2024-05-03 09:05:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_037450 68 bp RNA linear PRI 30-OCT-2022 DEFINITION Homo sapiens microRNA 3679 (MIR3679), microRNA. ACCESSION NR_037450 VERSION NR_037450.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 68) AUTHORS He JY, Zhou XQ and Wang WT. TITLE [Mechanism of miRNA-3679 Inhibiting Downstream ZADH2-Target Genes to Promote Hepatocellular Carcinoma Cell Proliferation] JOURNAL Sichuan Da Xue Xue Bao Yi Xue Ban 53 (5), 744-751 (2022) PUBMED 36224673 REMARK GeneRIF: [Mechanism of miRNA-3679 Inhibiting Downstream ZADH2-Target Genes to Promote Hepatocellular Carcinoma Cell Proliferation]. REFERENCE 2 (bases 1 to 68) AUTHORS Higashijima Y, Matsui Y, Shimamura T, Nakaki R, Nagai N, Tsutsumi S, Abe Y, Link VM, Osaka M, Yoshida M, Watanabe R, Tanaka T, Taguchi A, Miura M, Ruan X, Li G, Inoue T, Nangaku M, Kimura H, Furukawa T, Aburatani H, Wada Y, Ruan Y, Glass CK and Kanki Y. TITLE Coordinated demethylation of H3K9 and H3K27 is required for rapid inflammatory responses of endothelial cells JOURNAL EMBO J 39 (7), e103949 (2020) PUBMED 32125007 REMARK GeneRIF: Coordinated demethylation of H3K9 and H3K27 is required for rapid inflammatory responses of endothelial cells. REFERENCE 3 (bases 1 to 68) AUTHORS Hu W, Xu B, Zhang J, Kou C, Liu J, Wang Q and Zhang R. TITLE Exosomal miR-146a-5p from Treponema pallidum-stimulated macrophages reduces endothelial cells permeability and monocyte transendothelial migration by targeting JAM-C JOURNAL Exp Cell Res 388 (1), 111823 (2020) PUBMED 31926946 REFERENCE 4 (bases 1 to 68) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 68) AUTHORS Xie Z, Yin X, Gong B, Nie W, Wu B, Zhang X, Huang J, Zhang P, Zhou Z and Li Z. TITLE Salivary microRNAs show potential as a noninvasive biomarker for detecting resectable pancreatic cancer JOURNAL Cancer Prev Res (Phila) 8 (2), 165-173 (2015) PUBMED 25538087 REMARK GeneRIF: Salivary miR-3679-5p and miR-940 possess good discriminatory power to detect resectable pancreatic cancer. REFERENCE 6 (bases 1 to 68) AUTHORS Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C. TITLE Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene JOURNAL Cancer Res 71 (1), 78-86 (2011) PUBMED 21199797 REFERENCE 7 (bases 1 to 68) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 8 (bases 1 to 68) AUTHORS Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R and Bhattacharya A. TITLE Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood JOURNAL BMC Genomics 11, 288 (2010) PUBMED 20459673 REMARK Publication Status: Online-Only REFERENCE 9 (bases 1 to 68) AUTHORS Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM and Gunaratne PH. TITLE Discovery of novel microRNAs in female reproductive tract using next generation sequencing JOURNAL PLoS One 5 (3), e9637 (2010) PUBMED 20224791 REMARK Publication Status: Online-Only REFERENCE 10 (bases 1 to 68) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC115625.3. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM611194.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-68 AC115625.3 6016-6083 FEATURES Location/Qualifiers source 1..68 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="2" /map="2q21.2" gene 1..68 /gene="MIR3679" /gene_synonym="mir-3679" /note="microRNA 3679" /db_xref="GeneID:100500878" /db_xref="HGNC:HGNC:38979" /db_xref="miRBase:MI0016080" precursor_RNA 1..68 /gene="MIR3679" /gene_synonym="mir-3679" /product="microRNA 3679" /db_xref="GeneID:100500878" /db_xref="HGNC:HGNC:38979" /db_xref="miRBase:MI0016080" exon 1..68 /gene="MIR3679" /gene_synonym="mir-3679" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:186202971" variation 2 /gene="MIR3679" /gene_synonym="mir-3679" /replace="c" /replace="g" /db_xref="dbSNP:10175383" variation 3 /gene="MIR3679" /gene_synonym="mir-3679" /replace="c" /replace="t" /db_xref="dbSNP:2104887792" variation 5 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="g" /db_xref="dbSNP:6430498" ncRNA 6..28 /ncRNA_class="miRNA" /gene="MIR3679" /gene_synonym="mir-3679" /product="hsa-miR-3679-5p" /db_xref="miRBase:MIMAT0018104" /db_xref="GeneID:100500878" /db_xref="HGNC:HGNC:38979" /db_xref="miRBase:MI0016080" variation 6 /gene="MIR3679" /gene_synonym="mir-3679" /replace="c" /replace="t" /db_xref="dbSNP:1685877543" variation 7 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="g" /db_xref="dbSNP:1685877668" variation 13 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="g" /db_xref="dbSNP:1685877796" variation 20 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="g" /db_xref="dbSNP:1490236859" variation 21 /gene="MIR3679" /gene_synonym="mir-3679" /replace="c" /replace="g" /db_xref="dbSNP:982355045" variation 22..23 /gene="MIR3679" /gene_synonym="mir-3679" /replace="" /replace="aa" /db_xref="dbSNP:1573703474" variation 22 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="g" /db_xref="dbSNP:1053094244" variation 24..27 /gene="MIR3679" /gene_synonym="mir-3679" /replace="gggg" /replace="gggggggg" /db_xref="dbSNP:1573703494" variation 27 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="g" /db_xref="dbSNP:1685878554" variation 28 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="g" /db_xref="dbSNP:893220051" variation 30 /gene="MIR3679" /gene_synonym="mir-3679" /replace="g" /replace="t" /db_xref="dbSNP:1011652283" variation 33 /gene="MIR3679" /gene_synonym="mir-3679" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1044362500" variation 34 /gene="MIR3679" /gene_synonym="mir-3679" /replace="c" /replace="t" /db_xref="dbSNP:1685879116" variation 42 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:116613504" ncRNA 44..65 /ncRNA_class="miRNA" /gene="MIR3679" /gene_synonym="mir-3679" /product="hsa-miR-3679-3p" /db_xref="miRBase:MIMAT0018105" /db_xref="GeneID:100500878" /db_xref="HGNC:HGNC:38979" /db_xref="miRBase:MI0016080" variation 47..52 /gene="MIR3679" /gene_synonym="mir-3679" /replace="ccccc" /replace="cccccc" /replace="ccccccc" /db_xref="dbSNP:1158892564" variation 51 /gene="MIR3679" /gene_synonym="mir-3679" /replace="c" /replace="t" /db_xref="dbSNP:1250685109" variation 52 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="c" /db_xref="dbSNP:1685879747" variation 53 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="c" /db_xref="dbSNP:905887025" variation 55 /gene="MIR3679" /gene_synonym="mir-3679" /replace="g" /replace="t" /db_xref="dbSNP:1685880005" variation 58 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="t" /db_xref="dbSNP:139701217" variation 59 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="c" /db_xref="dbSNP:189786001" variation 60 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="t" /db_xref="dbSNP:754564873" variation 63 /gene="MIR3679" /gene_synonym="mir-3679" /replace="a" /replace="g" /db_xref="dbSNP:1283292908" ORIGIN
cgtggtgaggatatggcagggaaggggagtttccctctattcccttccccccagtaatcttcatcatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]