GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-10-05 20:36:59, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_031718                 61 bp    RNA     linear   PRI 04-SEP-2020
DEFINITION  Homo sapiens microRNA 1537 (MIR1537), microRNA.
ACCESSION   NR_031718
VERSION     NR_031718.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 61)
  AUTHORS   Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH and Provost P.
  TITLE     The repertoire and features of human platelet microRNAs
  JOURNAL   PLoS ONE 7 (12), e50746 (2012)
   PUBMED   23226537
REFERENCE   2  (bases 1 to 61)
  AUTHORS   Kozomara A and Griffiths-Jones S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res. 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   3  (bases 1 to 61)
  AUTHORS   Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC,
            Parsons PG, Schmidt C, Sturm RA and Hayward NK.
  TITLE     Characterization of the Melanoma miRNAome by Deep Sequencing
  JOURNAL   PLoS ONE 5 (3), e9685 (2010)
   PUBMED   20300190
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 61)
  AUTHORS   Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H and
            Siomi MC.
  TITLE     Characterization of endogenous human Argonautes and their miRNA
            partners in RNA silencing
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 105 (23), 7964-7969 (2008)
   PUBMED   18524951
REFERENCE   5  (bases 1 to 61)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL133286.9.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM610206.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-61                AL133286.9         18621-18681         c
FEATURES             Location/Qualifiers
     source          1..61
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q42.3"
     gene            1..61
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /note="microRNA 1537"
                     /db_xref="GeneID:100302139"
                     /db_xref="HGNC:HGNC:35381"
                     /db_xref="miRBase:MI0007258"
     precursor_RNA   1..61
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /product="microRNA 1537"
                     /db_xref="GeneID:100302139"
                     /db_xref="HGNC:HGNC:35381"
                     /db_xref="miRBase:MI0007258"
     exon            1..61
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           3..24
                     /ncRNA_class="miRNA"
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /product="hsa-miR-1537-5p"
                     /db_xref="miRBase:MIMAT0026765"
                     /db_xref="GeneID:100302139"
                     /db_xref="HGNC:HGNC:35381"
                     /db_xref="miRBase:MI0007258"
     variation       3
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1427677321"
     variation       4
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1678730205"
     variation       7
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753867118"
     variation       10
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1678729442"
     variation       11..12
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1572459389"
     variation       13..19
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="agt"
                     /replace="agtcagt"
                     /db_xref="dbSNP:1678727460"
     variation       13
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1283278090"
     variation       14
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192140250"
     variation       17
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:570217974"
     variation       30
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1678726938"
     variation       32
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1678726410"
     variation       34
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1678725895"
     ncRNA           40..61
                     /ncRNA_class="miRNA"
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /product="hsa-miR-1537-3p"
                     /db_xref="miRBase:MIMAT0007399"
                     /db_xref="GeneID:100302139"
                     /db_xref="HGNC:HGNC:35381"
                     /db_xref="miRBase:MI0007258"
     variation       44
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1678725310"
     variation       45
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566982898"
     variation       46
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331850293"
     variation       49
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1678724051"
     variation       51
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1678723581"
     variation       53
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341864544"
     variation       57
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919863023"
     variation       60
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113301642"
     variation       61
                     /gene="MIR1537"
                     /gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1678721735"
ORIGIN      
acagctgtaattagtcagttttctgtcctgtccacacagaaaaccgtctagttacagttgt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]