GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-10-05 20:37:00, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_031722                 62 bp    RNA     linear   PRI 25-APR-2021
DEFINITION  Homo sapiens microRNA 103b-2 (MIR103B2), microRNA.
ACCESSION   NR_031722
VERSION     NR_031722.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 62)
  AUTHORS   Han LL, Yin XR and Zhang SQ.
  TITLE     miR-103 promotes the metastasis and EMT of hepatocellular carcinoma
            by directly inhibiting LATS2
  JOURNAL   Int J Oncol 53 (6), 2433-2444 (2018)
   PUBMED   30272278
  REMARK    GeneRIF: Clinical data indicates that a high expression of miR103
            is associated with the progression of hepatocellular carcinoma
            (HCC). Further results suggest that miR103 promotes HCC metastasis
            and EMT by directly inhibiting LATS2.
REFERENCE   2  (bases 1 to 62)
  AUTHORS   Wang DS, Zhong B, Zhang MS and Gao Y.
  TITLE     Upregulation of serum miR-103 predicts unfavorable prognosis in
            patients with colorectal cancer
  JOURNAL   Eur Rev Med Pharmacol Sci 22 (14), 4518-4523 (2018)
   PUBMED   30058684
  REMARK    GeneRIF: Study results demonstrated that serum miR-103 was
            overexpressed in colorectal cancer (CRC) subjects, could
            differentiate CRC cases from controls with relatively high
            accuracy, and significantly correlated with worse clinical factors,
            as well as poorer recurrence-free survival or overall survival.
            Taken together, serum miR-103 might be a promising biomarker for
            diagnosis and prognosis of CRC.
REFERENCE   3  (bases 1 to 62)
  AUTHORS   Xu Q, Li Y, Shang YF, Wang HL and Yao MX.
  TITLE     miRNA-103: molecular link between insulin resistance and
            nonalcoholic fatty liver disease
  JOURNAL   World J Gastroenterol 21 (2), 511-516 (2015)
   PUBMED   25593466
  REMARK    GeneRIF: miR-103 is involved in insulin resistance and NAFLD, and
            may be a molecular link between insulin resistance and NAFLD
REFERENCE   4  (bases 1 to 62)
  AUTHORS   Geng L, Sun B, Gao B, Wang Z, Quan C, Wei F and Fang XD.
  TITLE     MicroRNA-103 promotes colorectal cancer by targeting tumor
            suppressor DICER and PTEN
  JOURNAL   Int J Mol Sci 15 (5), 8458-8472 (2014)
   PUBMED   24828205
  REMARK    GeneRIF: MiR-103 significantly promotes cancer cell proliferation,
            invasion and metastasis, and, thus, could be an important mediator
            in the pathogenesis of colorectal cancer Through regulation of
            colorectal cancer cell DICER and PTEN expression.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 62)
  AUTHORS   Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H and
            Siomi MC.
  TITLE     Characterization of endogenous human Argonautes and their miRNA
            partners in RNA silencing
  JOURNAL   Proc Natl Acad Sci U S A 105 (23), 7964-7969 (2008)
   PUBMED   18524951
REFERENCE   6  (bases 1 to 62)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL353194.13.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-62                AL353194.13        56368-56429         c
FEATURES             Location/Qualifiers
     source          1..62
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="20"
                     /map="20p13"
     gene            1..62
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /note="microRNA 103b-2"
                     /db_xref="GeneID:100302282"
                     /db_xref="HGNC:HGNC:35385"
                     /db_xref="miRBase:MI0007262"
     precursor_RNA   1..62
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /product="microRNA 103b-2"
                     /db_xref="GeneID:100302282"
                     /db_xref="HGNC:HGNC:35385"
                     /db_xref="miRBase:MI0007262"
     exon            1..62
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           1..23
                     /ncRNA_class="miRNA"
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /product="hsa-miR-103b"
                     /db_xref="miRBase:MIMAT0007402"
                     /db_xref="GeneID:100302282"
                     /db_xref="HGNC:HGNC:35385"
                     /db_xref="miRBase:MI0007262"
     variation       1
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2146889685"
     variation       4
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2090582074"
     variation       7
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283132774"
     variation       10
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1222085747"
     variation       28
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868616864"
     variation       29
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372086073"
     variation       30
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1294959011"
     variation       32
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2515524880"
     variation       33
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1043321965"
     variation       34
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311787936"
     variation       36
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948718743"
     variation       42
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766345821"
     variation       49
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315599005"
     variation       51
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2515524833"
     variation       54
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1201044934"
     variation       60
                     /gene="MIR103B2"
                     /gene_synonym="hsa-mir-103-2-as; MIR103-2-AS; MIR103-2AS;
                     MIRN103-2AS"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319257633"
ORIGIN      
tcatagccctgtacaatgctgcttgacctgaatgctacaaggcagcactgtaaagaagctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]