GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-04 12:00:28, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001406525            6403 bp    mRNA    linear   PRI 14-OCT-2024
DEFINITION  Homo sapiens ATPase copper transporting beta (ATP7B), transcript
            variant 20, mRNA.
ACCESSION   NM_001406525
VERSION     NM_001406525.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6403)
  AUTHORS   Zhang,K., Qu,C., Zhou,P., Yang,Z. and Wu,X.
  TITLE     Integrative analysis of the cuproptosis-related gene ATP7B in the
            prognosis and immune infiltration of IDH1 wild-type glioma
  JOURNAL   Gene 905, 148220 (2024)
   PUBMED   38286269
  REMARK    GeneRIF: Integrative analysis of the cuproptosis-related gene ATP7B
            in the prognosis and immune infiltration of IDH1 wild-type glioma.
REFERENCE   2  (bases 1 to 6403)
  AUTHORS   Ruturaj, Mishra,M., Saha,S., Maji,S., Rodriguez-Boulan,E.,
            Schreiner,R. and Gupta,A.
  TITLE     Regulation of the apico-basolateral trafficking polarity of the
            homologous copper-ATPases ATP7A and ATP7B
  JOURNAL   J Cell Sci 137 (5) (2024)
   PUBMED   38032054
  REMARK    GeneRIF: Regulation of the apico-basolateral trafficking polarity
            of the homologous copper-ATPases ATP7A and ATP7B.
REFERENCE   3  (bases 1 to 6403)
  AUTHORS   Tavares,L.A., Rodrigues,R.L., Santos da Costa,C., Nascimento,J.A.,
            Vargas de Carvalho,J., Nogueira de Carvalho,A., Mardones,G.A. and
            daSilva,L.L.P.
  TITLE     AP-1gamma2 is an adaptor protein 1 variant required for
            endosome-to-Golgi trafficking of the mannose-6-P receptor (CI-MPR)
            and ATP7B copper transporter
  JOURNAL   J Biol Chem 300 (3), 105700 (2024)
   PUBMED   38307383
  REMARK    GeneRIF: AP-1gamma2 is an adaptor protein 1 variant required for
            endosome-to-Golgi trafficking of the mannose-6-P receptor (CI-MPR)
            and ATP7B copper transporter.
REFERENCE   4  (bases 1 to 6403)
  AUTHORS   Gorukmez,O., Ozgur,T., Gorukmez,O. and Topak,A.
  TITLE     ATP7B Gene Variant Profile Identified by NGS in Wilson's Disease
  JOURNAL   Fetal Pediatr Pathol 42 (6), 891-900 (2023)
   PUBMED   37737146
  REMARK    GeneRIF: ATP7B Gene Variant Profile Identified by NGS in Wilson's
            Disease.
REFERENCE   5  (bases 1 to 6403)
  AUTHORS   Petrukhin,K., Lutsenko,S., Chernov,I., Ross,B.M., Kaplan,J.H. and
            Gilliam,T.C.
  TITLE     Characterization of the Wilson disease gene encoding a P-type
            copper transporting ATPase: genomic organization, alternative
            splicing, and structure/function predictions
  JOURNAL   Hum Mol Genet 3 (9), 1647-1656 (1994)
   PUBMED   7833924
REFERENCE   6  (bases 1 to 6403)
  AUTHORS   Petrukhin,K., Fischer,S.G., Pirastu,M., Tanzi,R.E., Chernov,I.,
            Devoto,M., Brzustowicz,L.M., Cayanis,E., Vitale,E., Russo,J.J. et
            al.
  TITLE     Mapping, cloning and genetic characterization of the region
            containing the Wilson disease gene
  JOURNAL   Nat Genet 5 (4), 338-343 (1993)
   PUBMED   8298640
REFERENCE   7  (bases 1 to 6403)
  AUTHORS   Bull,P.C., Thomas,G.R., Rommens,J.M., Forbes,J.R. and Cox,D.W.
  TITLE     The Wilson disease gene is a putative copper transporting P-type
            ATPase similar to the Menkes gene
  JOURNAL   Nat Genet 5 (4), 327-337 (1993)
   PUBMED   8298639
  REMARK    Erratum:[Nat Genet 1994 Feb;6(2):214]
REFERENCE   8  (bases 1 to 6403)
  AUTHORS   Yamaguchi,Y., Heiny,M.E. and Gitlin,J.D.
  TITLE     Isolation and characterization of a human liver cDNA as a candidate
            gene for Wilson disease
  JOURNAL   Biochem Biophys Res Commun 197 (1), 271-277 (1993)
   PUBMED   8250934
REFERENCE   9  (bases 1 to 6403)
  AUTHORS   Weiss,K.H. and Schilsky,M.
