450"
variation 9487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:929800092"
variation 9490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:527669622"
variation 9491
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:549237039"
variation 9493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197914771"
variation 9495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730478"
variation 9498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1392976578"
variation 9500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1436265888"
variation 9512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1173872939"
variation 9513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1359389680"
variation 9519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1450967468"
variation 9520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1290064103"
variation 9521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:781379128"
variation 9522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:909814849"
variation 9524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299657367"
variation 9526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1373626613"
variation 9531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645927187"
variation 9534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:185858553"
variation 9550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1055697473"
variation 9552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:72661621"
variation 9553..9562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tccttc"
/replace="tccttccttc"
/db_xref="dbSNP:1218081256"
variation 9553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645927931"
variation 9554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1261319218"
variation 9556
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557631281"
variation 9559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:905089140"
variation 9563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645928288"
variation 9565
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1476784105"
variation 9567
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645928392"
variation 9568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1209153186"
variation 9569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1002154199"
variation 9573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1250980066"
variation 9575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148730511"
variation 9592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730512"
variation 9599
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571388910"
variation 9610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645928633"
variation 9614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645928670"
variation 9616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645928707"
variation 9620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1169625706"
variation 9621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557631302"
variation 9625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645928858"
variation 9626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645928897"
variation 9627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:755404281"
variation 9630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1379326027"
variation 9633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:566124661"
variation 9639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:906587405"
variation 9640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645929464"
variation 9644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:957905671"
variation 9645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:987936386"
variation 9648..9652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tct"
/replace="tctct"
/db_xref="dbSNP:1324462378"
variation 9649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645929665"
variation 9652
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397188131"
variation 9653
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645929760"
variation 9655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1442134509"
variation 9657
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308942244"
variation 9659..9670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agcagaccccag"
/db_xref="dbSNP:1645929927"
variation 9661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571388998"
variation 9665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1020633272"
variation 9666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645930068"
variation 9667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:537918276"
variation 9668
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1011597209"
variation 9670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645930333"
variation 9672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:976807461"
variation 9674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415042054"
variation 9678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:556344781"
variation 9680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645930529"
variation 9681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645930579"
variation 9683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645930630"
variation 9685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645930675"
variation 9696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645930721"
variation 9703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:920968850"
variation 9704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:571457484"
variation 9705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1237268495"
variation 9707..9710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1479460493"
variation 9712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1178560312"
variation 9715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645931081"
variation 9717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1408159161"
variation 9719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1422693027"
variation 9721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:778071525"
variation 9728
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:538991257"
variation 9731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645931359"
variation 9733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1420696197"
variation 9740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1462365726"
variation 9741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1337824283"
variation 9743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:976378557"
variation 9749..9751
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1353108129"
variation 9750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645931650"
variation 9752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:76228984"
variation 9761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645931822"
variation 9763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730618"
variation 9764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:909469542"
variation 9766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982632384"
variation 9767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932004"
variation 9772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571389116"
variation 9773
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932124"
variation 9774
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413035460"
variation 9776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932222"
variation 9777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:909731645"
variation 9779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645932343"
variation 9782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645932401"
variation 9785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1336859435"
variation 9787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645932525"
variation 9788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:941191309"
variation 9793
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:571976877"
variation 9795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:542631707"
variation 9796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:554236559"
variation 9798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645932802"
variation 9802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1218947869"
variation 9803
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1276981531"
variation 9814
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1206225660"
variation 9815
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:897878642"
variation 9816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:949518256"
variation 9817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:76697094"
variation 9819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1185171901"
variation 9820
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1258936672"
variation 9823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1645933368"
variation 9824
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1475855058"
variation 9825..9826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1170589272"
variation 9826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:2148730672"
variation 9826
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645933797"
variation 9827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1417868148"
variation 9828
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571389218"
variation 9832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:905225551"
variation 9838
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002072883"
variation 9847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487381167"
variation 9849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645934129"
variation 9850
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1171506019"
variation 9851
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645934252"
variation 9853
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645934296"
variation 9854
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:191561832"
variation 9857
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:565124454"
variation 9860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645934495"
variation 9869
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1356152831"
variation 9871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645934617"
variation 9877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1242561591"
variation 9878
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774855156"
variation 9879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1020767569"
variation 9880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645934928"
variation 9892
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1396694608"
variation 9893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:965488511"
variation 9894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:999541063"
variation 9895..9896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ag"
/db_xref="dbSNP:1273371065"
variation 9895
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052452213"
variation 9898
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1208267090"
variation 9900
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645935320"
variation 9901
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1281928751"
variation 9903
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645935416"
variation 9908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:997980288"
variation 9916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645935522"
variation 9924
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:144839878"
variation 9926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645935647"
variation 9932
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:953699800"
variation 9940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777902193"
variation 9947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645935888"
variation 9948
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571389337"
variation 9949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:909436967"
variation 9953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645936024"
variation 9959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730732"
variation 9960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936070"
variation 9963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:746430497"
variation 9965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:972205965"
variation 9967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645936224"
variation 9968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1424826706"
variation 9970
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1433155202"
variation 9974
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645936346"
variation 9975
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936384"
variation 9980
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299430009"
variation 9987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936481"
variation 9992
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:964296465"
variation 9993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645936637"
variation 9993
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:541373139"
variation 9994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:567471178"
variation 9995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1046513851"
variation 9998
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645936800"
variation 10000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645936844"
variation 10001
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:926702492"
variation 10003
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645936923"
variation 10004
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1343372432"
variation 10007
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:937979601"
variation 10009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645937054"
variation 10011
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645937090"
variation 10013..10021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ta"
/replace="tatatcata"
/db_xref="dbSNP:1645937128"
variation 10014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:772438156"
variation 10018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1273415719"
variation 10019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645937280"
variation 10021
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951009828"
variation 10024..10025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645937390"
variation 10025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1369976515"
variation 10026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645937485"
variation 10028..10033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1373713883"
variation 10033
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:183777566"
variation 10038
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1235279035"
variation 10040
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:893706036"
variation 10041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938031"
variation 10044
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:879287028"
variation 10045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645938135"
variation 10046
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645938178"
variation 10048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938223"
variation 10049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571389448"
variation 10050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376685024"
variation 10051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1285655950"
variation 10052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557631682"
variation 10055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1009468975"
variation 10058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:775089595"
variation 10060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645938531"
variation 10061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938581"
variation 10062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1351784476"
variation 10064
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645938762"
variation 10066
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:982558756"
variation 10067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1042607221"
variation 10068
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645938928"
variation 10071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645938968"
variation 10073..10079
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgtt"
/replace="tgttgtt"
/db_xref="dbSNP:1449247484"
variation 10077
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1450922295"
variation 10087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645939126"
variation 10090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1246555874"
variation 10091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645939234"
variation 10093
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1452924763"
variation 10095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:186821250"
variation 10097
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645939409"
variation 10099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:147529833"
variation 10101
