2025-09-18 01:40:10, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_001440352 1549 bp mRNA linear PRI 20-MAY-2025 DEFINITION Homo sapiens CD44 molecule (IN blood group) (CD44), transcript variant 37, mRNA. ACCESSION NM_001440352 XM_011520489 XM_054370583 VERSION NM_001440352.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1549) AUTHORS Li,C., Zhang,Y., Wang,Y., Ouyang,J., Yang,Y., Zhu,Q., Lu,Y., Kang,T., Li,Y., Xia,M., Chen,J., Li,Q., Zhu,C. and Ye,L. TITLE RNA-binding protein LSM7 facilitates breast cancer metastasis through mediating alternative splicing of CD44 JOURNAL Life Sci 356, 123013 (2024) PUBMED 39182568 REMARK GeneRIF: RNA-binding protein LSM7 facilitates breast cancer metastasis through mediating alternative splicing of CD44. REFERENCE 2 (bases 1 to 1549) AUTHORS Kashif,M., Jahan,S., Minhas,S., Amar,A., Tahir,R., Nisar,H., Shehzad,F., Nagi,A.H. and Afzal,N. TITLE Genetic Signatures: CD44 Single-Nucleotide Polymorphisms Affect Cell Surface Expression and Elevate Risk in Head and Neck Squamous Cell Carcinoma JOURNAL JCO Glob Oncol 10, e2400084 (2024) PUBMED 39481067 REMARK GeneRIF: Genetic Signatures: CD44 Single-Nucleotide Polymorphisms Affect Cell Surface Expression and Elevate Risk in Head and Neck Squamous Cell Carcinoma. Erratum:[JCO Glob Oncol. 2025 Jan;11:e2400651. doi: 10.1200/GO-24-00651. PMID: 39883899] REFERENCE 3 (bases 1 to 1549) AUTHORS Kainulainen,K., Niskanen,E.A., Kinnunen,J., Maki-Mantila,K., Hartikainen,K., Paakinaho,V., Malinen,M., Ketola,K. and Pasonen-Seppanen,S. TITLE Secreted factors from M1 macrophages drive prostate cancer stem cell plasticity by upregulating NANOG, SOX2, and CD44 through NFkappaB-signaling JOURNAL Oncoimmunology 13 (1), 2393442 (2024) PUBMED 39175947 REMARK GeneRIF: Secreted factors from M1 macrophages drive prostate cancer stem cell plasticity by upregulating NANOG, SOX2, and CD44 through NFkappaB-signaling. Publication Status: Online-Only REFERENCE 4 (bases 1 to 1549) AUTHORS Yan,H., Xing,Z., Liu,S., Gao,P., Wang,Q. and Guo,G. TITLE CALCR exacerbates renal cell carcinoma progression via stabilizing CD44 JOURNAL Aging (Albany NY) 16 (13), 10765-10783 (2024) PUBMED 38985127 REMARK GeneRIF: CALCR exacerbates renal cell carcinoma progression via stabilizing CD44. REFERENCE 5 (bases 1 to 1549) AUTHORS Liang,S., Li,L., Guo,Z., Sun,H. and Yang,Y. TITLE Co-expression of CD44v6 and MMP2 predicts lung metastasis and unfavorable prognosis in osteosarcoma JOURNAL Future Oncol 20 (25), 1799-1806 (2024) PUBMED 39011948 REMARK GeneRIF: Co-expression of CD44v6 and MMP2 predicts lung metastasis and unfavorable prognosis in osteosarcoma. REFERENCE 6 (bases 1 to 1549) AUTHORS Screaton,G.R., Bell,M.V., Jackson,D.G., Cornelis,F.B., Gerth,U. and Bell,J.I. TITLE Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons JOURNAL Proc Natl Acad Sci U S A 89 (24), 12160-12164 (1992) PUBMED 1465456 REFERENCE 7 (bases 1 to 1549) AUTHORS Kugelman,L.C., Ganguly,S., Haggerty,J.G., Weissman,S.M. and Milstone,L.M. TITLE The core protein of epican, a heparan