2024-05-03 12:46:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_036180 81 bp RNA linear PRI 14-NOV-2021 DEFINITION Homo sapiens microRNA 378c (MIR378C), microRNA. ACCESSION NR_036180 VERSION NR_036180.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 81) AUTHORS Yu Q, Zheng B, Ji X, Li P and Guo Z. TITLE miR-378c suppresses Wilms tumor development via negatively regulating CAMKK2 JOURNAL Acta Biochim Biophys Sin (Shanghai) 53 (6), 739-747 (2021) PUBMED 33956079 REMARK GeneRIF: miR-378c suppresses Wilms tumor development via negatively regulating CAMKK2. REFERENCE 2 (bases 1 to 81) AUTHORS Tian S, Cao Y, Wang J, Bi Y, Zhong J, Meng X, Sun W, Yang R, Gan L, Wang X, Li H and Wang R. TITLE The miR-378c-Samd1 circuit promotes phenotypic modulation of vascular smooth muscle cells and foam cells formation in atherosclerosis lesions JOURNAL Sci Rep 11 (1), 10548 (2021) PUBMED 34006929 REMARK GeneRIF: The miR-378c-Samd1 circuit promotes phenotypic modulation of vascular smooth muscle cells and foam cells formation in atherosclerosis lesions. Publication Status: Online-Only REFERENCE 3 (bases 1 to 81) AUTHORS Xia H, Zhang Z, Yuan J and Niu Q. TITLE The lncRNA PVT1 promotes invasive growth of lung adenocarcinoma cells by targeting miR-378c to regulate SLC2A1 expression JOURNAL Hum Cell 34 (1), 201-210 (2021) PUBMED 32960438 REMARK GeneRIF: The lncRNA PVT1 promotes invasive growth of lung adenocarcinoma cells by targeting miR-378c to regulate SLC2A1 expression. REFERENCE 4 (bases 1 to 81) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 81) AUTHORS Templin C, Volkmann J, Emmert MY, Mocharla P, Muller M, Kraenkel N, Ghadri JR, Meyer M, Styp-Rekowska B, Briand S, Klingenberg R, Jaguszewski M, Matter CM, Djonov V, Mach F, Windecker S, Hoerstrup SP, Thum T, Luscher TF and Landmesser U. TITLE Increased Proangiogenic Activity of Mobilized CD34+ Progenitor Cells of Patients With Acute ST-Segment-Elevation Myocardial Infarction: Role of Differential MicroRNA-378 Expression JOURNAL Arterioscler Thromb Vasc Biol 37 (2), 341-349 (2017) PUBMED 28062497 REMARK GeneRIF: miR-378 regulates the angiogenic capacity of CD34(+) progenitor cells in STEMI patients. REFERENCE 6 (bases 1 to 81) AUTHORS Li B, Wang Y, Li S, He H, Sun F, Wang C, Lu Y, Wang X and Tao B. TITLE Decreased expression of miR-378 correlates with tumor invasiveness and poor prognosis of patients with glioma JOURNAL Int J Clin Exp Pathol 8 (6), 7016-7021 (2015) PUBMED 26261592 REMARK GeneRIF: Results indicate that miR-378 may serve as a tumor suppressor and play an important role in inhibiting glioma cell migration and invasion. Publication Status: Online-Only REFERENCE 7 (bases 1 to 81) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 8 (bases 1 to 81) AUTHORS Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE and Hart RP. TITLE Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors JOURNAL PLoS One 4 (9), e7192 (2009) PUBMED 19784364 REMARK Publication Status: Online-Only REFERENCE 9 (bases 1 to 81) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL607076.9. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM611150.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-81 AL607076.9 17482-17562 c FEATURES Location/Qualifiers source 1..81 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="10" /map="10q26.3" gene 1..81 /gene="MIR378C" /gene_synonym="mir-378c" /note="microRNA 378c" /db_xref="GeneID:100422867" /db_xref="HGNC:HGNC:38374" /db_xref="miRBase:MI0015825" precursor_RNA 1..81 /gene="MIR378C" /gene_synonym="mir-378c" /product="microRNA 378c" /db_xref="GeneID:100422867" /db_xref="HGNC:HGNC:38374" /db_xref="miRBase:MI0015825" exon 1..81 /gene="MIR378C" /gene_synonym="mir-378c" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /db_xref="dbSNP:530160510" variation 3 /gene="MIR378C" /gene_synonym="mir-378c" /replace="" /replace="a" /db_xref="dbSNP:1847567065" variation 3 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /db_xref="dbSNP:1847567039" variation 5 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /db_xref="dbSNP:1203120302" variation 6 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="c" /db_xref="dbSNP:1260038309" variation 7 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1008022556" variation 9 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="t" /db_xref="dbSNP:1187408484" variation 10 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="cc" /db_xref="dbSNP:1255712575" ncRNA 11..35 /ncRNA_class="miRNA" /gene="MIR378C" /gene_synonym="mir-378c" /product="hsa-miR-378c" /db_xref="miRBase:MIMAT0016847" /db_xref="GeneID:100422867" /db_xref="HGNC:HGNC:38374" /db_xref="miRBase:MI0015825" variation 14 /gene="MIR378C" /gene_synonym="mir-378c" /replace="g" /replace="t" /db_xref="dbSNP:1847566924" variation 15 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="g" /db_xref="dbSNP:954998865" variation 16 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="aa" /db_xref="dbSNP:1476405711" variation 21 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="g" /db_xref="dbSNP:1187159745" variation 22 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /db_xref="dbSNP:1847566865" variation 23 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /db_xref="dbSNP:936928990" variation 24 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="t" /db_xref="dbSNP:924224817" variation 32 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1031754294" variation 38 /gene="MIR378C" /gene_synonym="mir-378c" /replace="g" /replace="t" /db_xref="dbSNP:1168308663" variation 39 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="t" /db_xref="dbSNP:561292419" variation 40 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:933449449" variation 41 /gene="MIR378C" /gene_synonym="mir-378c" /replace="g" /replace="t" /db_xref="dbSNP:1847566702" variation 42 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /db_xref="dbSNP:1589744682" variation 43 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1589744679" variation 46 /gene="MIR378C" /gene_synonym="mir-378c" /replace="g" /replace="t" /db_xref="dbSNP:1847566658" variation 47 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /db_xref="dbSNP:1847566638" variation 48 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="c" /db_xref="dbSNP:1847566627" variation 53 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:904508376" variation 55 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="t" /db_xref="dbSNP:1847566579" variation 59 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /db_xref="dbSNP:1311331011" variation 60 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="t" /db_xref="dbSNP:1847566553" variation 64 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:963788455" variation 67 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="g" /db_xref="dbSNP:1847566507" variation 69 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="t" /db_xref="dbSNP:1564762861" variation 77 /gene="MIR378C" /gene_synonym="mir-378c" /replace="a" /replace="g" /db_xref="dbSNP:1847566479" variation 81 /gene="MIR378C" /gene_synonym="mir-378c" /replace="c" /replace="g" /db_xref="dbSNP:1847566464" ORIGIN
ggaggccatcactggacttggagtcagaagagtggagtcgggtcagacttcaactctgactttgaaggtggtgagtgcctc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]