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1571389520"
variation 10103
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645939650"
variation 10109
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645939724"
variation 10112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:901047433"
variation 10113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645940116"
variation 10114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645940165"
variation 10115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1016676335"
variation 10116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571389534"
variation 10120..10125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1156913272"
variation 10121
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1454602683"
variation 10126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1041723286"
variation 10129
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1402447345"
variation 10130..10133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1378038090"
variation 10130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:902424416"
variation 10132..10133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1455044342"
variation 10132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1393521931"
variation 10133
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1237809139"
variation 10134..10152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttttttt"
/replace="ttttttttttttt"
/replace="ttttttttttttttt"
/replace="tttttttttttttttt"
/replace="ttttttttttttttttt"
/replace="tttttttttttttttttt"
/replace="ttttttttttttttttttt"
/replace="tttttttttttttttttttt"
/replace="ttttttttttttttttttttt"
/replace="tttttttttttttttttttttt"
/replace="ttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttttttttttt"
/replace="tttttttttttttttttttttttttttttttttttttttttttttttt
ttttttt"
/db_xref="dbSNP:rs56299314"
variation 10134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:998430886"
variation 10135
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1389444371"
variation 10136..10137
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1253963572"
variation 10136
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:991298321"
variation 10137..10138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1645941577"
variation 10137
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645941528"
variation 10138
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645941619"
variation 10139
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1305799231"
variation 10140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1437526799"
variation 10141..10142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1645941836"
variation 10141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1324541265"
variation 10142
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645941887"
variation 10144
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1373639324"
variation 10147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1442010437"
variation 10151..10152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645942085"
variation 10152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:915821854"
variation 10153..10154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1459750847"
variation 10153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1334151702"
variation 10154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645942678"
variation 10155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1645942899"
variation 10155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1241485762"
variation 10156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148730886"
variation 10160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730888"
variation 10162..10170
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ataata"
/replace="ataataata"
/db_xref="dbSNP:1390527072"
variation 10171
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1326405001"
variation 10173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148730897"
variation 10178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571389709"
variation 10179
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571389716"
variation 10181
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730909"
variation 10184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:192178564"
variation 10189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:76010229"
variation 10190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1292086954"
variation 10192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148730920"
variation 10197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645943470"
variation 10198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333357254"
variation 10200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:368787742"
variation 10201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645943653"
variation 10204
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1274276173"
variation 10205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1339109894"
variation 10211
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274900715"
variation 10215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:571547232"
variation 10218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645943980"
variation 10224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571389776"
variation 10226
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438572134"
variation 10231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557631973"
variation 10233..10237
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tc"
/replace="tcctc"
/db_xref="dbSNP:1645944220"
variation 10233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468870902"
variation 10234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:927991002"
variation 10235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944341"
variation 10238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645944393"
variation 10241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645944429"
variation 10243..10247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aga"
/replace="agaga"
/db_xref="dbSNP:2148730948"
variation 10246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1197725041"
variation 10248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148730952"
variation 10250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571389812"
variation 10251
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:953944035"
variation 10256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1236172183"
variation 10257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645944711"
variation 10258..10261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:935320290"
variation 10260
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944817"
variation 10261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944852"
variation 10265
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645944915"
variation 10266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005197104"
variation 10267
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1418357887"
variation 10270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645945036"
variation 10276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052981048"
variation 10278
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1165885221"
variation 10283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645945167"
variation 10285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:893885209"
variation 10289
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:538830586"
variation 10292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:554046305"
variation 10295..10299
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aatga"
/db_xref="dbSNP:1039846959"
variation 10297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1417210514"
variation 10300..10306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gag"
/replace="gagtgag"
/db_xref="dbSNP:1166468590"
variation 10300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645945523"
variation 10309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1397247151"
variation 10311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1016631003"
variation 10316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:79355955"
variation 10321
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:374567306"
variation 10323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:998463302"
variation 10324..10332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtttg"
/replace="gtttgtttg"
/db_xref="dbSNP:1645945883"
variation 10326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1253380792"
variation 10327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645945999"
variation 10328
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:972340698"
variation 10337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1210421637"
variation 10338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278367992"
variation 10342..10346
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aagta"
/db_xref="dbSNP:1645946188"
variation 10343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1486676421"
variation 10350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148730998"
variation 10355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1029907759"
variation 10356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1256800555"
variation 10359..10362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tttt"
/db_xref="dbSNP:1427805956"
variation 10364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1190759460"
variation 10366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331051161"
variation 10370
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:886809352"
variation 10371..10373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:2148731008"
variation 10372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1449770932"
variation 10375
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645946697"
variation 10376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571389968"
variation 10382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1172599437"
variation 10383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537611630"
variation 10385
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1393337895"
variation 10388
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1017098420"
variation 10390
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1329859133"
variation 10391
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:962457507"
variation 10401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1298262217"
variation 10402
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645947152"
variation 10406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:970880807"
variation 10407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:796216640"
variation 10410
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:991745125"
variation 10411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1022772857"
variation 10416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:926698779"
variation 10417
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1211717696"
variation 10420
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:765055734"
variation 10424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645947544"
variation 10425
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231469789"
variation 10429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645947772"
variation 10432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:938122072"
variation 10434
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645947863"
variation 10435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645947901"
variation 10436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:536504767"
variation 10441
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645948019"
variation 10442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645948072"
variation 10445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1263636608"
variation 10449
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:750161490"
variation 10451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645948761"
variation 10455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645948795"
variation 10456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1192727380"
variation 10458
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645948898"
variation 10460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1557632206"
variation 10463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645948999"
variation 10469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645949043"
variation 10470..10476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aagaaaa"
/db_xref="dbSNP:1392914826"
variation 10470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645949105"
variation 10477
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645949205"
variation 10478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:981350706"
variation 10479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1455253259"
variation 10480..10488
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tcat"
/replace="tcatttcat"
/db_xref="dbSNP:924520841"
variation 10484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:915277531"
variation 10486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645949519"
variation 10487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1452338087"
variation 10489
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645949661"
variation 10490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217983159"
variation 10495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1291110926"
variation 10498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645949803"
variation 10500
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:536507609"
variation 10503
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1389902328"
variation 10504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440655487"
variation 10507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645949979"
variation 10508
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:555810167"
variation 10513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042270233"
variation 10521
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645950154"
variation 10523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:901095268"
variation 10528..10533
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttaatt"
/db_xref="dbSNP:1306471992"
variation 10529
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:998002982"
variation 10539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:554734378"
variation 10541
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645950403"
variation 10542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1262448321"
variation 10543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:889519470"
variation 10546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645950528"
variation 10548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:761407670"
variation 10550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1005332944"
variation 10551
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645950670"
variation 10552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465261319"
variation 10553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:574671804"
variation 10558
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645950821"
variation 10562..10563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ca"
/db_xref="dbSNP:765710979"
variation 10562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:554554773"
variation 10571
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:575943703"
variation 10573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645951006"
variation 10575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:543584812"
variation 10577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1440347734"
variation 10581
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645951162"
variation 10583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249253610"
variation 10586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1416767433"
variation 10588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:946799865"
variation 10589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1040176474"
variation 10590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645951426"
variation 10591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1571390306"
variation 10594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:766182338"
variation 10597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645951578"
variation 10600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645951627"
variation 10606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:994240347"
variation 10610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1026532078"
variation 10611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:564774699"
variation 10612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645951847"
variation 10618
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:934140536"
variation 10619
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:532140374"
variation 10620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645952015"
variation 10621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1397122822"
variation 10624
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:752823385"
