2025-07-03 11:42:39, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NR_049829 112 bp RNA linear PRI 08-SEP-2020 DEFINITION Homo sapiens microRNA 5197 (MIR5197), microRNA. ACCESSION NR_049829 VERSION NR_049829.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 112) AUTHORS Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R and den Boer ML. TITLE Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia JOURNAL Leukemia 25 (9), 1389-1399 (2011) PUBMED 21606961 REMARK Review article REFERENCE 2 (bases 1 to 112) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC008696.6. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-112 AC008696.6 125814-125925 c FEATURES Location/Qualifiers source 1..112 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="5" /map="5q31.3" gene 1..112 /gene="MIR5197" /note="microRNA 5197" /db_xref="GeneID:100846991" /db_xref="HGNC:HGNC:43450" /db_xref="miRBase:MI0018176" precursor_RNA 1..112 /gene="MIR5197" /product="microRNA 5197" /db_xref="GeneID:100846991" /db_xref="HGNC:HGNC:43450" /db_xref="miRBase:MI0018176" exon 1..112 /gene="MIR5197" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:1489960847" variation 3 /gene="MIR5197" /replace="" /replace="t" /db_xref="dbSNP:1757695667" variation 4..6 /gene="MIR5197" /replace="ggg" /replace="gggg" /db_xref="dbSNP:35579612" variation 6 /gene="MIR5197" /replace="g" /replace="t" /db_xref="dbSNP:1298572672" variation 9 /gene="MIR5197" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:2042253" variation 12 /gene="MIR5197" /replace="a" /replace="g" /db_xref="dbSNP:1229081286" variation 13 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:1757696027" variation 18 /gene="MIR5197" /replace="a" /replace="t" /db_xref="dbSNP:1580928229" variation 21 /gene="MIR5197" /replace="a" /replace="g" /db_xref="dbSNP:1561903822" variation 22 /gene="MIR5197" /replace="a" /replace="g" /db_xref="dbSNP:1757696184" variation 23 /gene="MIR5197" /replace="a" /replace="g" /db_xref="dbSNP:553711864" ncRNA 27..49 /ncRNA_class="miRNA" /gene="MIR5197" /product="hsa-miR-5197-5p" /db_xref="miRBase:MIMAT0021130" /db_xref="GeneID:100846991" /db_xref="HGNC:HGNC:43450" /db_xref="miRBase:MI0018176" variation 28 /gene="MIR5197" /replace="a" /replace="g" /db_xref="dbSNP:934588813" variation 30 /gene="MIR5197" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1277438133" variation 32 /gene="MIR5197" /replace="g" /replace="t" /db_xref="dbSNP:757874166" variation 37 /gene="MIR5197" /replace="a" /replace="c" /db_xref="dbSNP:1757696514" variation 38 /gene="MIR5197" /replace="a" /replace="t" /db_xref="dbSNP:546634101" variation 39 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:1358766411" variation 40 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:1277811118" variation 41 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:1227864408" variation 42 /gene="MIR5197" /replace="a" /replace="c" /db_xref="dbSNP:2126720389" variation 45 /gene="MIR5197" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:372758014" variation 57 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:970099591" variation 58 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:2479829516" variation 59 /gene="MIR5197" /replace="a" /replace="t" /db_xref="dbSNP:1757696950" variation 60 /gene="MIR5197" /replace="c" /replace="g" /db_xref="dbSNP:1757697010" variation 63 /gene="MIR5197" /replace="c" /replace="g" /db_xref="dbSNP:2126720398" ncRNA 64..86 /ncRNA_class="miRNA" /gene="MIR5197" /product="hsa-miR-5197-3p" /db_xref="miRBase:MIMAT0021131" /db_xref="GeneID:100846991" /db_xref="HGNC:HGNC:43450" /db_xref="miRBase:MI0018176" variation 68 /gene="MIR5197" /replace="a" /replace="g" /db_xref="dbSNP:2126720401" variation 71 /gene="MIR5197" /replace="g" /replace="t" /db_xref="dbSNP:77549240" variation 73 /gene="MIR5197" /replace="a" /replace="c" /db_xref="dbSNP:1411653302" variation 77 /gene="MIR5197" /replace="c" /replace="g" /db_xref="dbSNP:1347866830" variation 82 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:892818585" variation 83 /gene="MIR5197" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1405555825" variation 87 /gene="MIR5197" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:920738919" variation 89 /gene="MIR5197" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1454576100" variation 94 /gene="MIR5197" /replace="a" /replace="g" /db_xref="dbSNP:1757698122" variation 95 /gene="MIR5197" /replace="a" /replace="t" /db_xref="dbSNP:1175313611" variation 96 /gene="MIR5197" /replace="a" /replace="g" /db_xref="dbSNP:1757698238" variation 97 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:1757698293" variation 105 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:1412154067" variation 106 /gene="MIR5197" /replace="c" /replace="t" /db_xref="dbSNP:1184932024" variation 108 /gene="MIR5197" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1757698447" variation 111 /gene="MIR5197" /replace="c" /replace="g" /db_xref="dbSNP:1757698529" ORIGIN
tatgggattccacagacaatgagtatcaatggcacaaactcattcttgaatttttgccagttcaagaagagactgagtcatcgaatgctctaaatgtcacttcacctcatgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]