ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-05 17:50:29, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_031651 66 bp RNA linear PRI 04-JAN-2024
DEFINITION Homo sapiens microRNA 1249 (MIR1249), microRNA.
ACCESSION NR_031651
VERSION NR_031651.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 66)
AUTHORS Mazziotta C, Iaquinta MR, Tramarin ML, Badiale G, Cervellera CF,
Tonnini G, Patergnani S, Pinton P, Lanza G, Gafa R, Tognon M,
Martini F, De Mattei M and Rotondo JC.
TITLE Hsa-microRNA-1249-3p/Homeobox A13 axis modulates the expression of
beta-catenin gene in human epithelial cells
JOURNAL Sci Rep 13 (1), 22872 (2023)
PUBMED 38129477
REMARK GeneRIF: Hsa-microRNA-1249-3p/Homeobox A13 axis modulates the
expression of beta-catenin gene in human epithelial cells.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 66)
AUTHORS Zhang Q, Ding F, Zhang C, Han X and Cheng H.
TITLE Circ_0001715 Functions as a miR-1249-3p Sponge to Accelerate the
Progression of Non-small Cell Lung Cancer via Upregulating the
Level of FGF5
JOURNAL Biochem Genet 61 (5), 1807-1826 (2023)
PUBMED 36808266
REMARK GeneRIF: Circ_0001715 Functions as a miR-1249-3p Sponge to
Accelerate the Progression of Non-small Cell Lung Cancer via
Upregulating the Level of FGF5.
REFERENCE 3 (bases 1 to 66)
AUTHORS Su Y, Tan R, Sun M, Yuan L, Ruiz M, Dupuis J, Hu Q and Zhu L.
TITLE MiR-1249 on Endothelial Extracellular Vesicles Mediates Cigarette
Smoke-Induced Pulmonary Hypertension by Inhibiting HDAC10 (Histone
Deacetylase 10)-NFkappaB (Nuclear Factor kappaB)-CaSR
(Calcium-Sensing Receptor) Cascade
JOURNAL Hypertension 79 (12), 2721-2732 (2022)
PUBMED 36252137
REMARK GeneRIF: MiR-1249 on Endothelial Extracellular Vesicles Mediates
Cigarette Smoke-Induced Pulmonary Hypertension by Inhibiting HDAC10
(Histone Deacetylase 10)-NFkappaB (Nuclear Factor kappaB)-CaSR
(Calcium-Sensing Receptor) Cascade.
REFERENCE 4 (bases 1 to 66)
AUTHORS Liu J and Fu Z.
TITLE Identification of a Novel circ_0010235/miR-1249-3p/HOXA13 Axis in
Lung Adenocarcinoma
JOURNAL Biochem Genet 60 (5), 1657-1675 (2022)
PUBMED 35076814
REMARK GeneRIF: Identification of a Novel circ_0010235/miR-1249-3p/HOXA13
Axis in Lung Adenocarcinoma.
REFERENCE 5 (bases 1 to 66)
AUTHORS Yang XM, Song YQ, Li L, Liu DM and Chen GD.
TITLE miR-1249-5p regulates the osteogenic differentiation of ADSCs by
targeting PDX1
JOURNAL J Orthop Surg Res 16 (1), 10 (2021)
PUBMED 33407691
REMARK GeneRIF: miR-1249-5p regulates the osteogenic differentiation of
ADSCs by targeting PDX1.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 66)
AUTHORS Wang R, Zhang YY, Lu JS, Xia BH, Yang ZX, Zhu XD, Zhou XW and Huang
PT.
TITLE The highly pathogenic H5N1 influenza A virus down-regulated several
cellular MicroRNAs which target viral genome
JOURNAL J Cell Mol Med 21 (11), 3076-3086 (2017)
PUBMED 28609011
REMARK GeneRIF: Two miRNAs, miR-584-5p and miR-1249, that matched with the
PB2 binding sequence, dramatically down-regulated PB2 expression,
and inhibited replication of H5N1 and H1N1 influenza A virus
strains in A549 cells.
REFERENCE 7 (bases 1 to 66)
AUTHORS Kaudewitz D, Skroblin P, Bender LH, Barwari T, Willeit P, Pechlaner
R, Sunderland NP, Willeit K, Morton AC, Armstrong PC, Chan MV, Lu
R, Yin X, Gracio F, Dudek K, Langley SR, Zampetaki A, de Rinaldis
E, Ye S, Warner TD, Saxena A, Kiechl S, Storey RF and Mayr M.