variation 10627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645952175"
variation 10633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1475802643"
variation 10636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769579976"
variation 10638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1051385703"
variation 10642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1387279727"
variation 10643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:887318250"
variation 10645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:577137923"
variation 10651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148731147"
variation 10653
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645952594"
variation 10655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571390376"
variation 10656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645952695"
variation 10658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645952755"
variation 10662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571390379"
variation 10670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1329790878"
variation 10671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232591929"
variation 10673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645952994"
variation 10674
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1016571419"
variation 10675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541247710"
variation 10678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1221909151"
variation 10681
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645953212"
variation 10684..10687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1250436182"
variation 10685
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170656511"
variation 10690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645953349"
variation 10693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1012690951"
variation 10696
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731173"
variation 10703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1034292694"
variation 10705
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023122358"
variation 10707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645953543"
variation 10708
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1475198673"
variation 10710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645953620"
variation 10712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:959441747"
variation 10713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645953732"
variation 10717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:971236523"
variation 10725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406344392"
variation 10726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571390465"
variation 10727
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148731193"
variation 10731..10734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:1170144354"
variation 10731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:756201441"
variation 10732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571390483"
variation 10733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645954035"
variation 10736
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1463669362"
variation 10740
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308776284"
variation 10741
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645954194"
variation 10742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645954239"
variation 10746
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:797000"
variation 10748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1413202362"
variation 10749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1314800058"
variation 10752
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1356235775"
variation 10753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645954749"
variation 10753
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1291336086"
variation 10754
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1399312246"
variation 10757
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1381191391"
variation 10760
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645954902"
variation 10762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293434777"
variation 10766
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645955000"
variation 10782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645955058"
variation 10784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1271937511"
variation 10791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1305415314"
variation 10796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645955199"
variation 10797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:149973488"
variation 10798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645955307"
variation 10800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1274815717"
variation 10806
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978512280"
variation 10810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1485047376"
variation 10814..10819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atc"
/replace="atcatc"
/db_xref="dbSNP:988567911"
variation 10816..10823
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="catc"
/replace="catccatc"
/db_xref="dbSNP:1645955559"
variation 10817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645955621"
variation 10818
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645955670"
variation 10821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260272129"
variation 10827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148731236"
variation 10828
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1473376114"
variation 10831..10832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gc"
/db_xref="dbSNP:1645955865"
variation 10833..10840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tta"
/replace="ttagatta"
/db_xref="dbSNP:915270251"
variation 10835
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1417796906"
variation 10843
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731249"
variation 10845
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956028"
variation 10846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645956083"
variation 10849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:922523004"
variation 10859
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:933923210"
variation 10860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049564838"
variation 10863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1255212265"
variation 10868
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571390632"
variation 10871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1345239585"
variation 10876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645956465"
variation 10877
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1374976353"
variation 10879
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645956563"
variation 10881
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645956616"
variation 10885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645956654"
variation 10893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645956696"
variation 10899
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956744"
variation 10902
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1432963371"
variation 10908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557632608"
variation 10910
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956893"
variation 10913
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731274"
variation 10915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645956933"
variation 10916
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645956974"
variation 10919
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:749591113"
variation 10920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645957080"
variation 10927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645957267"
variation 10928
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314784229"
variation 10938
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:541709462"
variation 10941
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645957439"
variation 10942
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645957482"
variation 10943
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360833545"
variation 10946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:889656691"
variation 10947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:975558464"
variation 10949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1269434140"
variation 10950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645957713"
variation 10953
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:941085179"
variation 10955
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645957762"
variation 10956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:370987082"
variation 10960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645957861"
variation 10966
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1557632654"
variation 10967
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:561377490"
variation 10968
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645958029"
variation 10970
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645958078"
variation 10975..10978
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1212627138"
variation 10977
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645958200"
variation 10979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1230227545"
variation 10986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1557632676"
variation 10987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1038086877"
variation 10988
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645958411"
variation 10994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1297912830"
variation 10996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1346659954"
variation 10997
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1231450945"
variation 10999
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:896914475"
variation 11002
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1281771883"
variation 11005..11010
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agag"
/replace="agagag"
/db_xref="dbSNP:1645958717"
variation 11013
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645958777"
variation 11018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1257578153"
variation 11020
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1215700811"
variation 11025
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:531586139"
variation 11026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645958969"
variation 11028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757525458"
variation 11029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1487708249"
variation 11035
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1487039969"
variation 11043
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571390780"
variation 11045
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:72902981"
variation 11048
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1260188111"
variation 11050..11058
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttttatatt"
/db_xref="dbSNP:934150347"
variation 11050..11053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645959570"
variation 11055
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645959687"
variation 11059
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645959736"
variation 11060
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1175609979"
variation 11061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1425938053"
variation 11067
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645959918"
variation 11070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1051230848"
variation 11071
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645960017"
variation 11079
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1317511757"
variation 11085
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:906771930"
variation 11087
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1040157330"
variation 11090
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148731364"
variation 11091
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1437053986"
variation 11095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:940262733"
variation 11098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645960401"
variation 11099
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1171516285"
variation 11104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1231609646"
variation 11108
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645960576"
variation 11110
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:183246331"
variation 11112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148731378"
variation 11113
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1033807276"
variation 11115
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645960749"
variation 11120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645960818"
variation 11122
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645960867"
variation 11124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645960923"
variation 11125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1223766443"
variation 11126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:959493286"
variation 11128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1282794742"
variation 11131
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1331785007"
variation 11135
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:565061414"
variation 11136..11139
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggtg"
/replace="ggtggtg"
/db_xref="dbSNP:1433070917"
variation 11141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645961260"
variation 11145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645961306"
variation 11151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731402"
variation 11152
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1252699110"
variation 11158
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:989617154"
variation 11160
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1324155466"
variation 11161..11163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:35360401"
variation 11164
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1022309525"
variation 11165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1247403885"
variation 11166
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645961677"
variation 11167
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645961719"
variation 11168
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1469669349"
variation 11169
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645961803"
variation 11171
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:966786785"
variation 11173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645961931"
variation 11175
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645961981"
variation 11177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:978102549"
variation 11178
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1458699622"
variation 11180..11192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctcagttgctctc"
/replace="ctcagttgctctcagttgctctc"
/db_xref="dbSNP:932315942"
variation 11182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:772665781"
variation 11183
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645962253"
variation 11186
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1438311565"
variation 11190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645962360"
variation 11193
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331275123"
variation 11195
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645962442"
variation 11196
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731442"
variation 11200
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440877349"
variation 11203
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645962519"
variation 11207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645962556"
variation 11208..11212
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttctt"
/db_xref="dbSNP:1645962608"
variation 11210
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1645962698"
variation 11210
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:933913300"
variation 11215
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1277194365"
variation 11216..11217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ta"
/replace="tata"
/db_xref="dbSNP:1645962827"
variation 11216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1352880263"
variation 11219
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1229529982"
variation 11220
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645962916"
variation 11222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:985818181"
variation 11225
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:780359581"
variation 11228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645963039"
variation 11231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:532437523"
variation 11232
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1333104450"
variation 11233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:941138142"
