2025-06-17 06:05:26, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NR_039956 87 bp RNA linear PRI 30-JAN-2022 DEFINITION Homo sapiens microRNA 4793 (MIR4793), microRNA. ACCESSION NR_039956 VERSION NR_039956.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 87) AUTHORS Yan M, Niu L, Liu J, Yao Y and Li H. TITLE circEVI5 acts as a miR-4793-3p sponge to suppress the proliferation of gastric cancer JOURNAL Cell Death Dis 12 (8), 774 (2021) PUBMED 34354043 REMARK GeneRIF: circEVI5 acts as a miR-4793-3p sponge to suppress the proliferation of gastric cancer. Publication Status: Online-Only REFERENCE 2 (bases 1 to 87) AUTHORS Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C. TITLE Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene JOURNAL Cancer Res 71 (1), 78-86 (2011) PUBMED 21199797 REFERENCE 3 (bases 1 to 87) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC121252.4. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-87 AC121252.4 82642-82728 c FEATURES Location/Qualifiers source 1..87 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="3" /map="3p21.31" gene 1..87 /gene="MIR4793" /note="microRNA 4793" /db_xref="GeneID:100616112" /db_xref="HGNC:HGNC:41538" /db_xref="miRBase:MI0017440" precursor_RNA 1..87 /gene="MIR4793" /product="microRNA 4793" /db_xref="GeneID:100616112" /db_xref="HGNC:HGNC:41538" /db_xref="miRBase:MI0017440" exon 1..87 /gene="MIR4793" /inference="alignment:Splign:2.1.0" variation 6 /gene="MIR4793" /replace="c" /replace="g" /db_xref="dbSNP:2047058793" variation 7 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:2531579104" variation 9 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:764995199" variation 10 /gene="MIR4793" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:761647376" variation 11 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:2047058217" variation 13 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:776757428" variation 15 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:1488955294" variation 16 /gene="MIR4793" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:373490754" variation 17 /gene="MIR4793" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:775646965" variation 18 /gene="MIR4793" /replace="a" /replace="c" /db_xref="dbSNP:772276217" ncRNA 19..42 /ncRNA_class="miRNA" /gene="MIR4793" /product="hsa-miR-4793-5p" /db_xref="miRBase:MIMAT0019965" /db_xref="GeneID:100616112" /db_xref="HGNC:HGNC:41538" /db_xref="miRBase:MI0017440" variation 20 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:2531578969" variation 21 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:2531578962" variation 26 /gene="MIR4793" /replace="g" /replace="t" /db_xref="dbSNP:2531578956" variation 27 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:2531578955" variation 29 /gene="MIR4793" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:2047058011" variation 30 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:138052127" variation 31 /gene="MIR4793" /replace="a" /replace="c" /db_xref="dbSNP:2531578943" variation 32 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:779453089" variation 33 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:2047057931" variation 34 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:2106701526" variation 35 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:2531578920" variation 36 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:1213116185" variation 37 /gene="MIR4793" /replace="a" /replace="c" /db_xref="dbSNP:370939789" variation 38 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:749627418" variation 39 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:780847102" variation 41 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:2531578899" variation 42 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:2531578892" variation 43 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:2531578885" variation 44 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:754564648" variation 45 /gene="MIR4793" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:560454528" variation 46 /gene="MIR4793" /replace="g" /replace="t" /db_xref="dbSNP:2531578866" variation 47 /gene="MIR4793" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:2106701499" variation 50 /gene="MIR4793" /replace="a" /replace="t" /db_xref="dbSNP:1449029134" variation 54 /gene="MIR4793" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:2047056812" variation 57 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:1359588980" ncRNA 58..80 /ncRNA_class="miRNA" /gene="MIR4793" /product="hsa-miR-4793-3p" /db_xref="miRBase:MIMAT0019966" /db_xref="GeneID:100616112" /db_xref="HGNC:HGNC:41538" /db_xref="miRBase:MI0017440" variation 61 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:1575539289" variation 63 /gene="MIR4793" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:779602935" variation 64 /gene="MIR4793" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:757908486" variation 65 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:2047056678" variation 68 /gene="MIR4793" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:2531578784" variation 72 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:1422853760" variation 75 /gene="MIR4793" /replace="c" /replace="g" /db_xref="dbSNP:2047056635" variation 76 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:2047056615" variation 80 /gene="MIR4793" /replace="c" /replace="t" /db_xref="dbSNP:377721296" variation 81 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:1426193549" variation 82 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:765189900" variation 84 /gene="MIR4793" /replace="a" /replace="g" /db_xref="dbSNP:2531578724" variation 85 /gene="MIR4793" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:761542012" ORIGIN
tttctcctcgctgcccgcacatcctgctccacagggcagagggaggccaagaagacctctgcactgtgagttggctggctggaggaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]