sulfate proteoglycan on keratinocytes, is an alternative form of CD44 JOURNAL J Invest Dermatol 99 (6), 886-891 (1992) PUBMED 1281868 REFERENCE 8 (bases 1 to 1549) AUTHORS Arch,R., Wirth,K., Hofmann,M., Ponta,H., Matzku,S., Herrlich,P. and Zoller,M. TITLE Participation in normal immune responses of a metastasis-inducing splice variant of CD44 JOURNAL Science 257 (5070), 682-685 (1992) PUBMED 1496383 REFERENCE 9 (bases 1 to 1549) AUTHORS Jackson,D.G., Buckley,J. and Bell,J.I. TITLE Multiple variants of the human lymphocyte homing receptor CD44 generated by insertions at a single site in the extracellular domain JOURNAL J Biol Chem 267 (7), 4732-4739 (1992) PUBMED 1537855 REFERENCE 10 (bases 1 to 1549) AUTHORS Aruffo,A., Stamenkovic,I., Melnick,M., Underhill,C.B. and Seed,B. TITLE CD44 is the principal cell surface receptor for hyaluronate JOURNAL Cell 61 (7), 1303-1313 (1990) PUBMED 1694723 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL356215.11 and AL133330.14. On or before May 19, 2025 this sequence version replaced XM_011520489.4, XM_054370583.1. Summary: The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR12921934.3535048.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-200 AL356215.11 23071-23270 c 201-366 AL133330.14 175136-175301 c 367-500 AL133330.14 171469-171602 c 501-569 AL133330.14 164976-165044 c 570-800 AL133330.14 161811-162041 c 801-926 AL133330.14 153630-153755 c 927-1040 AL133330.14 150681-150794 c 1041-1157 AL133330.14 150089-150205 c 1158-1286 AL133330.14 147236-147364 c 1287-1549 AL133330.14 145829-146091 c FEATURES Location/Qualifiers source 1..1549 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="11" /map="11p13" gene 1..1549 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /note="CD44 molecule (IN blood group)" /db_xref="GeneID:960" /db_xref="HGNC:HGNC:1681" /db_xref="MIM:107269" exon 1..200 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="alignment:Splign:2.1.0" CDS 134..1342 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /note="isoform 37 precursor is encoded by transcript variant 37; hematopoietic cell E- and L-selectin ligand; chondroitin sulfate proteoglycan 8; cell surface glycoprotein CD44; GP90 lymphocyte homing/adhesion receptor; heparan sulfate proteoglycan; hyaluronate receptor; Indian blood group antigen; Hermes antigen; homing function and Indian blood group system; CD44 antigen; CD44 molecule (Indian blood group); phagocyte glycoprotein 1; In(Lu) related-p80; homing cell adhesion molecule; epican; soluble CD44; phagocytic glycoprotein 1; extracellular matrix receptor III" /codon_start=1 /product="CD44 antigen isoform 37 precursor" /protein_id="NP_001427281.1" /db_xref="GeneID:960" /db_xref="HGNC:HGNC:1681" /db_xref="MIM:107269" /translation="
MDKFWWHAAWGLCLVPLSLAQIDLNITCRFAGVFHVEKNGRYSISRTEAADLCKAFNSTLPTMAQMEKALSIGFETCRYGFIEGHVVIPRIHPNSICAANNTGVYILTSNTSQYDTYCFNASAPPEEDCTSVTDLPNAFDGPITITIVNRDGTRYVQKGEYRTNPEDIYPSNPTDDDVSSGSSSERSSTSGGYIFYTFSTVHPIPDEDSPWITDSTDRIPATSTSSNTISAGWEPNEENEDERDRHLSFSGSGIDDDEDFISSTISTTPRAFDHTKQNQDWTQWNPSHSNPEVLLQTTTRMTDVDRNGTTAYEGNWNPEAHPPLIHHEHHEEEETPHSTSTIQATPSSTTEETATQKEQWFGNRWHEGYRQTPKEDSHSTTGTAGDCGSMAWVKKYFSFIFL"