variation 11235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963237"
variation 11238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:547982368"
variation 11241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963342"
variation 11244
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645963392"
variation 11246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1290902326"
variation 11247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:373686806"
variation 11250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1179771257"
variation 11252
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963572"
variation 11254
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645963634"
variation 11255
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1254058861"
variation 11256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1473570625"
variation 11257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645963769"
variation 11258..11264
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aata"
/replace="aataata"
/db_xref="dbSNP:1645963806"
variation 11259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:929744265"
variation 11262
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1368577431"
variation 11266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645963949"
variation 11267
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964002"
variation 11269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1342960689"
variation 11270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1236022849"
variation 11272
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391071"
variation 11274
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645964181"
variation 11275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955855642"
variation 11276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964273"
variation 11280
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1280679964"
variation 11281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391096"
variation 11283
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011523316"
variation 11285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964460"
variation 11288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645964497"
variation 11292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:566097843"
variation 11296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1351790848"
variation 11298
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645964638"
variation 11300
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964690"
variation 11302
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964746"
variation 11306..11316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgacttactg"
/db_xref="dbSNP:1557632990"
variation 11311..11313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tta"
/db_xref="dbSNP:1411012960"
variation 11313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964884"
variation 11316
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645964938"
variation 11318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557632999"
variation 11323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:968116522"
variation 11325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1262009984"
variation 11326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537000935"
variation 11335..11337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1487119334"
variation 11335
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645965170"
variation 11339
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:548591833"
variation 11340
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:569703352"
variation 11341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645965386"
variation 11344
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:955413619"
variation 11348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645965488"
variation 11351
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645965534"
variation 11352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645965587"
variation 11353
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1001213093"
variation 11354
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1276915536"
variation 11355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:751069758"
variation 11356
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:537024441"
variation 11357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1055271617"
variation 11358
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210193915"
variation 11359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645965962"
variation 11362
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1256753454"
variation 11366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:895417653"
variation 11368..11380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgcactgagtatt"
/replace="tgcactgagtattgcactgagtatt"
/db_xref="dbSNP:1195903376"
variation 11368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1011008122"
variation 11372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:986984923"
variation 11373..11377
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tgagt"
/db_xref="dbSNP:1645966287"
variation 11376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645966332"
variation 11377..11381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tattt"
/db_xref="dbSNP:1645966383"
variation 11381
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1368812370"
variation 11391..11392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:768505111"
variation 11393
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:908733349"
variation 11403
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1022445034"
variation 11406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940169695"
variation 11407..11408
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1429852086"
variation 11407
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645966696"
variation 11412
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645966780"
variation 11413..11418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="atcttt"
/db_xref="dbSNP:1645966820"
variation 11415
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645966871"
variation 11416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645966935"
variation 11423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1038648489"
variation 11426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645967015"
variation 11429..11435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="act"
/replace="acttact"
/db_xref="dbSNP:1439339547"
variation 11430
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:920167348"
variation 11431
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:558557808"
variation 11435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454227670"
variation 11436
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645967251"
variation 11437
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1335354894"
variation 11441
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645967331"
variation 11442..11445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="at"
/replace="atat"
/db_xref="dbSNP:760214668"
variation 11442
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:577028704"
variation 11443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645967498"
variation 11444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645967559"
variation 11448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1292926775"
variation 11450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1233660586"
variation 11452
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645967686"
variation 11454..11456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1645967724"
variation 11455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:747536325"
variation 11459
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:534379333"
variation 11472
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1000050388"
variation 11475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645967961"
variation 11477..11484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttgtt"
/replace="ttgttgtt"
/db_xref="dbSNP:774358868"
variation 11492
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645968060"
variation 11494..11497
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gt"
/replace="gtgt"
/db_xref="dbSNP:1482267019"
variation 11495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:906981995"
variation 11498..11504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctc"
/replace="ctcactc"
/db_xref="dbSNP:1645968230"
variation 11499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002603071"
variation 11502..11505
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:1392008923"
variation 11510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1442744285"
variation 11513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1029659910"
variation 11517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571391359"
variation 11518..11519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1449640571"
variation 11523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645968581"
variation 11524
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172540728"
variation 11528
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645968854"
variation 11530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1375424872"
variation 11531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645968957"
variation 11532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:891663260"
variation 11535
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645969054"
variation 11536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:955516294"
variation 11537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:13374690"
variation 11538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:186500181"
variation 11539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:761501941"
variation 11543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021545390"
variation 11546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1366214165"
variation 11549
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645969491"
variation 11552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:900384495"
variation 11554
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1301418755"
variation 11555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391431"
variation 11557
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645969750"
variation 11558
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645969790"
variation 11562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313994790"
variation 11563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:962637582"
variation 11565
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645969978"
variation 11567
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645970022"
variation 11569
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:973883790"
variation 11573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148731634"
variation 11574
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1256538396"
variation 11575
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1349816459"
variation 11579
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1308492815"
variation 11584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249913556"
variation 11586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:996864302"
variation 11587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645970400"
variation 11589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645970455"
variation 11590
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249649614"
variation 11595
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645970856"
variation 11600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542145695"
variation 11601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645970961"
variation 11612
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645971016"
variation 11613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645971074"
variation 11614
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:563417423"
variation 11615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:773087620"
variation 11619
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645971253"
variation 11625
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:576054752"
variation 11629
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645971355"
variation 11630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645971407"
variation 11633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:543429815"
variation 11634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1215887950"
variation 11637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1176111045"
variation 11638
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1571391522"
variation 11639..11648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaa"
/replace="aaaaaaaaa"
/replace="aaaaaaaaaa"
/replace="aaaaaaaaaaa"
/db_xref="dbSNP:148090796"
variation 11639
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:928413251"
variation 11648..11649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="at"
/db_xref="dbSNP:1571391534"
variation 11648
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:191452426"
variation 11649..11656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttttttt"
/replace="tttttttt"
/replace="ttttttttt"
/db_xref="dbSNP:1015679361"
variation 11649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:182527149"
variation 11650
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645972168"
variation 11651
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1369938681"
variation 11654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:974606597"
variation 11655
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1387455843"
variation 11658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645972514"
variation 11660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645972635"
variation 11661
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645972708"
variation 11666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:145217568"
variation 11667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:565342652"
variation 11668
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645973107"
variation 11672
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:980305904"
variation 11673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1043862956"
variation 11677
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902717828"
variation 11678
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1329582447"
variation 11686
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645973519"
variation 11688
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:999700616"
variation 11689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:928334836"
variation 11690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1419816438"
variation 11694..11699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctct"
/replace="ctctct"
/db_xref="dbSNP:1645974053"
variation 11695
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1164176522"
variation 11706
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1415503827"
variation 11707
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645974332"
variation 11710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1471932731"
variation 11712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:938344896"
variation 11718
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:376645263"
variation 11719
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:188384146"
variation 11720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:548893620"
variation 11724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006870978"
variation 11725
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1299599273"
variation 11728
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731724"
variation 11729
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1297748652"
variation 11731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645975152"
variation 11734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1368752337"
variation 11735
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:947249893"
variation 11742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975310"
variation 11743
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975356"
variation 11748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:192876785"
variation 11752..11756
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="cataa"
/replace="cataattccataattccataa"
/db_xref="dbSNP:1645975465"
variation 11755..11768
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagccac"
/replace="aagccacaagccac"
/db_xref="dbSNP:369200119"
variation 11755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1232464621"
variation 11759
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645975673"
variation 11761
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:996060361"
variation 11762
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975778"
variation 11763
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645975833"
variation 11764
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:962606885"
variation 11768..11790
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctg"
/replace="ctgggcccagcctcttttacctg"
/db_xref="dbSNP:1645975920"
variation 11769
