ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-04 00:09:26, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001349367 1649 bp mRNA linear PRI 02-AUG-2023
DEFINITION Homo sapiens centromere protein K (CENPK), transcript variant 3,
mRNA.
ACCESSION NM_001349367 XM_011543534
VERSION NM_001349367.2
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1649)
AUTHORS Li X, Han YR, Xuefeng X, Ma YX, Xing GS, Yang ZW, Zhang Z, Shi L
and Wu XL.
TITLE Lentivirus-mediated short hairpin RNA interference of CENPK
inhibits growth of colorectal cancer cells with overexpression of
Cullin 4A
JOURNAL World J Gastroenterol 28 (37), 5420-5443 (2022)
PUBMED 36312839
REMARK GeneRIF: Lentivirus-mediated short hairpin RNA interference of
CENPK inhibits growth of colorectal cancer cells with
overexpression of Cullin 4A.
REFERENCE 2 (bases 1 to 1649)
AUTHORS Tian T, Chen L, Dou Z, Yang Z, Gao X, Yuan X, Wang C, Liu R, Shen
Z, Gui P, Teng M, Meng X, Hill DL, Li L, Zhang X, Liu X, Sun L,
Zang J and Yao X.
TITLE Structural insights into human CCAN complex assembled onto DNA
JOURNAL Cell Discov 8 (1), 90 (2022)
PUBMED 36085283
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 1649)
AUTHORS Tian H, Wang F, Deng Y, Ying L, Fang W, Chen D, Miao C, Li H, Sun
S, Ma Y, Cai H and Guo T.
TITLE Centromeric protein K (CENPK) promotes gastric cancer proliferation
and migration via interacting with XRCC5
JOURNAL Gastric Cancer 25 (5), 879-895 (2022)
PUBMED 35715658
REMARK GeneRIF: Centromeric protein K (CENPK) promotes gastric cancer
proliferation and migration via interacting with XRCC5.
REFERENCE 4 (bases 1 to 1649)
AUTHORS Lin X, Wang F, Chen J, Liu J, Lin YB, Li L, Chen CB and Xu Q.
TITLE N6-methyladenosine modification of CENPK mRNA by ZC3H13 promotes
cervical cancer stemness and chemoresistance
JOURNAL Mil Med Res 9 (1), 19 (2022)
PUBMED 35418160
REMARK GeneRIF: N(6)-methyladenosine modification of CENPK mRNA by ZC3H13
promotes cervical cancer stemness and chemoresistance.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 1649)
AUTHORS Li Q, Liang J, Zhang S, An N, Xu L and Ye C.
TITLE Overexpression of centromere protein K (CENPK) gene in
Differentiated Thyroid Carcinoma promote cell Proliferation and
Migration
JOURNAL Bioengineered 12 (1), 1299-1310 (2021)
PUBMED 33904381
REMARK GeneRIF: Overexpression of centromere protein K (CENPK) gene in
Differentiated Thyroid Carcinoma promote cell Proliferation and
Migration.
REFERENCE 6 (bases 1 to 1649)
AUTHORS Okada M, Cheeseman IM, Hori T, Okawa K, McLeod IX, Yates JR 3rd,
Desai A and Fukagawa T.
TITLE The CENP-H-I complex is required for the efficient incorporation of
newly synthesized CENP-A into centromeres
JOURNAL Nat Cell Biol 8 (5), 446-457 (2006)
PUBMED 16622420
REFERENCE 7 (bases 1 to 1649)
AUTHORS Foltz DR, Jansen LE, Black BE, Bailey AO, Yates JR 3rd and
Cleveland DW.
TITLE The human CENP-A centromeric nucleosome-associated complex
JOURNAL Nat Cell Biol 8 (5), 458-469 (2006)
PUBMED 16622419
REFERENCE 8 (bases 1 to 1649)
AUTHORS Obuse C, Yang H, Nozaki N, Goto S, Okazaki T and Yoda K.