  TITLE     Wilson Disease
  JOURNAL   (in) Adam MP, Feldman J, Mirzaa GM, Pagon RA, Wallace SE and
            Amemiya A (Eds.);
            GENEREVIEWS(R);
            (1993)
   PUBMED   20301685
REFERENCE   10 (bases 1 to 6403)
  AUTHORS   Klein,C., Lohmann,K., Marras,C. and Munchau,A.
  TITLE     Hereditary Dystonia Overview
  JOURNAL   (in) Adam MP, Feldman J, Mirzaa GM, Pagon RA, Wallace SE and
            Amemiya A (Eds.);
            GENEREVIEWS(R);
            (1993)
   PUBMED   20301334
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL139082.18, AL138821.12 and
            AL162377.10.
            
            Summary: This gene is a member of the P-type cation transport
            ATPase family and encodes a protein with several membrane-spanning
            domains, an ATPase consensus sequence, a hinge domain, a
            phosphorylation site, and at least 2 putative copper-binding sites.
            This protein is a monomer, and functions as a copper-transporting
            ATPase which exports copper out of the cells, such as the efflux of
            hepatic copper into the bile. Alternate transcriptional splice
            variants, encoding different isoforms with distinct cellular
            localizations, have been characterized. Mutations in this gene have
            been associated with Wilson disease which is characterized by
            copper accumulation. [provided by RefSeq, Dec 2019].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR14038194.2553780.1,
                                           SRR18074969.2997899.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA1965299,
                                           SAMEA1966682 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-164               AL139082.18        29750-29913         c
            165-1398            AL138821.12        33967-35200         c
            1399-1656           AL138821.12        30524-30781         c
            1657-1820           AL138821.12        28476-28639         c
            1821-1982           AL138821.12        24904-25065         c
            1983-2059           AL138821.12        21869-21945         c
            2060-2234           AL138821.12        20180-20354         c
            2235-2468           AL138821.12        18343-18576         c
            2469-2560           AL138821.12        17548-17639         c
            2561-2688           AL138821.12        10304-10431         c
            2689-2843           AL138821.12        10039-10193         c
            2844-2978           AL138821.12        9694-9828           c
            2979-3161           AL138821.12        4141-4323           c
            3162-3330           AL138821.12        2418-2586           c
            3331-3474           AL138821.12        1113-1256           c
            3475-3617           AL162377.10        168087-168229       c
            3618-3821           AL162377.10        166512-166715       c
            3822-3939           AL162377.10        166312-166429       c
            3940-4042           AL162377.10        164629-164731       c
            4043-6403           AL162377.10        161705-164065       c
FEATURES             Location/Qualifiers
     source          1..6403
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="13"
                     /map="13q14.3"
     gene            1..6403
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="ATPase copper transporting beta"
                     /db_xref="GeneID:540"
                     /db_xref="HGNC:HGNC:870"
                     /db_xref="MIM:606882"
     exon            1..164
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     CDS             114..4316
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /EC_number="7.2.2.8"
                     /note="isoform n is encoded by transcript variant 20;
                     copper-transporting ATPase 2; copper pump 2; ATPase, Cu++
                     transporting, beta polypeptide; Wilson disease-associated
                     protein; ATPase, Cu(2+)- transporting, beta polypeptide;
                     copper-transporting protein ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform n"
                     /protein_id="NP_001393454.1"