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645975972"
variation 11771
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1323198939"
variation 11772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571391707"
variation 11776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1221838658"
variation 11776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1030240996"
variation 11777
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645976236"
variation 11778
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:891165367"
variation 11779..11782
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:2148731754"
variation 11781
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:570383674"
variation 11783
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645976445"
variation 11784
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1475127738"
variation 11785
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1015678868"
variation 11787
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391747"
variation 11794
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148731770"
variation 11798
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571391757"
variation 11799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1437672957"
variation 11809
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1557633486"
variation 11810
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1424657866"
variation 11821
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1169982834"
variation 11825
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:918514248"
variation 11827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431744049"
variation 11829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="a"
/db_xref="dbSNP:1308645978"
variation 11829
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951256614"
variation 11830..11831
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="agg"
/db_xref="dbSNP:1645977129"
variation 11830
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:981312528"
variation 11832
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645977184"
variation 11834..11837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1645977241"
variation 11837
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1300930716"
variation 11839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645977370"
variation 11842
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645977428"
variation 11846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1381025451"
variation 11849
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:928351968"
variation 11860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645977573"
variation 11861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1228577338"
variation 11861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1645977661"
variation 11862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:753949706"
variation 11864
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:937117617"
variation 11865..11868
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645977831"
variation 11867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645977865"
variation 11871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1339586279"
variation 11874..11876
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tat"
/db_xref="dbSNP:1645977959"
variation 11883
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645978012"
variation 11884..11885
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1645978071"
variation 11893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1229978878"
variation 11894
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481089017"
variation 11896
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391859"
variation 11897
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1485670167"
variation 11904
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645978364"
variation 11905..11908
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1208604089"
variation 11909
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571391875"
variation 11915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645978528"
variation 11917
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1239632219"
variation 11920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645978639"
variation 11922
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645978711"
variation 11928..11931
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1645978750"
variation 11930
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391892"
variation 11934
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645978883"
variation 11935
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645978962"
variation 11937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979016"
variation 11940
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645979058"
variation 11943
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645979099"
variation 11945
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1055378139"
variation 11949
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1187262885"
variation 11950
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:914270513"
variation 11951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:946964831"
variation 11959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979475"
variation 11960..11965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttttt"
/replace="ttttttt"
/db_xref="dbSNP:1476134044"
variation 11960
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645979511"
variation 11969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979626"
variation 11971
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1043914988"
variation 11972..11973
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ta"
/db_xref="dbSNP:1645979734"
variation 11977
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645979785"
variation 11979
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391932"
variation 11980
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645979859"
variation 11981
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571391941"
variation 11984
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645979951"
variation 11986
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645980009"
variation 11988
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645980093"
variation 11991
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:902770990"
variation 11992
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027592148"
variation 11994
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645980281"
variation 12000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:185134170"
variation 12012
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1645980422"
variation 12014
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1173836103"
variation 12018
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360773338"
variation 12022
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:552211427"
variation 12024
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:570414684"
variation 12026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645980706"
variation 12028
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:190068140"
variation 12035
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1172290343"
variation 12036
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:757576530"
variation 12037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645981388"
variation 12041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:938353158"
variation 12047
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1007008303"
variation 12052
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1018285710"
variation 12053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149163525"
variation 12054
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645981704"
variation 12056
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:912995495"
variation 12057
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1310507008"
variation 12061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1356863618"
variation 12065
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645981907"
variation 12070
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1313235178"
variation 12075
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645982028"
variation 12089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:898460552"
variation 12095..12104
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tttctt"
/replace="tttctttctt"
/db_xref="dbSNP:1246563466"
variation 12098
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:193204277"
variation 12106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1042793716"
variation 12108..12134
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agaacaaccagtgtcaccaggtatgag"
/replace="agaacaaccagtgtcaccaggtatgagaacaaccagtgtcaccaggta
tgag"
/db_xref="dbSNP:1339311810"
variation 12112
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1477092800"
variation 12114..12127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="accag"
/replace="accagtgtcaccag"
/db_xref="dbSNP:1213116304"
variation 12116
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1427185544"
variation 12118
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:771887940"
variation 12123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1308271391"
variation 12124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571392090"
variation 12127
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210499147"
variation 12128
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:900361502"
variation 12130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731916"
variation 12132
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645982854"
variation 12135
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645982902"
variation 12138..12141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:1645982951"
variation 12139
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645983009"
variation 12141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1386145677"
variation 12147
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1255478039"
variation 12154
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645983185"
variation 12156
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320837542"
variation 12162
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1330109319"
variation 12174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1433685241"
variation 12176
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1486733663"
variation 12177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1368992746"
variation 12178..12188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atttatt"
/replace="atttatttatt"
/db_xref="dbSNP:1557633790"
variation 12182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645983564"
variation 12189
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1228316139"
variation 12190
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1267078324"
variation 12191
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:867210431"
variation 12192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:535270883"
variation 12198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148731956"
variation 12200..12201
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:2148731957"
variation 12202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:556704991"
variation 12205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1266666866"
variation 12206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:995516199"
variation 12207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:143723018"
variation 12216
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1027816144"
variation 12217
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645984324"
variation 12218
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:184939951"
variation 12224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:564988943"
variation 12230
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645984513"
variation 12231
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1037409376"
variation 12232
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:897137584"
variation 12234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645984671"
variation 12235
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1478352732"
variation 12238..12239
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ca"
/db_xref="dbSNP:1645984799"
variation 12240
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1433687798"
variation 12241
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645984944"
variation 12245
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:958443914"
variation 12246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645985054"
variation 12247
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:991235686"
variation 12248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1409603894"
variation 12248
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1473468758"
variation 12256
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1159541645"
variation 12257
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:996026993"
variation 12261
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:548438182"
variation 12263
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645985441"
variation 12268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:947018571"
variation 12269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1434722116"
variation 12270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571392261"
variation 12275
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1645985663"
variation 12276
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1349919648"
variation 12278..12285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taa"
/replace="taagataa"
/db_xref="dbSNP:755974130"
variation 12281
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:977126034"
variation 12284..12293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aat"
/replace="aatacccaat"
/db_xref="dbSNP:1645985908"
variation 12284
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645985847"
variation 12288
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645985973"
variation 12292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001619664"
variation 12296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:550918434"
variation 12297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645986209"
variation 12299
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645986255"
variation 12306
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="t"
/db_xref="dbSNP:1229399720"
variation 12309
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1283911043"
variation 12313
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11263839"
variation 12317
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051688201"
variation 12320
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:891328088"
variation 12323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645986782"
variation 12326
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:780701723"
variation 12327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645986930"
variation 12329..12331
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1645987003"
variation 12330
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:146481099"
variation 12341
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249536680"
variation 12342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1278385240"
variation 12343
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645987953"
variation 12345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1350343925"
variation 12348
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645988075"
variation 12349
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:968398401"
variation 12355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:559571643"
variation 12359
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645988275"
variation 12361
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:995485036"
variation 12365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1414006163"
variation 12366
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645988661"
variation 12373
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645988724"
variation 12374
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1445175870"
variation 12376
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1305566237"
variation 12382
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1372959969"
variation 12383
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217920228"
variation 12384
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1333997978"
variation 12386
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645989073"
variation 12392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1025669719"
variation 12397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645989207"
variation 12401
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645989264"
variation 12414..12418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tcttt"
/db_xref="dbSNP:1645989313"
variation 12416..12418
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1242470958"
variation 12416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1247378787"
variation 12422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1453640010"
variation 12423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645989501"