TITLE Proteomics analysis of the centromere complex from HeLa interphase
cells: UV-damaged DNA binding protein 1 (DDB-1) is a component of
the CEN-complex, while BMI-1 is transiently co-localized with the
centromeric region in interphase
JOURNAL Genes Cells 9 (2), 105-120 (2004)
PUBMED 15009096
REFERENCE 9 (bases 1 to 1649)
AUTHORS Yamashita A, Ito M, Takamatsu N and Shiba T.
TITLE Characterization of Solt, a novel SoxLZ/Sox6 binding protein
expressed in adult mouse testis
JOURNAL FEBS Lett 481 (2), 147-151 (2000)
PUBMED 10996314
REFERENCE 10 (bases 1 to 1649)
AUTHORS Taki T, Hayashi Y, Taniwaki M, Seto M, Ueda R, Hanada R, Suzukawa
K, Yokota J and Morishita K.
TITLE Fusion of the MLL gene with two different genes, AF-6 and
AF-5alpha, by a complex translocation involving chromosomes 5, 6, 8
and 11 in infant leukemia
JOURNAL Oncogene 13 (10), 2121-2130 (1996)
PUBMED 8950979
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BG502832.1, BC005400.1, BG527280.1 and BC008504.1.
On May 31, 2019 this sequence version replaced NM_001349367.1.
Summary: CENPK is a subunit of a CENPH (MIM 605607)-CENPI (MIM
300065)-associated centromeric complex that targets CENPA (MIM
117139) to centromeres and is required for proper kinetochore
function and mitotic progression (Okada et al., 2006 [PubMed
16622420]).[supplied by OMIM, Mar 2008].
Transcript Variant: This variant (3) differs in the 5' UTR and uses
an alternate splice site in its 5' coding region, resulting in use
of an alternate start codon, compared to variant 1. The encoded
isoform (3) has a slightly longer, but distinct N-terminus compared
to isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: DRR138522.1352282.1 [ECO:0000332]
RNAseq introns :: mixed sample support SAMEA1965299,
SAMEA1966682 [ECO:0006172]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-56 BG502832.1 2-57
57-123 BC005400.1 47-113
124-454 BG527280.1 123-453
455-1046 BC005400.1 493-1084
1047-1649 BC008504.1 1129-1731
FEATURES Location/Qualifiers
source 1..1649
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q12.3"
gene 1..1649
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="centromere protein K"
/db_xref="GeneID:64105"
/db_xref="HGNC:HGNC:29479"
/db_xref="MIM:611502"
exon 1..71
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1359976795"
variation 2
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1313487734"
variation 3
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1752349587"
variation 6
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752348893"
variation 7
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1752348579"
variation 8
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1306504051"
variation 9
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1342831242"
variation 11..20
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ggggctggca"
/replace="ggggctggcaggggctggca"
/db_xref="dbSNP:1485277906"
variation 11
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1752347563"
variation 12
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1231982437"
variation 13
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1028359789"
variation 14
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:542352928"
variation 15
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1210224911"
variation 19
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1265798087"
variation 21
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1752345149"
variation 22..25
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gc"
/replace="gcgc"
/db_xref="dbSNP:1257636747"
variation 24
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1226707165"
variation 28
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752344063"
variation 29
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752343711"
variation 30
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:748792667"
variation 31
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1422047918"
variation 32
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1412446096"
variation 33
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1473419782"
variation 34
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150581284"
variation 35
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1752342051"
variation 36
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1343690787"
variation 37
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:140804671"
variation 39
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:553552680"
variation 40
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1752340528"
variation 41
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:9791024"
variation 42
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1404435189"
variation 45
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1413477558"
variation 46
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1011178654"
variation 48
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:892736211"
variation 49
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1293152372"
variation 50
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1752337962"
variation 52
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1004353263"
variation 53
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1364825946"
variation 55
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1752336831"
variation 56
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:41268429"
misc_feature 59..61
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="upstream in-frame stop codon"
variation 61
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1027093258"
variation 62
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1003673595"
variation 63
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:995243929"
variation 64
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:558001621"
variation 69
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1368732818"
variation 71
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1157875168"
exon 72..139
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 72
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:548499564"
variation 75..77
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tag"
/replace="tagttag"
/db_xref="dbSNP:1038778849"
variation 77
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757254302"
variation 84
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1751964644"
variation 85
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1225478568"
variation 86
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1375448951"
variation 90
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1751963569"
variation 93
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1001509723"
variation 94
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1445804221"
variation 99
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1171663462"
variation 101
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1581126138"
variation 103
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1374448596"
variation 104
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:906122153"
variation 107
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:902390139"
variation 114
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1470058908"
variation 115
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1751960081"
