2024-05-03 07:41:45, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_031607 85 bp RNA linear PRI 15-FEB-2021 DEFINITION Homo sapiens microRNA 1203 (MIR1203), microRNA. ACCESSION NR_031607 VERSION NR_031607.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 85) AUTHORS Luo T, Yan L and Liu H. TITLE LINC00632 inhibits the malignant development of non-small cell lung cancer by downregulating miR-1203 JOURNAL J BUON 25 (3), 1517-1524 (2020) PUBMED 32862599 REMARK GeneRIF: LINC00632 inhibits the malignant development of non-small cell lung cancer by downregulating miR-1203. REFERENCE 2 (bases 1 to 85) AUTHORS Shi J, Li X, Hu Y, Zhang F, Lv X, Zhang X, Chen Q and Hu S. TITLE MiR-1203 is involved in hepatocellular carcinoma metastases and indicates a poor prognosis JOURNAL Neoplasma 67 (2), 267-276 (2020) PUBMED 31847527 REMARK GeneRIF: MiR-1203 is involved in hepatocellular carcinoma metastases and indicates a poor prognosis. REFERENCE 3 (bases 1 to 85) AUTHORS Xu HB, Zheng YF, Wu D, Li Y, Zhou LN and Chen YG. TITLE microRNA-1203 targets and silences cyclophilin D to protect human endometrial cells from oxygen and glucose deprivation-re-oxygenation JOURNAL Aging (Albany NY) 12 (3), 3010-3024 (2020) PUBMED 32041924 REMARK GeneRIF: microRNA-1203 targets and silences cyclophilin D to protect human endometrial cells from oxygen and glucose deprivation-re-oxygenation. REFERENCE 4 (bases 1 to 85) AUTHORS Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T and Miyajima A. TITLE Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs JOURNAL Sci Rep 7 (1), 7780 (2017) PUBMED 28798470 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 85) AUTHORS Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G and Cayota A. TITLE Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis JOURNAL Leukemia 22 (2), 330-338 (2008) PUBMED 17989717 REFERENCE 6 (bases 1 to 85) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC006468.10. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-85 AC006468.10 24703-24787 FEATURES Location/Qualifiers source 1..85 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="17" /map="17q21.32" gene 1..85 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /note="microRNA 1203" /db_xref="GeneID:100302211" /db_xref="HGNC:HGNC:35269" /db_xref="miRBase:MI0006335" precursor_RNA 1..85 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /product="microRNA 1203" /db_xref="GeneID:100302211" /db_xref="HGNC:HGNC:35269" /db_xref="miRBase:MI0006335" exon 1..85 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:1598375873" variation 2 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1212885775" variation 3 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="g" /db_xref="dbSNP:924393341" variation 4 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:1598375862" variation 5 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:1364121351" ncRNA 6..26 /ncRNA_class="miRNA" /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /product="hsa-miR-1203" /db_xref="miRBase:MIMAT0005866" /db_xref="GeneID:100302211" /db_xref="HGNC:HGNC:35269" /db_xref="miRBase:MI0006335" variation 8 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:547972348" variation 9..10 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="g" /replace="gg" /db_xref="dbSNP:745577400" variation 9 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:764824939" variation 10 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:2063979583" variation 11 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="c" /db_xref="dbSNP:2143212940" variation 12 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:995110609" variation 17 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1231461203" variation 18 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1338531929" variation 20 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:1439248445" variation 23 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:759274065" variation 26 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="c" /db_xref="dbSNP:1399107302" variation 29 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:1397225938" variation 31 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="c" /db_xref="dbSNP:370132472" variation 32 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:971148331" variation 33 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="c" /db_xref="dbSNP:770750211" variation 34 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="c" /db_xref="dbSNP:2143212576" variation 36 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="g" /db_xref="dbSNP:760600373" variation 37 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:2143212502" variation 38 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:2063978984" variation 39 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:773079400" variation 41 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:772132659" variation 43 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:1185828122" variation 46 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1461993785" variation 48 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:377012273" variation 49 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:779157281" variation 50 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:1598375745" variation 52 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:769023712" variation 55 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:1273851060" variation 56 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="t" /db_xref="dbSNP:1567796918" variation 59 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:749572635" variation 65 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:780536735" variation 68 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:117091718" variation 69 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="g" /replace="t" /db_xref="dbSNP:2063978303" variation 74 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:750931820" variation 75 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:781566509" variation 76 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1296220394" variation 78 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="g" /db_xref="dbSNP:757861784" variation 79 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:373807500" variation 80 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="g" /replace="t" /db_xref="dbSNP:1598375672" variation 81 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="g" /db_xref="dbSNP:1332949319" variation 82 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="c" /replace="t" /db_xref="dbSNP:752166614" variation 83 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="a" /replace="g" /db_xref="dbSNP:368862137" variation 84 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="g" /replace="t" /db_xref="dbSNP:764848039" variation 85 /gene="MIR1203" /gene_synonym="hsa-mir-1203; MIRN1203" /replace="g" /replace="t" /db_xref="dbSNP:1383931148" ORIGIN
tcctccccggagccaggatgcagctcaagccacagcagggtgtttagcgctcttcagtggctccagattgtggcgctggtgcagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]