variation 12427
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571392461"
variation 12428..12433
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ctt"
/replace="cttctt"
/db_xref="dbSNP:1645989615"
variation 12429
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645989673"
variation 12435
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:921698461"
variation 12443
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1191519402"
variation 12446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:887014334"
variation 12447
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645989900"
variation 12448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645989950"
variation 12450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:533887056"
variation 12451
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:530183670"
variation 12455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1276852075"
variation 12460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1344318585"
variation 12464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645990366"
variation 12469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1002828799"
variation 12470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645990508"
variation 12471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1035927223"
variation 12473..12475
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1396447344"
variation 12473
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:958491341"
variation 12477
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1440503374"
variation 12478
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1454463169"
variation 12479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645990826"
variation 12482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645990904"
variation 12485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157441159"
variation 12490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645991020"
variation 12495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1243379749"
variation 12498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645991123"
variation 12510
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051559876"
variation 12514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1166236015"
variation 12515
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1391478845"
variation 12517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645991327"
variation 12526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:769437079"
variation 12531
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1382205794"
variation 12534
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021299293"
variation 12538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320931704"
variation 12542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400641517"
variation 12543
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645991632"
variation 12546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1390026558"
variation 12548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:940563221"
variation 12550
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:772679199"
variation 12552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645991938"
variation 12563
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645991998"
variation 12564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645992071"
variation 12568
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1301734060"
variation 12570
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:542071503"
variation 12572
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:140969609"
variation 12578
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645992325"
variation 12583
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645992383"
variation 12586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645992429"
variation 12587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645992477"
variation 12588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:924330559"
variation 12589
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1255367362"
variation 12591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1342701448"
variation 12592
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:935573817"
variation 12594
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148732198"
variation 12596
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1279007528"
variation 12600
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:987031222"
variation 12601
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1263511842"
variation 12607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645992926"
variation 12610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:61588338"
variation 12613
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645993120"
variation 12615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645993181"
variation 12616
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:762650705"
variation 12617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:151209493"
variation 12619
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:3185860"
variation 12620
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645993405"
variation 12621
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:617254"
variation 12625..12632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tctattct"
/replace="tctattctattct"
/db_xref="dbSNP:1645993556"
variation 12628
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:546851825"
variation 12632
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1047496021"
variation 12634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645993755"
variation 12641
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:887152481"
variation 12644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645993882"
variation 12646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:528057622"
variation 12649
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1254691093"
variation 12654
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994114"
variation 12658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994175"
variation 12662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1322836145"
variation 12670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468625617"
variation 12671
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:546700653"
variation 12673
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994690"
variation 12675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645994738"
variation 12682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1035797650"
variation 12683
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:2148732262"
variation 12686..12689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:1329329536"
variation 12689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1057016314"
variation 12690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:774166730"
variation 12694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:894411906"
variation 12699
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328197100"
variation 12703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:617673"
variation 12711
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645995262"
variation 12713
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:767517357"
variation 12716
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645995367"
variation 12720
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645995429"
variation 12722..12723
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1571392793"
variation 12722
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1269631761"
variation 12724
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021438273"
variation 12726
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470842580"
variation 12731
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:968427356"
variation 12732..12733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="ct"
/db_xref="dbSNP:1645995834"
variation 12732
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1158659180"
variation 12733
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:538220647"
variation 12734
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645995946"
variation 12742
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:2148732301"
variation 12748
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:998649331"
variation 12749
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1208787348"
variation 12750
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1645996125"
variation 12755
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148732312"
variation 12767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1264651380"
variation 12767
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1645996176"
variation 12768
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645996290"
variation 12771
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645996337"
variation 12772..12776
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ga"
/replace="gagga"
/db_xref="dbSNP:2148732324"
variation 12772
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1435467966"
variation 12774
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1031750925"
variation 12779
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1461411805"
variation 12788
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645996576"
variation 12791
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411815515"
variation 12795
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1471831102"
variation 12796
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161741391"
variation 12797
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1010933207"
variation 12799
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:954369519"
variation 12800
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:535494736"
variation 12802
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645996920"
variation 12803
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1397201950"
variation 12811
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997025"
variation 12816
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1291927465"
variation 12817
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997119"
variation 12819
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:556743507"
variation 12822
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:912794404"
variation 12827
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:568710793"
variation 12828
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328509541"
variation 12838..12839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1645997459"
variation 12839
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1349724926"
variation 12840
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645997560"
variation 12841
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997604"
variation 12846
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645997657"
variation 12847
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:964311587"
variation 12850
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645997748"
variation 12855
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:975565048"
variation 12860
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645997839"
variation 12861..12865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggggg"
/replace="gggggg"
/db_xref="dbSNP:1289970722"
variation 12861
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:920123616"
variation 12862
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:931383205"
variation 12863
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645998053"
variation 12865
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1317214475"
variation 12866
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645998148"
variation 12867
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:921685638"
variation 12870
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263224418"
variation 12871
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645998386"
variation 12873
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645998430"
variation 12877..12887
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aagaagaa"
/replace="aagaagaagaa"
/db_xref="dbSNP:1489191079"
variation 12880
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1047104846"
variation 12887..12893
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aag"
/replace="aagtaag"
/db_xref="dbSNP:953077202"
variation 12887
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1482325926"
variation 12890
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:987319587"
variation 12891
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1645998748"
variation 12906
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:908631026"
variation 12915
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1423500069"
variation 12920
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1645998885"
variation 12924
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645998944"
variation 12926
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1334020336"
variation 12927
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732424"
variation 12932..12937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttgttt"
/db_xref="dbSNP:1425388438"
variation 12932..12936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="ttgtt"
/db_xref="dbSNP:551871231"
variation 12935..12937
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1571393013"
variation 12936
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1645999245"
variation 12939
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1307434820"
variation 12943
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:754003469"
variation 12946
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:911758811"
variation 12947
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:763435450"
variation 12951
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1373764064"
variation 12956
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:894380672"
variation 12958
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:11803162"
variation 12959
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1323075098"
variation 12963
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571393070"
variation 12965
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645999839"
variation 12969
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1195017326"
variation 12977
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:557614640"
variation 12981
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1340744989"
variation 12983
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207879034"
variation 12984
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233865788"
variation 12987
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646000122"
variation 12989
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646000167"
variation 12992
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646000219"
variation 12995
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1483140763"
variation 12996
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:188246113"
variation 13000
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180440137"
variation 13005
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646000397"
variation 13006
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1258548504"
variation 13009
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1646000491"
variation 13019
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646000550"
variation 13026
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1445453595"
variation 13029
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1388370039"
variation 13037
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1427799237"
variation 13039
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646001427"
variation 13040..13041
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1646001486"
variation 13042
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172476848"
variation 13049
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646001597"
variation 13050..13054
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tgt"
/replace="tgtgt"
/db_xref="dbSNP:1465366528"
variation 13050
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1300800227"
variation 13051
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646001729"
variation 13053
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1384613036"
variation 13057
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:765512570"
variation 13061
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1296280568"
variation 13062
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646001941"
variation 13073
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:999103079"
variation 13076
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1031390116"
variation 13078
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1274361357"
variation 13081
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1312064304"
variation 13089
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1048361259"
variation 13095
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:954633333"
variation 13106
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1008543100"
variation 13111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1646002395"