variation 119
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1581126047"
CDS 125..940
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="isoform 3 is encoded by transcript variant 3;
leucine zipper protein FKSG14; SoxLZ/Sox6-binding protein
Solt; protein AF-5alpha; interphase centromere complex
protein 37"
/codon_start=1
/product="centromere protein K isoform 3"
/protein_id="NP_001336296.1"
/db_xref="GeneID:64105"
/db_xref="HGNC:HGNC:29479"
/db_xref="MIM:611502"
/translation="
MTLFQEDLDPDSTTDVGDVTNTEEELIRECEEMWKDMEECQNKLSLIGTETLTDSNAQLSLLIMQVKCLTAELSQWQKKTPETIPLTEDVLITLGKEEFQKLRQDLEMVLSTKESKNEKLKEDLEREQRWLDEQQQIMESLNVLHSELKNKVETFSESRIFNELKTKMLNIKEYKEKLLSTLGEFLEDHFPLPDRSVKKKKKNIQESSVNLITLHEMLEILINRLFDVPHDPYVKISDSFWPPYVELLLRNGIALRHPEDPTRIRLEAFHQ"
misc_feature 158..937
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="Centromere-associated protein K; Region: CENP-K;
pfam11802"
/db_xref="CDD:432085"
variation 127
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2150571791"
variation 129
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1358207757"
variation 130
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1173365559"
variation 131
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1751958616"
variation 133
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1330586449"
variation 134
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1337771016"
variation 135
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401876701"
variation 137
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1440214129"
exon 140..241
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 141
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757460492"
variation 143
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:777895549"
variation 147
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2096371242"
variation 149
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:935938524"
variation 152
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150532568"
variation 153
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:758896315"
variation 154
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:75497175"
variation 156
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1216026136"
variation 159
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:371070860"
variation 166
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1750726023"
variation 167
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:760004670"
variation 168
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750725249"
variation 176
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1397513933"
variation 177
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750724525"
variation 178
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:754218341"
variation 179
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:766178671"
variation 183
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:760347848"
variation 185
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1348543974"
variation 188..192
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="actga"
/db_xref="dbSNP:1429400174"
variation 190
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:772652364"
variation 191..199
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gaagaa"
/replace="gaagaagaa"
/db_xref="dbSNP:1347528124"
variation 196
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1423115596"
variation 197
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750721303"
variation 200
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:150574725"
variation 202
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:201745679"
variation 204
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481438294"
variation 205
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:774283954"
variation 206
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141729484"
variation 209
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1206680426"
variation 213
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1581093357"
variation 219..221
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1437145639"
variation 219
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1248409774"
variation 220
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750716760"
variation 222
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:749111718"
variation 226
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750714903"
variation 227
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263513424"
variation 230
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:775244207"
variation 233
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:771118232"
variation 234
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:747252575"
variation 239
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:868732343"
exon 242..298
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 242
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750271640"
variation 243
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:543487501"
variation 244
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1043343369"
variation 245
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750268417"
variation 256
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1448020199"
variation 257
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:762865136"
variation 260
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:775330841"
variation 262
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:148016416"
variation 263
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750263924"
variation 264..266
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="ttg"
/db_xref="dbSNP:779227890"
variation 264
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454849271"
variation 266
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:144481454"
variation 267
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150519689"
variation 269
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:745593902"
variation 274..285
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aacactcaccga"
/db_xref="dbSNP:1242902542"
variation 276..282
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="cac"
/replace="cactcac"
/db_xref="dbSNP:757802386"
variation 276
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:946304876"
variation 278
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:138527872"
variation 280
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339735347"
variation 282
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2150519582"
variation 283
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:757907403"
variation 284
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141548635"
variation 288
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:201709067"
variation 295
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:755596314"
variation 296
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:764377925"
exon 299..371
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 300
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:749320661"
variation 301
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:780631678"
variation 305..309
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttgtt"
/db_xref="dbSNP:1750067937"
variation 305
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1750068401"