                     /db_xref="GeneID:540"
                     /db_xref="HGNC:HGNC:870"
                     /db_xref="MIM:606882"
                     /translation="
MPEQERQITAREGASRKILSKLSLPTRAWEPAMKKSFAFDNVGYEGGLDGLGPSSQVATSTVRILGMTCQSCVKSIEDRISNLKGIISMKVSLEQGSATVKYVPSVVCLQQVCHQIGDMGFEASIAEGKAASWPSRSLPAQEAVVKLRVEGMTCQSCVSSIEGKVRKLQGVVRVKVSLSNQEAVITYQPYLIQPEDLRDHVNDMGFEAAIKSKVAPLSLGPIDIERLQSTNPKRPLSSANQNFNNSETLGHQGSHVVTLQLRIDGMHCKSCVLNIEENIGQLLGVQSIQVSLENKTAQVKYDPSCTSPVALQRAIEALPPGNFKVSLPDGAEGSGTDHRSSSSHSPGSPPRNQVQGTCSTTLIAIAGMTCASCVHSIEGMISQLEGVQQISVSLAEGTATVLYNPSVISPEELRAAIEDMGFEASVVSESCSTNPLGNHSAGNSMVQTTDGTPTSVQEVAPHTGRLPANHAPDILAKSPQSTRAVAPQKCFLQIKGMTCASCVSNIERNLQKEAGVLSVLVALMAGKAEIKYDPEVIQPLEIAQFIQDLGFEAAVMEDYAGSDGNIELTITGMTCASCVHNIESKLTRTNGITYASVALATSKALVKFDPEIIGPRDIIKIIEEIGFHASLAQRNPNAHHLDHKMEIKQWKKSFLCSLVFGIPVMALMIYMLIPSNEPHQSMVLDHNIIPGLSILNLIFFILCTFVQLLGGWYFYVQAYKSLRHRSANMDVLIVLATSIAYVYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHLAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDIVKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLIKATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIMSTLTLVVWIVIGFIDFGVVQRYFPIKTVMFDKTGTITHGVPRVMRVLLLGDVATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSNVEGILAHSERPLSAPASHLNEAGSLPAEKDAVPQTFSVLIGNREWLRRNGLTISSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLQSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNKGKKVAMVGDGVNDSPALAQADMGVAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLVGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAHGHMKPLTASQVSVHIGMDDRWRDSPRATPWDQVSYVSQVSLSSLTSDKPSRHSAAADDDGDKWSLLLNGRDEEQYI"
     misc_feature    180..182
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:23186163; propagated from
                     UniProtKB/Swiss-Prot (P35670.4); phosphorylation site"
     misc_feature    294..485
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(312..320,327..329)
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    549..740
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(567..575,582..584)
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    801..860
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="propagated from UniProtKB/Swiss-Prot (P35670.4);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    891..1067
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(909..917,924..926)
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1077..1178
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="propagated from UniProtKB/Swiss-Prot (P35670.4);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1200..1388
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1215..1223,1230..1232)
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1545..1547
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:23186163; propagated from
                     UniProtKB/Swiss-Prot (P35670.4); phosphorylation site"
     misc_feature    1554..1556
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q64535; propagated from
                     UniProtKB/Swiss-Prot (P35670.4); phosphorylation site"
     misc_feature    1587..1775
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1602..1610,1617..1619)
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1812..2003
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1830..1838,1845..1847)
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2067..3980
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    2073..2138
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="propagated from UniProtKB/Swiss-Prot (P35670.4);
                     transmembrane region"
     misc_feature    2205..2264
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="propagated from UniProtKB/Swiss-Prot (P35670.4);
                     transmembrane region"
     misc_feature    2286..2348
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="propagated from UniProtKB/Swiss-Prot (P35670.4);
                     transmembrane region"
     misc_feature    2406..2468
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="propagated from UniProtKB/Swiss-Prot (P35670.4);
                     transmembrane region"
     misc_feature    2871..2939
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="propagated from UniProtKB/Swiss-Prot (P35670.4);