sig_peptide 134..193 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="COORDINATES: ab initio prediction:SignalP:6.0" exon 201..366 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="alignment:Splign:2.1.0" exon 367..500 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="alignment:Splign:2.1.0" exon 501..569 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="alignment:Splign:2.1.0" exon 570..800 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="alignment:Splign:2.1.0" exon 801..926 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="alignment:Splign:2.1.0" exon 927..1040 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="alignment:Splign:2.1.0" exon 1041..1157 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="alignment:Splign:2.1.0" exon 1158..1286 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="alignment:Splign:2.1.0" exon 1287..1549 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /inference="alignment:Splign:2.1.0" regulatory 1525..1530 /regulatory_class="polyA_signal_sequence" /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /note="hexamer: AATAAA" polyA_site 1549 /gene="CD44" /gene_synonym="CDW44; CSPG8; ECM-III; ECMR-III; H-CAM; HCELL; Hermes-1; HUTCH-1; HUTCH-I; LHR; MC56; MDU2; MDU3; MIC4; Pgp1" /note="major polyA site" ORIGIN
ctcattgcccagcggaccccagcctctgccaggttcggtccgccatcctcgtcccgtcctccgccggcccctgccccgcgcccagggatcctccagctcctttcgcccgcgccctccgttcgctccggacaccatggacaagttttggtggcacgcagcctggggactctgcctcgtgccgctgagcctggcgcagatcgatttgaatataacctgccgctttgcaggtgtattccacgtggagaaaaatggtcgctacagcatctctcggacggaggccgctgacctctgcaaggctttcaatagcaccttgcccacaatggcccagatggagaaagctctgagcatcggatttgagacctgcaggtatgggttcatagaagggcacgtggtgattccccggatccaccccaactccatctgtgcagcaaacaacacaggggtgtacatcctcacatccaacacctcccagtatgacacatattgcttcaatgcttcagctccacctgaagaagattgtacatcagtcacagacctgcccaatgcctttgatggaccaattaccataactattgttaaccgtgatggcacccgctatgtccagaaaggagaatacagaacgaatcctgaagacatctaccccagcaaccctactgatgatgacgtgagcagcggctcctccagtgaaaggagcagcacttcaggaggttacatcttttacaccttttctactgtacaccccatcccagacgaagacagtccctggatcaccgacagcacagacagaatccctgctaccagtacgtcttcaaataccatctcagcaggctgggagccaaatgaagaaaatgaagatgaaagagacagacacctcagtttttctggatcaggcattgatgatgatgaagattttatctccagcaccatttcaaccacaccacgggcttttgaccacacaaaacagaaccaggactggacccagtggaacccaagccattcaaatccggaagtgctacttcagacaaccacaaggatgactgatgtagacagaaatggcaccactgcttatgaaggaaactggaacccagaagcacaccctcccctcattcaccatgagcatcatgaggaagaagagaccccacattctacaagcacaatccaggcaactcctagtagtacaacggaagaaacagctacccagaaggaacagtggtttggcaacagatggcatgagggatatcgccaaacacccaaagaagactcccattcgacaacagggacagctggggactgtggcagcatggcatgggtcaagaagtacttctccttcatcttcctttgatgtcggtaactcatcctttctgcactgcgggagttgttaatgcttttgtgtcctccagttcacatgctgattgctaagaagaaaatgagcatgagtgaacccaaagctgctgaaacattctgcgtttatgcaacttccttgccctctatacaaggaagatggtttcattgtcttgtctagagaataaagtcttttttaaaaataaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]