ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-05 20:36:59, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_031718 61 bp RNA linear PRI 04-SEP-2020
DEFINITION Homo sapiens microRNA 1537 (MIR1537), microRNA.
ACCESSION NR_031718
VERSION NR_031718.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 61)
AUTHORS Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH and Provost P.
TITLE The repertoire and features of human platelet microRNAs
JOURNAL PLoS ONE 7 (12), e50746 (2012)
PUBMED 23226537
REFERENCE 2 (bases 1 to 61)
AUTHORS Kozomara A and Griffiths-Jones S.
TITLE miRBase: integrating microRNA annotation and deep-sequencing data
JOURNAL Nucleic Acids Res. 39 (Database issue), D152-D157 (2011)
PUBMED 21037258
REFERENCE 3 (bases 1 to 61)
AUTHORS Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC,
Parsons PG, Schmidt C, Sturm RA and Hayward NK.
TITLE Characterization of the Melanoma miRNAome by Deep Sequencing
JOURNAL PLoS ONE 5 (3), e9685 (2010)
PUBMED 20300190
REMARK Publication Status: Online-Only
REFERENCE 4 (bases 1 to 61)
AUTHORS Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H and
Siomi MC.
TITLE Characterization of endogenous human Argonautes and their miRNA
partners in RNA silencing
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 105 (23), 7964-7969 (2008)
PUBMED 18524951
REFERENCE 5 (bases 1 to 61)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL133286.9.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
##Evidence-Data-START##
Transcript is intronless :: LM610206.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-61 AL133286.9 18621-18681 c
FEATURES Location/Qualifiers
source 1..61
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q42.3"
gene 1..61
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/note="microRNA 1537"
/db_xref="GeneID:100302139"
/db_xref="HGNC:HGNC:35381"
/db_xref="miRBase:MI0007258"
precursor_RNA 1..61
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/product="microRNA 1537"
/db_xref="GeneID:100302139"
/db_xref="HGNC:HGNC:35381"
/db_xref="miRBase:MI0007258"
exon 1..61
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/inference="alignment:Splign:2.1.0"
ncRNA 3..24
/ncRNA_class="miRNA"
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/product="hsa-miR-1537-5p"
/db_xref="miRBase:MIMAT0026765"
/db_xref="GeneID:100302139"
/db_xref="HGNC:HGNC:35381"
/db_xref="miRBase:MI0007258"
variation 3
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1427677321"
variation 4
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1678730205"
variation 7
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="c"
/replace="g"
/db_xref="dbSNP:753867118"
variation 10
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="g"
/db_xref="dbSNP:1678729442"
variation 11..12
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1572459389"
variation 13..19
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="agt"
/replace="agtcagt"
/db_xref="dbSNP:1678727460"
variation 13
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="c"
/db_xref="dbSNP:1283278090"
variation 14
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="g"
/replace="t"
/db_xref="dbSNP:192140250"
variation 17
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:570217974"
variation 30
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="g"
/db_xref="dbSNP:1678726938"
variation 32
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="c"
/replace="g"
/db_xref="dbSNP:1678726410"
variation 34
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="g"
/db_xref="dbSNP:1678725895"
ncRNA 40..61
/ncRNA_class="miRNA"
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/product="hsa-miR-1537-3p"
/db_xref="miRBase:MIMAT0007399"
/db_xref="GeneID:100302139"
/db_xref="HGNC:HGNC:35381"
/db_xref="miRBase:MI0007258"
variation 44
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="c"
/db_xref="dbSNP:1678725310"
variation 45
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:566982898"
variation 46
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="g"
/db_xref="dbSNP:1331850293"
variation 49
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="c"
/replace="t"
/db_xref="dbSNP:1678724051"
variation 51
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1678723581"
variation 53
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="c"
/replace="t"
/db_xref="dbSNP:1341864544"
variation 57
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="g"
/db_xref="dbSNP:919863023"
variation 60
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:113301642"
variation 61
/gene="MIR1537"
/gene_synonym="hsa-mir-1537; mir-1537; MIRN1537"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1678721735"
ORIGIN
acagctgtaattagtcagttttctgtcctgtccacacagaaaaccgtctagttacagttgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]