                     transmembrane region"
     misc_feature    order(2997..3005,3207..3209,3360..3368,3456..3458,
                     3576..3584,3642..3644,3651..3653,3660..3662,3717..3719,
                     3726..3728)
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
     exon            165..1398
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            1399..1656
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            1657..1820
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            1821..1982
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            1983..2059
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            2060..2234
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            2235..2468
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            2469..2560
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            2561..2688
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            2689..2843
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            2844..2978
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            2979..3161
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            3162..3330
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            3331..3474
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            3475..3617
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            3618..3821
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            3822..3939
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            3940..4042
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     exon            4043..6403
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /inference="alignment:Splign:2.1.0"
     regulatory      6376..6381
                     /regulatory_class="polyA_signal_sequence"
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="hexamer: AATAAA"
     polyA_site      6403
                     /gene="ATP7B"
                     /gene_synonym="PWD; WC1; WD; WND"
                     /note="major polyA site"
ORIGIN      
ctcacactctgcgcctcctctcccgggactttaacaccccgctctcctccaccgaccaggtgaccttttgctctgagccagatcagagaagaattcggtgtccgtgcgggacgatgcctgagcaggagagacagatcacagccagagaaggggccagtcggaaaatcttatctaagctttctttgcctacccgtgcctgggaaccagcaatgaagaagagttttgcttttgacaatgttggctatgaaggtggtctggatggcctgggcccttcttctcaggtggccaccagcacagtcaggatcttgggcatgacttgccagtcatgtgtgaagtccattgaggacaggatttccaatttgaaaggcatcatcagcatgaaggtttccctggaacaaggcagtgccactgtgaaatatgtgccatcggttgtgtgcctgcaacaggtttgccatcaaattggggacatgggcttcgaggccagcattgcagaaggaaaggcagcctcctggccctcaaggtccttgcctgcccaggaggctgtggtcaagctccgggtggagggcatgacctgccagtcctgtgtcagctccattgaaggcaaggtccggaaactgcaaggagtagtgagagtcaaagtctcactcagcaaccaagaggccgtcatcacttatcagccttatctcattcagcccgaagacctcagggaccatgtaaatgacatgggatttgaagctgccatcaagagcaaagtggctcccttaagcctgggaccaattgatattgagcggttacaaagcactaacccaaagagacctttatcttctgctaaccagaattttaataattctgagaccttggggcaccaaggaagccatgtggtcaccctccaactgagaatagatggaatgcattgtaagtcttgcgtcttgaatattgaagaaaatattggccagctcctaggggttcaaagtattcaagtgtccttggagaacaaaactgcccaagtaaagtatgacccttcttgtaccagcccagtggctctgcagagggctatcgaggcacttccacctgggaattttaaagtttctcttcctgatggagccgaagggagtgggacagatcacaggtcttccagttctcattcccctggctccccaccgagaaaccaggtccagggcacatgcagtaccactctgattgccattgccggcatgacctgtgcatcctgtgtccattccattgaaggcatgatctcccaactggaaggggtgcagcaaatatcggtgtctttggccgaagggactgcaacagttctttataatccctctgtaattagcccagaagaactcagagctgctatagaagacatgggatttgaggcttcagtcgtttctgaaagctgttctactaaccctcttggaaaccacagtgctgggaattccatggtgcaaactacagatggtacacctacatctgtgcaggaagtggctccccacactgggaggctccctgcaaaccatgccccggacatcttggcaaagtccccacaatcaaccagagcagtggcaccgcagaagtgcttcttacagatcaaaggcatgacctgtgcatcctgtgtgtctaacatagaaaggaatctgcagaaagaagctggtgttctctccgtgttggttgccttgatggcaggaaaggcagagatcaagtatgacccagaggtcatccagcccctcgagatagctcagttcatccaggacctgggttttgaggcagcagtcatggaggactacgcaggctccgatggcaacattgagctgacaatcacagggatgacctgcgcgtcctgtgtccacaacatagagtccaaactcacgaggacaaatggcatcacttatgcctccgttgcccttgccaccagcaaagcccttgttaagtttgacccggaaattatcggtccacgggatattatcaaaattattgaggaaattggctttcatgcttccctggcccagagaaaccccaacgctcatcacttggaccacaagatggaaataaagcagtggaagaagtctttcctgtgcagcctggtgtttggcatccctgtcatggccttaatgatctatatgctgatacccagcaacgagccccaccagtccatggtcctggaccacaacatcattccaggactgtccattctaaatctcatcttctttatcttgtgtacctttgtccagctcctcggtgggtggtacttctacgttcaggcctacaaatctctgagacacaggtcagccaacatggacgtgctcatcgtcctggccacaagcattgcttatgtttattctctggtcatcctggtggttgctgtggctgagaaggcggagaggagccctgtgacattcttcgacacgccccccatgctctttgtgttcattgccctgggccggtggctggaacacttggcaaagagcaaaacctcagaagccctggctaaactcatgtctctccaagccacagaagccaccgttgtgacccttggtgaggacaatttaatcatcagggaggagcaagtccccatggagctggtgcagcggggcgatatcgtcaaggtggtccctgggggaaagtttccagtggatgggaaagtcctggaaggcaataccatggctgatgagtccctcatcacaggagaagccatgccagtcactaagaaacccggaagcactgtaattgcggggtctataaatgcacatggctctgtgctcattaaagctacccacgtgggcaatgacaccactttggctcagattgtgaaactggtggaagaggctcagatgtcaaaggcacccattcagcagctggctgaccggtttagtggatattttgtcccatttatcatcatcatgtcaactttgacgttggtggtatggattgtaatcggttttatcgattttggtgttgttcagagatactttcctataaagactgtgatgtttgacaagactggcaccattacccatggcgtccccagggtcatgcgggtgctcctgctgggggatgtggccacactgcccctcaggaaggttctggctgtggtggggactgcggaggccagcagtgaacaccccttgggcgtggcagtcaccaaatactgtaaagaggaacttggaacagagaccttgggatactgcacggacttccaggcagtgccaggctgtggaattgggtgcaaagtcagcaacgtggaaggcatcctggcccacagtgagcgccctttgagtgcaccggccagtcacctgaatgaggctggcagccttcccgcagaaaaagatgcagtcccccagaccttctctgtgctgattggaaaccgtgagtggctgaggcgcaacggtttaaccatttctagcgatgtcagtgacgctatgacagaccacgagatgaaaggacagacagccatcctggtggctattgacggtgtgctctgtgggatgatcgcaatcgcagacgctgtcaagcaggaggctgccctggctgtgcacacgctgcagagcatgggtgtggacgtggttctgatcacgggggacaaccggaagacagccagagctattgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttcgcacaaggtggccaaggtccaggagctccagaataaagggaagaaagtcgccatggtgggggatggggtcaatgactccccggccttggcccaggcagacatgggtgtggccattggcaccggcacggatgtggccatcgaggcagccgacgtcgtccttatcagaaatgatttgctggatgtggtggctagcattcacctttccaagaggactgtccgaaggatacgcatcaacctggtcctggcactgatttataacctggttgggatacccattgcagcaggtgtcttcatgcccatcggcattgtgctgcagccctggatgggctcagcggccatggcagcctcctctgtgtctgtggtgctctcatccctgcagctcaagtgctataagaagcctgacctggagaggtatgaggcacaggcgcatggccacatgaagcccctgacggcatcccaggtcagtgtgcacataggcatggatgacaggtggcgggactcccccagggccacaccatgggaccaggtcagctatgtcagccaggtgtcgctgtcctccctgacgtccgacaagccatctcggcacagcgctgcagcagacgatgatggggacaagtggtctctgctcctgaatggcagggatgaggagcagtacatctgatgacttcaggcaggcgggccggggcagggacttgcctccactcaccacaagctgagcaggacagccagcagcaggatgggctgagctagcctccagctttggggacttccgctccctggatatgtccagtcatcctgccctgcagcacgcggccttgtctgggtgcagctgggcttggcctggagaggacggccctgcctgcctcttggcctcacgggaccgtcagcatgggctttgtcttggactctagtccttggctggactgtagaaggtgagaggcgagtcaccctcctcacagacctctgcttggagtatttaggatgactgctgtgaaatggagaacagtttcatcaggaccaaaaaacctcactgggcctttccagagaactgcagacctcactgtcagggtctttctgatgacgcctgtctgtgtgcatcatgtttctgagaccacagtttacctcaggtgtgcctgttgctttcttcctgcatagtctgttcctttcttcgtacatagtctgttccttttctctcctgtgtgcttgtcagtggggacccctcgcaaccctgcctgtcacctgggagggtgggaccaatgtccttgtggtctttgctgctgctctcaggcgcttctccaatgctctggagtgtgcatttcagcttgaacctgcttcctggctcacacatccccagccagggagcttgccacactcttcttcaagttgaggagagttcttttttgcttaaagcccccttctccatggagtgttggcttctcaatagagtgttgttgctgaccagctggagtgagggcctcagagcctgacctgagagtccgtactcggcttcctgtggggtgtaggttctcgcgattcaggacgtccttccatatccctgcccagcctgtggtgcttgaaacgtttgccccatgggaaacgtatgtgtgcaggagcctccctgcacggcccaaggggcttcgttttcagtcttctgactgtcacctcgtggggttcagtagagaattcatgtgactagcgcctggccttgtgtggcttggaggaaatggtactgcccaaataggaggaaaacacagcctccctgagcctgcattctgcacgctgcccaggggcttcagaaaaggagtggccacagcaccccgaagggagcatctgtttacctggcagtggctctcagagcagcagaacgggttcagttttagactctgaagttggttgtgattgacagaaccctttgggagcaaactagtagagttggattaaattctgggtgaaacccttttctcccacacaaaatagttttagtgatttttttcattgtccattacttgccaggggcagttttagcagcacttttgatagattacgtctaatcctcccaaccaaccagcagggtagctattactgtccacattttacaggcaaggaaacaggctccaagaggctgaggactttgcccaggatgacatagccaatggacaagcagtgtctgtcagctgtgaaggcttcactcttattgtccttctaccttgaatagaagttttcctgataagaataaacgaggaaaaggtccttgcctcctggaagaacaaatctaccaggtgatctattcattgtttcaactcagaatgcacttgattcaggaggtcatctgaccttcaccttggatggttagtttcactttttacatatagtttttgcagggttttattttataaaatccaagcgcgctgttgattgtgttttccttgttttcagcccccccactccagcccgcagcacatttccgctgtccgtcagtaattgtgtcctctctttatgcttgcttggggaatgttgttttctgactaggctgatcattatctaaagaatctaattctgttgatttttaaaacttttaggaccataaacgttgtgttcatatatggacatggaaatatttatataattttatagaaaataaccttttagatggtcaaagtgtaaggagtttttttgtcagataatcatttctacttcaaaaacatttcatgcaatattagaataaagttcctgtcattcctctaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]