ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-05 20:36:44, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_031721 62 bp RNA linear PRI 24-SEP-2022
DEFINITION Homo sapiens microRNA 103b-1 (MIR103B1), microRNA.
ACCESSION NR_031721
VERSION NR_031721.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 62)
AUTHORS Dahiya N and Atreya C.
TITLE MiRNA-103b Downregulates ITGB3 and Mediates Apoptosis in Ex Vivo
Stored Human Platelets
JOURNAL Microrna 10 (2), 123-129 (2021)
PUBMED 34086556
REFERENCE 2 (bases 1 to 62)
AUTHORS Luo M, Xu C, Luo Y, Wang G, Wu J and Wan Q.
TITLE Circulating miR-103 family as potential biomarkers for type 2
diabetes through targeting CAV-1 and SFRP4
JOURNAL Acta Diabetol 57 (3), 309-322 (2020)
PUBMED 31583475
REMARK GeneRIF: miR-103a and miR-103b had high complementarity and
conservation, modulated reporter gene expression through seed
sequences in the 3'UTRs of CAV-1 and SFRP4 mRNA, and negatively
regulated their mRNA and protein levels
REFERENCE 3 (bases 1 to 62)
AUTHORS Han LL, Yin XR and Zhang SQ.
TITLE miR-103 promotes the metastasis and EMT of hepatocellular carcinoma
by directly inhibiting LATS2
JOURNAL Int J Oncol 53 (6), 2433-2444 (2018)
PUBMED 30272278
REMARK GeneRIF: Clinical data indicates that a high expression of miR103
is associated with the progression of hepatocellular carcinoma
(HCC). Further results suggest that miR103 promotes HCC metastasis
and EMT by directly inhibiting LATS2.
REFERENCE 4 (bases 1 to 62)
AUTHORS Wang DS, Zhong B, Zhang MS and Gao Y.
TITLE Upregulation of serum miR-103 predicts unfavorable prognosis in
patients with colorectal cancer
JOURNAL Eur Rev Med Pharmacol Sci 22 (14), 4518-4523 (2018)
PUBMED 30058684
REMARK GeneRIF: Study results demonstrated that serum miR-103 was
overexpressed in colorectal cancer (CRC) subjects, could
differentiate CRC cases from controls with relatively high
accuracy, and significantly correlated with worse clinical factors,
as well as poorer recurrence-free survival or overall survival.
Taken together, serum miR-103 might be a promising biomarker for
diagnosis and prognosis of CRC.
REFERENCE 5 (bases 1 to 62)
AUTHORS Xu Q, Li Y, Shang YF, Wang HL and Yao MX.
TITLE miRNA-103: molecular link between insulin resistance and
nonalcoholic fatty liver disease
JOURNAL World J Gastroenterol 21 (2), 511-516 (2015)
PUBMED 25593466
REMARK GeneRIF: miR-103 is involved in insulin resistance and NAFLD, and
may be a molecular link between insulin resistance and NAFLD
REFERENCE 6 (bases 1 to 62)
AUTHORS Geng L, Sun B, Gao B, Wang Z, Quan C, Wei F and Fang XD.
TITLE MicroRNA-103 promotes colorectal cancer by targeting tumor
suppressor DICER and PTEN
JOURNAL Int J Mol Sci 15 (5), 8458-8472 (2014)
PUBMED 24828205
REMARK GeneRIF: MiR-103 significantly promotes cancer cell proliferation,
invasion and metastasis, and, thus, could be an important mediator
in the pathogenesis of colorectal cancer Through regulation of
colorectal cancer cell DICER and PTEN expression.
Publication Status: Online-Only
REFERENCE 7 (bases 1 to 62)
AUTHORS Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H and
Siomi MC.
TITLE Characterization of endogenous human Argonautes and their miRNA
partners in RNA silencing
JOURNAL Proc Natl Acad Sci U S A 105 (23), 7964-7969 (2008)
PUBMED 18524951
REFERENCE 8 (bases 1 to 62)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC020894.5.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-62 AC020894.5 116839-116900
FEATURES Location/Qualifiers
source 1..62
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q34"
gene 1..62
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/note="microRNA 103b-1"
/db_xref="GeneID:100302238"
/db_xref="HGNC:HGNC:35384"
/db_xref="miRBase:MI0007261"
precursor_RNA 1..62
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/product="microRNA 103b-1"
/db_xref="GeneID:100302238"
/db_xref="HGNC:HGNC:35384"
/db_xref="miRBase:MI0007261"
exon 1..62
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/inference="alignment:Splign:2.1.0"
ncRNA 1..23
/ncRNA_class="miRNA"
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/product="hsa-miR-103b"
/db_xref="miRBase:MIMAT0007402"
/db_xref="GeneID:100302238"
/db_xref="HGNC:HGNC:35384"
/db_xref="miRBase:MI0007261"
variation 2
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="c"
/db_xref="dbSNP:2533448541"
variation 4
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:369221403"
variation 6
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1759436432"
variation 9
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1759436474"
variation 14
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="g"
/db_xref="dbSNP:572980521"
variation 15
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:748411363"
variation 19
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1759436614"
variation 23
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:769854452"
variation 24
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1414823069"
variation 27
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1759436752"
variation 30
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1759436799"
variation 31
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:370346491"
variation 33
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1230188403"
variation 35
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1759436926"
variation 38
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1759436961"
variation 43
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1759437015"
variation 45
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1031876357"
variation 47
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="c"
/db_xref="dbSNP:773654610"
variation 48
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1759437137"
variation 49
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:763264678"
variation 50
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1257538371"
variation 51
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:771317046"
variation 59
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1759437340"
variation 60
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="c"
/replace="t"
/db_xref="dbSNP:201456319"
variation 61
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1242639044"
variation 62
/gene="MIR103B1"
/gene_synonym="hsa-mir-103-1-as; MIR103-1AS; MIRN103-1AS"
/replace="a"
/replace="t"
/db_xref="dbSNP:2533448589"
ORIGIN
tcatagccctgtacaatgctgcttgatccatatgcaacaaggcagcactgtaaagaagccga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]