variation 13111
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646002331"
variation 13114
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1258131628"
variation 13120
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:2148732519"
variation 13123
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646002496"
variation 13124
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646002562"
variation 13125
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646002643"
variation 13126
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1461969099"
variation 13130
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646002723"
variation 13140
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646002777"
variation 13141
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:750676879"
variation 13145
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:372215826"
variation 13150..13155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agatag"
/replace="agatagatag"
/db_xref="dbSNP:747128678"
variation 13150
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1246372871"
variation 13151
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646003040"
variation 13153
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:541089374"
variation 13155
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1420464265"
variation 13161..13163
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1458669625"
variation 13165
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1420152307"
variation 13167
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:975699442"
variation 13170..13173
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1646003844"
variation 13174
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:920175823"
variation 13177
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1407985565"
variation 13181..13186
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaa"
/replace="aaaaaa"
/replace="aaaaaaa"
/db_xref="dbSNP:879476871"
variation 13182
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:553296373"
variation 13184
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:983370268"
variation 13188
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1166121037"
variation 13192
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000280959"
variation 13194
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646004353"
variation 13196..13197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1028638611"
variation 13197
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571393323"
variation 13198..13205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/replace="aaaaaaaaa"
/db_xref="dbSNP:537923747"
variation 13198
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:908602603"
variation 13199
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:181064431"
variation 13202
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:542295369"
variation 13205
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:563919064"
variation 13206
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:112898338"
variation 13207
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1480657929"
variation 13208
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646005279"
variation 13209
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249438005"
variation 13222
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1341003490"
variation 13224
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646005638"
variation 13227
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:948637090"
variation 13228
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1409385468"
variation 13233
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042915926"
variation 13234
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1318454112"
variation 13238
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1348773393"
variation 13242..13249
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="atga"
/replace="atgaatga"
/replace="atgaatgaatga"
/db_xref="dbSNP:927327408"
variation 13246
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1346625871"
variation 13250
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:937333611"
variation 13253
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:546552052"
variation 13259
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646006216"
variation 13262..13270
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aata"
/replace="aataaaata"
/db_xref="dbSNP:1646006249"
variation 13265..13268
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1057183876"
variation 13265
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646006294"
variation 13266
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1353187187"
variation 13269
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:895865063"
variation 13271
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1278971952"
variation 13279
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:113322531"
variation 13285
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:751968895"
variation 13290
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1041857755"
variation 13291..13293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1490476437"
variation 13292
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260154197"
variation 13293
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646006975"
variation 13294..13301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tatt"
/replace="tatttatt"
/db_xref="dbSNP:1181268134"
variation 13294
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1409449668"
variation 13296
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:556209808"
variation 13297
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646007200"
variation 13300..13301
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1158810267"
variation 13303
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1412573968"
variation 13305
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646007375"
variation 13311
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890196881"
variation 13315
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1164876514"
variation 13318
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1366804179"
variation 13323
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1000473891"
variation 13324
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646007686"
variation 13325
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646007746"
variation 13327
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:528752687"
variation 13332
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1371743303"
variation 13333
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732668"
variation 13337..13342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ggggg"
/replace="gggggg"
/db_xref="dbSNP:1646007997"
variation 13337
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1337878891"
variation 13338
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646008067"
variation 13342
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1017276949"
variation 13345
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646008138"
variation 13349..13355
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agta"
/replace="agtagta"
/db_xref="dbSNP:1571393515"
variation 13350
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="g"
/db_xref="dbSNP:1646008232"
variation 13352
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646008319"
variation 13354..13364
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="taaataa"
/replace="taaataaataa"
/db_xref="dbSNP:1463701048"
variation 13357
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283853555"
variation 13365
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1354426697"
variation 13367
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008521"
variation 13368
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646008564"
variation 13372
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008605"
variation 13378
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008643"
variation 13379
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1029234276"
variation 13380
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646008780"
variation 13390
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360124812"
variation 13392
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1204324335"
variation 13397
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:755507279"
variation 13400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:994515114"
variation 13400
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1248268375"
variation 13406
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1646009159"
variation 13409
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646009214"
variation 13411
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1439377406"
variation 13416
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646009303"
variation 13422
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1027212716"
variation 13423
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:150294351"
variation 13424
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1646009423"
variation 13426
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732720"
variation 13428
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1375077345"
variation 13432
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646009514"
variation 13440
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1471600869"
variation 13444
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571393572"
variation 13445
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1184975862"
variation 13446
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:137937874"
variation 13448
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646009749"
variation 13450
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1018716062"
variation 13454
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:747667827"
variation 13455
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1557634949"
variation 13456
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:972327090"
variation 13457
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:755634987"
variation 13458..13460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="ttt"
/db_xref="dbSNP:1333857852"
variation 13460
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:992913212"
variation 13461
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1027513323"
variation 13463
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:866611493"
variation 13464
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:915999164"
variation 13465
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1571393625"
variation 13466
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1315881943"
variation 13467
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:948694188"
variation 13468
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951959518"
variation 13469
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1646010429"
variation 13470
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:369177016"
variation 13471
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1249546128"
variation 13472..13479
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/replace="aaaaaaaaa"
/db_xref="dbSNP:926539078"
variation 13476
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1646010659"
variation 13480
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646010719"
variation 13481
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:978750367"
variation 13482
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1277644378"
variation 13484
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646010976"
variation 13485..13493
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggggtaggg"
/db_xref="dbSNP:1459736713"
variation 13485
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:757440604"
variation 13486
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646011106"
variation 13487
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646011168"
variation 13490
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:937345012"
variation 13495
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646011287"
variation 13498
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646011345"
variation 13499
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:2148732793"
variation 13500..13518
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gggagggtggagaagagag"
/replace="gggagggtggagaagagagggagggtggagaagagag"
/db_xref="dbSNP:1646011402"
variation 13504
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646011442"
variation 13506
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:992754289"
variation 13507
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1557635040"
variation 13511
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:777335358"
variation 13512
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646011644"
variation 13513..13522
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="agagagag"
/replace="agagagagag"
/replace="agagagagagag"
/db_xref="dbSNP:917332610"
variation 13513
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400487753"
variation 13514
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052949107"
variation 13516
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1337672685"
variation 13517
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1042173951"
variation 13519
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1433002965"
variation 13520
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:890323189"
variation 13523
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:944523722"
variation 13526
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646012268"
variation 13527
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:926170271"
variation 13530
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646012396"
variation 13532
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1328194233"
variation 13536
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228031040"
variation 13537
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1274083950"
variation 13538
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1038766385"
variation 13539
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:936153832"
variation 13542
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646012670"
variation 13543..13546
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1646012732"
variation 13547
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646012802"
variation 13548
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646012848"
variation 13552
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646012914"
variation 13553
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:900268718"
variation 13555..13559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="gctcc"
/db_xref="dbSNP:1646013091"
variation 13555
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1263381056"
variation 13559
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646013169"
variation 13561
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:994483877"
variation 13562
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1027759385"
variation 13564
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1260081808"
variation 13567..13572
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaaaaa"
/replace="aaaaaaa"
/db_xref="dbSNP:1430597782"
variation 13573
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1189626933"
variation 13576
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:748935515"
variation 13577
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646013928"
variation 13581..13582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="tg"
/db_xref="dbSNP:1646013985"
variation 13582
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:1646014059"
variation 13584
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646014128"
variation 13585
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571393759"
variation 13586
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:888693143"
variation 13587
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1571393772"
variation 13588
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:529029363"
variation 13591
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:550254208"
variation 13593
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448127823"
variation 13597
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1198804497"
variation 13603
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1452846937"
variation 13606
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646014790"
variation 13607
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:568745685"
variation 13608
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:539225869"
variation 13609
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481624921"
variation 13610
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646014975"
variation 13611
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646015038"
variation 13615
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1646015106"
variation 13617
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:1177526516"
variation 13622
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:557502575"
variation 13623
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1008583388"
variation 13626
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:770599707"