TITLE Association of MicroRNAs and YRNAs With Platelet Function
JOURNAL Circ Res 118 (3), 420-432 (2016)
PUBMED 26646931
REFERENCE 8 (bases 1 to 66)
AUTHORS Scaravilli M, Porkka KP, Brofeldt A, Annala M, Tammela TL, Jenster
GW, Nykter M and Visakorpi T.
TITLE MiR-1247-5p is overexpressed in castration resistant prostate
cancer and targets MYCBP2
JOURNAL Prostate 75 (8), 798-805 (2015)
PUBMED 25731699
REFERENCE 9 (bases 1 to 66)
AUTHORS Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu
AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ and Marra MA.
TITLE Application of massively parallel sequencing to microRNA profiling
and discovery in human embryonic stem cells
JOURNAL Genome Res 18 (4), 610-621 (2008)
PUBMED 18285502
REMARK Erratum:[Genome Res. 2009 May;19(5):958]
REFERENCE 10 (bases 1 to 66)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL008718.23.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-66 AL008718.23 22612-22677 c
FEATURES Location/Qualifiers
source 1..66
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="22"
/map="22q13.31"
gene 1..66
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/note="microRNA 1249"
/db_xref="GeneID:100302149"
/db_xref="HGNC:HGNC:35315"
/db_xref="miRBase:MI0006384"
precursor_RNA 1..66
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/product="microRNA 1249"
/db_xref="GeneID:100302149"
/db_xref="HGNC:HGNC:35315"
/db_xref="miRBase:MI0006384"
exon 1..66
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/inference="alignment:Splign:2.1.0"
variation 1..15
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="gggaggag"
/replace="gggaggagggaggag"
/replace="gggaggagggaggagggaggag"
/db_xref="dbSNP:753665756"
variation 1
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="g"
/db_xref="dbSNP:2518062032"
ncRNA 4..27
/ncRNA_class="miRNA"
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/product="hsa-miR-1249-5p"
/db_xref="miRBase:MIMAT0032029"
/db_xref="GeneID:100302149"
/db_xref="HGNC:HGNC:35315"
/db_xref="miRBase:MI0006384"
variation 4
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="g"
/db_xref="dbSNP:1428329405"
variation 7
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:761335728"
variation 8
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="g"
/replace="t"
/db_xref="dbSNP:1029013080"
variation 12
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1399375206"
variation 13
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="g"
/db_xref="dbSNP:776038412"
variation 14
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="c"
/db_xref="dbSNP:2083584092"
variation 16
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="aa"
/db_xref="dbSNP:766236574"
variation 16
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:568509176"
variation 17
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:1569071809"
variation 19
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="g"
/db_xref="dbSNP:746269146"
variation 21
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:2083583939"
variation 22
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:779104734"
variation 25
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="g"
/replace="t"
/db_xref="dbSNP:1437874588"
variation 26
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="g"
/replace="t"
/db_xref="dbSNP:997039598"
variation 28
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:962879780"
variation 29
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1329738969"
variation 30
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="g"
/db_xref="dbSNP:1463684960"
variation 32
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:2083583760"
variation 34
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="g"
/db_xref="dbSNP:1242355400"
variation 36
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:548285742"
variation 37
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="g"
/replace="t"
/db_xref="dbSNP:1170487571"
ncRNA 41..62
/ncRNA_class="miRNA"
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/product="hsa-miR-1249-3p"
/db_xref="miRBase:MIMAT0005901"
/db_xref="GeneID:100302149"
/db_xref="HGNC:HGNC:35315"
/db_xref="miRBase:MI0006384"
variation 42
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:748877788"
variation 43
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="g"
/db_xref="dbSNP:374284482"
variation 44
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1192845661"
variation 45
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468862499"
variation 46
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:2083583564"
variation 47..48
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:760510027"
variation 47
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:899425140"
variation 49..55
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="cccccc"
/replace="ccccccc"
/replace="cccccccc"
/db_xref="dbSNP:764079139"
variation 49
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294104796"
variation 50
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1196549122"
variation 51
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:755615861"
variation 53
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:781165672"
variation 54
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766032834"
variation 55
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="g"
/db_xref="dbSNP:889284862"
variation 57
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:757611155"
variation 62
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="a"
/replace="g"
/db_xref="dbSNP:933407079"
variation 63
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:1376834156"
variation 64
/gene="MIR1249"
/gene_synonym="hsa-mir-1249; MIRN1249"
/replace="c"
/replace="t"
/db_xref="dbSNP:2083583187"
ORIGIN
gggaggagggaggagatgggccaagttccctctggctggaacgcccttcccccccttcttcacctg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]