variation 13627
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:566671117"
variation 13630
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1571393823"
variation 13633
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1290747057"
variation 13634
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385739329"
variation 13636
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:992965566"
variation 13637
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:149480174"
variation 13640
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1359870567"
variation 13642
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1571393854"
variation 13643
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452955599"
variation 13644
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:372205273"
variation 13645
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1646016011"
variation 13646
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/db_xref="dbSNP:1283671820"
variation 13656
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1387050257"
variation 13657..13659
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:1328134606"
variation 13658
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:1236404859"
variation 13660
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1435466336"
variation 13662
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:978718021"
variation 13663
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:993290863"
variation 13665
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646016404"
variation 13666
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:925979776"
variation 13667
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:951950535"
variation 13670
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148732980"
variation 13673..13675
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1646016530"
variation 13676
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="g"
/replace="t"
/db_xref="dbSNP:2148732983"
variation 13680
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:955978316"
variation 13682
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646016728"
variation 13683..13687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="gtg"
/replace="gtgtg"
/db_xref="dbSNP:1490979203"
variation 13684
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:1200680347"
variation 13687
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646016843"
variation 13689
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1251501560"
variation 13690
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:989092655"
variation 13693
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:145835702"
variation 13694
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="c"
/db_xref="dbSNP:138746703"
variation 13698
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:960582832"
variation 13701..13703
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="aaa"
/replace="aaaaa"
/db_xref="dbSNP:530985639"
variation 13704
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646017641"
variation 13707..13710
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:150609292"
variation 13712
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="t"
/db_xref="dbSNP:2148733025"
variation 13714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace=""
/replace="c"
/db_xref="dbSNP:1557635273"
variation 13714
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="c"
/replace="t"
/db_xref="dbSNP:967767747"
variation 13715
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1646017835"
variation 13717
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/replace="a"
/replace="g"
/db_xref="dbSNP:1303579430"
polyA_site 13721
/gene="AGO1"
/gene_synonym="EIF2C; EIF2C1; GERP95; hAgo1; NEDLBAS; Q99"
/experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN
actggcagctggccgggcgctcgcagtgggagctgctgcaggctccgcggcggcggcaacggaggctgcgggggcggcggcgcgagcggccgggcttggtaggggagccgagcccggcccgggatcccgagcagcgagagtgtggggtacctaggcccctcacgctggacttcacagtctccgggccgcctgacctccgcacgggtatatgggatggaagcgggaccctcgggagcagctgcgggcgcttacctgccccccctgcagcaggtgttccaggcacctcgccggcctggcattggcactgtggggaaaccaatcaagctcctggccaattactttgaggtggacatccctaagatcgacgtgtaccactacgaggtggacatcaagccggataagtgtccccgtagagtcaaccgggaagtggtggaatacatggtccagcatttcaagcctcagatctttggtgatcgcaagcctgtgtatgatggaaagaagaacatttacactgtcacagcactgcccattggcaacgaacgggtcgactttgaggtgacaatccctggggaagggaaggatcgaatctttaaggtctccatcaagtggctagccattgtgagctggcgaatgctgcatgaggccctggtcagcggccagatccctgttcccttggagtctgtgcaagccctggatgtggccatgaggcacctggcatccatgaggtacacccctgtgggccgctccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacattgatgtctcagccactgccttttataaggcacagccagtgattgagttcatgtgtgaggtgctggacatcaggaacatagatgagcagcccaagcccctcacggactctcagcgcgttcgcttcaccaaggagatcaagggcctgaaggtggaagtcacccactgtggacagatgaagaggaagtaccgcgtgtgtaatgttacccgtcgccctgctagccatcagacattccccttacagctggagagtggacagactgtggagtgcacagtggcacagtatttcaagcagaaatataaccttcagctcaagtatccccatctgccctgcctacaagttggccaggaacaaaagcatacctaccttcccctagaggtctgtaacattgtggctgggcagcgctgtattaaaaagctgaccgacaaccagacctcgaccatgataaaggccacagctagatccgctccagacagacaggaggagatcagtcgcctgatgaagaatgccagctacaacttagatccctacatccaggaatttgggatcaaagtgaaggatgacatgacggaggtgacagggcgagtgctgccggcgcccatcttgcagtacggcggccgggtgagcaggaaccgggccattgccacacccaatcagggtgtctgggacatgcgggggaaacagttctacaatgggattgagatcaaagtctgggccatcgcctgcttcgcaccccaaaaacagtgtcgagaagaggtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcggggatgcctatccagggtcaaccttgtttctgcaaatatgcacagggggcagacagcgtggagcctatgttccggcatctcaagaacacctactcagggctgcagctcattattgtcatcctgccagggaagacgccggtgtatgctgaggtgaaacgtgtcggagatacactcttgggaatggctacgcagtgtgtgcaggtgaagaacgtggtcaagacctcacctcagactctgtccaacctctgcctcaagatcaatgtcaaacttggtggcattaacaacatcctagtcccacaccagcgctctgccgtttttcaacagccagtgatattcctgggagcagatgttacacaccccccagcaggggatgggaaaaaaccttctatcacagcagtggtaggcagtatggatgcccaccccagccgatactgtgctactgtgcgggtacagcgaccacggcaagagatcattgaagacttgtcctacatggtgcgtgagctcctcatccaattctacaagtccacccgtttcaagcctacccgcatcatcttctaccgagatggggtgcctgaaggccagctaccccagatactccactatgagctactggccattcgtgatgcctgcatcaaactggaaaaggactaccagcctgggatcacttatattgtggtgcagaaacgccatcacacccgccttttctgtgctgacaagaatgagcgaattgggaagagtggtaacatcccagctgggaccacagtggacaccaacatcacccacccatttgagtttgacttctatctgtgcagccacgcaggcatccagggcaccagccgaccatcccattactatgttctttgggatgacaaccgtttcacagcagatgagctccagatcctgacgtaccagctgtgccacacttacgtacgatgcacacgctctgtctctatcccagcacctgcctactatgcccgcctggtggctttccgggcacgataccacctggtggacaaggagcatgacagtggagaggggagccacatatcggggcagagcaatgggcgggacccccaggccctggccaaagccgtgcaggttcaccaggatactctgcgcaccatgtacttcgcttgaaggcagaacgctgttacctcactggatagaagaaagctttccaagccccaggagctgtgccacccaaatccagaggaagcaaggaggagggaggtggggtagggaggagtgtaggatgccttgtttccttctatagaggtggtgtaagagtggggaacagggccagcaagacagaccaccagccagaaatctctgatatcaacctcatgtcccccacccctcaccccatcttgtcacatctggccctgaccccactggaccaaaaggggcagcactggtgcccaccatacacacaggtgtctcatgtgactcacagtgctaaagactcatgcttgacagcttggtaaggtcaactctgtagccctgcagacaaaagctggttaggtttgggtttgatactttagatgggaaagtgaggggcttgagaaagtgggtgggaggagggaaggattttttaggagccttaatcagaaaaggactagatttgtttaagaagaaaaatgaaaccagacccagatcaatattttaggatactagatgttttaatgggttcagaatccagtttgtaggaagattttttaatggttttggttgctcctcccccagctgccaccccccaccttacccttattcctctctgtccacattttctgccccaccttacttctcctccctgacagacatccagcccctagtaatacttaaggcactatggcacttagctttgaagtgacacgaccctgtcttccttccgcccgctggtgggtaaccagtgccttccctgtaacggtaatgctgcagaactgcaaccttttgtacctttctttggggaatggggtgggggtgggagaggaggtagatggggaagaaataccccagacccaacaaacctccagccagaaagccagctattttgcatttgaaggaattgacttcctcattcattgagctttttaaaagatcacaacctcaagatggttaaaatccattgacatttgcactttcaaacatgacaagtctcggagctgctgagatgacaggcccctggcctttccacttatgcctccttttctccttattcctcctacctcccgccccgcccaggtctggagttactttcatagcatttttcactcttggcttcttttctcccttgatggtcaagtctcttatgtttcaatatttcttaactggggtgtcttataacaaaaaactcttaggtctaaaatgagaaaaaagagagaaaacaaaatgttatttttataccataacttgagtgtattgccaaaatttggaaatccttcccatgcctgatgagtttatatcccagaaacattgagccatcagaatgaactgtgtacctgatttgttctctgacctggctaggtagggagggggtggttatcgccccaagatggggtccaggctccatccttcctctgtgcagataatacctttttcttgctatagcctccctcctctgcactgtcctgcactctttcttgcaagtgcatctttttccttcccctggactgtcctctgaccctttggctcatcctagattgcagtgtgtcctgtggacaggctggggaattttgctgctccctattgcttctgtttacaaaaatgaatttttcctggtttcccactagggcatgtgggtgggtggcatggacttttttttttttttttttttgtcttgagacatggggtttggctgtcttgcaggactggagaaggtggtggttctagcttggtctctgttggccttgaagcaagcatcccccctgccctttttccttgactgttcatttttttcctgccccactgcttgggatggggagttgcaacttcagtgtggaatttcctctttgaggagcctgggcttggatctatcctgatctggtgatgaagccatgattactttagacctagcccaggcttggaggccagctggaggaagaagggtctaaatcctggcctgtagagttagaactaccatttcctccccttagctgcccttgtatgacccggatttgctatgcaaaacaatctatcccaggttctgttctggttggctacattgttcagcaactcacaaaacgtagcacaaacattcattatggagaaagcatcaggactgttgagtaactcctcctttacttttttcctgctggctacagcatggggtgccctataggcacaagcccagctgaagaacagaatggagggctctgggaggaggcagctcactggagagcctacattccttacacaagtgcctaaagagagtgatgctaacactccatctgccctgtccattgccttcatatacagtctacttcgtgttctgtcaccctttggggaggggagttctcctgggacagtgggctctgcatgttctccacttggatacattttggggctaggatcagggcactattcctggagggtccagtcattcaccagcatttgcaaatgtccatagggagcaggtggcagcctctactcccagcaacaagtttgtgttctctccttttctctctttgcctcactctctccagttggttttcagctggggcttgaaatgcatttttagccctttgacgtggcttatgccattcaagaaataaaaagcaagagaatcagctttgggcaatgacaagaaatgagttcttactctgatttttttgtaaaaagataatttttgagacttgaaaaataccccgaccttgagattattcctgtttgaaaggtggtgcatgcagatggagaagtggtgttggcagcaagctttggctcatgtggatttggtttaagtggtgcttcttacccaagcttcaaggaagtgcttgggggacccccagcctcatcctcttagttgggtctcttgttccctttgtaccactgttttgccttccttttcctcttctctctttgcctggcttcctttcccttttcttctattcactctgcttgcttgctggccggcctgcctgcctgcctgcctgcctgcctgcctgtctgcctatgtgatgatgaaatctctgcatggctgcaatgatcccactgttagctggcagggtcaggcttagctccttgactgcagaagaccaagaacctgttccccaagcccagagatgtccacctgggctggactgccctcaagcttatactagagaagagcaactgacctgcccaacttgtgtgaagtcaggagggtttctggcattttccacacctgtccactccttggagctggtttctctcattgctttttctaaatctggttctttttctctttacctggggcctggcttttctgagattgtcttagggttgagctatttgggtatcctgggtttgagtgttaggggatggacataaaggaaaaagagtgatgagaagagaatggagagaatttgaataaaaggtgggaaaggagagcactgttctttgattgtttatccagtccaacctgatccattagggatcgaggtgctacactggcctccagggataagcctggggctactgttgctgggaacttaggcttaacataaagccgaagaaggtacctagaaatttgaaacttccctaaaaagctcctaatgcccacctgctagatagcttctctgtggcctcctatttagctaagcagcagtgtttttggatactttttttttctgtttgtgaataaggccagcactcaagatgggcagccaagggtgcactgactattagctggcccataggatatctgtaaggctggtgggacagttttggacctggaatcatgtgtaactaacaaggttggacgtttcttccccatcagggtagaaaaatcatctcaaactagccaaaaggcagttttggaaactacattgggggacgttatttttatttatatatggggcctaggccaatccaggatggtagctggaataccttccttcttaaaatctgatcatggcagggatatgcagggcactttttactatttggccttctaagcagattgggaaggaggtattttctggttttcgctttcctccgacttaataggacttgccttctccctgggcagggagagaggctgggttggtgctctcccttactctactcatactgacttagagcctctggctgctgtttgggcatccaagaaagggaggggaaggaatgagctaaaaacaaaacagaatgaggtgggaaagggagattttcttctttacagaggaaaataggaaaccctccaagaattgtgcaagtaaagacatttgttgaatgcactgagtcccttggtgtagtagcaataaggaaaaatgaaattactttcctgtgcacacagtccagcctaattggtatgtgatgttgcacttagcagccatgtggtgggcatgtgtgactactctggttttcactttagtttctaaactttttatccctctcaagtccagcatggatggggaaatgtctctggatccccacagctgtgtacttgtttgcatttgtttccctttgagatttgtgtttgtgtcctgctttgagctgtaccttgtccagtccattgtgaaattatcccagcagctgtaatgtacagttccttctgaagcaagcaacatcagcagcagcagcagcagcagcacaattctgtgttttataaagacaacagtggcttctatttctaaagtgcggtctttctctttttttttcctaccagcaaaacaaacttttgggactgattacatctctaatagattttaggtgagaataatactgtagattgttatgcaggaatacttcacagagccttcatttattcttcattcaacaaacatgcaaagcactgtgccagcagtattgtggggaggggaggcacaattcaaaatgaggaaaatagtgtccgtctcattaagggaattaagtttggtgggggatatgattagccaaatagtcccctggcataggaggaagataatgagggagtggaataaggctacaacaacgaatatagggaggaagggacagatttgagagacgaggtagaattaataggactcgatggctggtgggaggagaagacaggagtagaggttagctcccaggtttctccttgaccataggagtgtgttgggacattctgccagtcaagatgggggtgacggggagactgtagaaggaaggtggggagtttttgaagaaacagaatgttgtatagactgagttttgaggtgtttgtggggcagtaagggtaaggtgtccagtaaacacaggttggtgctcaggtaagactgtaaaactgcatttatagatacaggagtcttatagatggtagttaaagccataggcatgaatgagatagcttagaaaaagagaagagaaactagtatacagccccctaagaaactcaatttaaaggttcgggggaggaagcagatcttaaggtgacagatcactggtagacagtttgtgggttttttgtttctttgtttagccagtttggtgaggtaggagaagaaatcagagtagaagaaggttcatgaagggagtgattaacaacatgaactgctgcagagagggagttctttttttttctgtgtgttttacctttctactccccatcttttggggatcttgtaactctatgacttacttacgttattctccagtatttcttgaaaatgagcattggaaaaaccaattctaaaatggctaaaactaggactttcaagttcaccacaactaccaccaattaggagataattgtaaaagaataaacaaaacctaattttgttcctagccaatattataaaccatgttccagcatactagataatagtagcatactatatttatttccataatttgtcttctttagagcctatgaactcctaggagcagaagctatattctcttcatttttgtcatctcagggtcatggcatataccaacagatcagtatgtgcaaatataattgaaataggctagtagtctgtggtttatgagtatgggctgggtgggcagtggatcaagaagtgataggagtacacaggatgaactcagaattcctgaatcttcaggtaagcagatacttaactacattatcattgtcttttcccactcaccccaagttggaggttctatggttttgtactttaagctggtggtataattgtcaagcatgtaaattctggcattcttcctggtactgctagagcattgttatttctatgcatgggggtaagaaggctcagagaaggatcctggcggataccccagtgagaaatcgtcagtggcagccagtgtgtacatacgtggacctagcattcctctggaggccaagtgttgtaaattggcctgtggctatcatctggcagactcccttgggaaagagccagccagccccatgcttcttttcagcagcaagggttagggaggttggttgaacttgaagagcagattggacatggagcagattttgaccagttgaaataagacataaatttatgactccgagtgaggcagaaataaagaacttagcagggggaataggaggaggatgattatggcaaattttgctataaactttagttttagaaaagattgatattgaaaagccttcaggatttgcctgtggttgctactcaagttaaaaagactgggagcctgcattgtttggtcctggagctcaaggttttcagtgaaggcttgtcctggcacctctgggcattccttttcattactggttgagcatccttccttctgctctgtcaattggcaaaatatgctggagcacattctggactagcagttgccttggggtagtcaggctgggtatttgtttggtatctcttggtgtagcagaccccagaatctcatggcaattaggatttggtggctaaacgaaagagttagtgcaaggaaaagcctagttggaatttctgagtctgggccatccttaagctgctgtctactgcctgaatgggaagtaatgtcgaattggaaaattagctcaccatttttgttctagctttgcagacatttattcctctgatgataggctgagaaatgcctaggccggcttagaaggcacacagcatgacagaagtactccttcaaagcagctgtgtcaagaaggaagagctggaaaagtggatttgctggggaattagatgcatttagttttccacttacgcacaactgccttctccagtatatcataccaaggttttttaggcctttgtggcttaccctgcaggaacatactgtgtcctgttgttctggactgtagcatcttcaccaccatcctcttggcaatggttttttgtttggggtttttttttttttttttttggacaaagtataataatattgagggacctttctagggagcctttggtcctttgtccccattttccaaagggagggaactttcctcttaaaagagacagtgggaacttttagccaggtttttggaaaaggcctgtgggctattaatgagagtgagctgcaaaaggaggaagggtttgtttgggtactttgaagtacttagctaggtgttttctacagtatcttatataattgcatcttacagcatctttacatgcgaaatagtttatcagttatcttcaattgcatattacaaaattctgattaaatttttcttaaataagaaaactatcatttcatatgacaagaaatcctaatttaatgttactccaaggttggttaattcagtggctcagtgataacaccaaagactcagtttcttgaaatttttttgctctgccatcctccatgtttatcctcacgccagttcgcctcatggtcccaatatggctactgtaattctgggaaggaaatgctgacagaaccgtgtctggcaaaagagagacagatttttctgtgtccttctaaagcaaggaagtcttcccctggaagctccaacagatacggcctcatggctttgctagaaatgggtcatctcactcctgtcattggcaaagcaagtaagatcatccatcaggagtggcttagattaatgaattatcctttgagtcgtgtagactagaaagttcagtcatgtctactagcaagaaaggagataagggctgttggataagcagcatctggtctcaaaggtacttcaacttttacagatgagaaacatgaatcagagtgactttcccaggctcacagcaagtaagagagggccttcagtgttagctgtgtctgtccctaaagcccatgttttatattgtatcttgctagagtataaagtaacttactttctaccttgtagaaactgatggtctaggagaagagatttgaactcaggtgcccagttgactctaatcttggcccatgtgagaggattgtactcagttgctctcctcatccagtgatgtttcttgtctaacacaagaagcctaggagtagaaagtcctaagcagagtagaataatagcggcagcagggagggaagtgtgaactgtgtgtccctgagcctgacttactgggcagggacatgacacttaaagcggcagctggccactctgtctttcctgcatgcactgagtatttggtagctcattagtgaccagtgatattgatcatcttttcatgtgctcacttactatccccatatctttgttgtttgcatcttttacccattgtatttgttgtttttgagacagtgtctcactctgtcacccaggctggagtgcagtctcatgatcgcggctcactgcagtttctgcctcctgggctcaagcaatcctcccacctcagcctcctgagtagctgggcttacaggcgcacaccaccatgcccagctaattaaaaaaaaaattttttttgtagcagttcggtctcattagtattgcccaggctggcctctcttagcttcaagctatcctcccgcctcggcctcccaaagtgctggaattacaggcataagccacaagccactgggcccagcctcttttacctgtttcaaaattgagttttattgagttgtaagagttctttattcattttaaacacaagtcctttgttggatatatcttttacatctatttttcccagtctgtggcttgccttttcattttgaagagcaaaagtttaaaattttgtgaatttattaaagctccgtttgttgcttttttctgttctagtttatacttttgtatcatattttaggaaattttgcactgggtatttgatggctcctgaggaggttcaactttcagagcgcactgatttctctgcacctgagattttgtactatttctgtatttctttcttctcagaacaaccagtgtcaccaggtatgagggcagagttttagcttgtttgctgagccccattcttgaagctcatttatttattcacctatctgtccatcaatccaacaaatatactgaatgctgctatgtgccaggtactggcactgttctaggtactggggcaatgacagttaagataatacccaatgaccctgctctgtacccttaagagcagactcagttgggaatgagttatccaaatatagggtgtacatgtagtcaggagagagcctcatacagctttgcctttggcagaatccttcaaacctctttgtcttcctacttcttgatattacaaatcatgagcctttcacatgcattgactctaaagaggtgggttcctggatagcagaagtagataggaaggcatcattgacatttactgagatggattgaatcagagggtgtaaattctgctccatcaatgttgaaaaagactagcccaccccaaaggtttatcactgtcaccatgtctaatgtctattctggaagaagctgaagaagtctgcctttgtttagggaaccggttccagaatcagaggggttgaggatataaaagacccttgcacaagagttggtatttaccctgtcagatgctgctaccaagatttggattgtgtacagtcgaggattaaaaatgacttttaagatgcagtgtttcatctggtgacatttaatttgatattttaaaattggggagggtattttcagccatgggggtagggatgtgaaagaagaagaaagtaagaattggagtcagatgtggttttgagtcccatacatttattgtttaatattatatggtaagtactttaaaatggtaaatagtaaatacttgtgttattcactaacatttggggaggattttctctgtgctttatgtatattacctaaccttacaaactgtgtaaggtacatgctgttctctcaatttttcagataagaaaattgaagcccagagagatcaagtgactgatccaaagtcccacagtgaggggaactgaagataggatattctttctccttttcctctttaaaaaattattttgattaaaaaaaaccgtattactgaagcatagggacatggggagaaattatgaatgattcctcagcctgaataaaatagtatgtttcattaaggcaacaaatatttattaaggacctaatatttgcctgacattcaagtgaggtggggggcacacaagtagtaaataaataacagactgggcaaagggctaccaaggcaatactgtagtagactaacaggtgccccaccatagatgggtggtccggaaaaggcgtctcagatgtctttcgttgagacgcaaaaaaaagctgtggggtagggcgtaaggggagggtggagaagagagagagggttcctggccaagggaaccaaaagcagagaagctccaagtcagaaaaaagcagcggttggcccgttgggagaattggaagccaaccagtatagctgtagcacaggcggggcccatttacgccgtgcgttttcaccctggaaaggagtttgggttttcaagtgtgacgaggcgctattaaagagttttaaacatggaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]