variation 313
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750067487"
variation 315
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:532263854"
variation 316
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1328421596"
variation 317
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1750066060"
variation 319
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1750065565"
variation 320
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1278922834"
variation 325
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:746283375"
variation 328..330
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1388017290"
variation 334
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:781388497"
variation 335
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:751218204"
variation 336
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1406983239"
variation 341
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1391243960"
variation 342..348
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tca"
/replace="tcagtca"
/db_xref="dbSNP:762598205"
variation 342
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1561685621"
variation 343
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:777349763"
variation 344
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:185445391"
variation 345
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1425260470"
variation 349
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:749780402"
variation 350
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750057694"
variation 352
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1477188242"
variation 353
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1750056781"
variation 355
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1750056286"
variation 356..362
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/db_xref="dbSNP:750256768"
variation 358
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:377608156"
variation 362
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:549718297"
variation 363
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1750053838"
variation 364
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:759373577"
variation 365
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:753728671"
variation 368
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561685364"
variation 371
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1693238677"
exon 372..418
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 374
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438182467"
variation 377
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:557986609"
variation 379
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:764452510"
variation 381
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:763064949"
variation 382
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1483041739"
variation 383
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1748212552"
variation 386
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1748212077"
variation 387..388
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aa"
/db_xref="dbSNP:1403653612"
variation 391
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765236390"
variation 392
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:548653305"
variation 394
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:771385648"
variation 395
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1286587676"
variation 397
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:138507676"
variation 401
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314951065"
variation 402
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:974580309"
variation 405
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773540586"
variation 407..408
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1581021207"
variation 408
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:2150453321"
variation 412
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1581021175"
variation 414..415
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aa"
/db_xref="dbSNP:779363914"
variation 414..415
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1748205064"
variation 415
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228585329"
exon 419..501
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 421
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1393117032"
variation 424
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1180206825"
variation 430
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150375703"
variation 434
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:773628734"
variation 438
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1237140365"
variation 447
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1232231851"
variation 449
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1193606113"
variation 450
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745284481"
variation 451
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:547550705"
variation 452
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1745283514"
variation 454
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1186908669"
variation 458
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:748490924"
variation 459
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:773901255"
variation 462
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:2150375557"
variation 468
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:768317556"
variation 469
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1561634678"
variation 471
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:748850005"
variation 474
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745280061"
variation 475
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:145897680"
variation 476
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:753691260"
variation 481
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376463567"
variation 482
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1327050486"
variation 484..487
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="aaag"
/db_xref="dbSNP:2150375437"
variation 489
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:140748564"
variation 491
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1286143770"
variation 492
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1745276214"
variation 493
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:745797201"
variation 494
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1302333711"
variation 496
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1434037126"
variation 498
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1580930674"
variation 499
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:909927578"
exon 502..600
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 504
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745248317"
variation 505
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195109001"
variation 506
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1745247359"
variation 508
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:185309293"
variation 509
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:755218264"
variation 510
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:138940796"
variation 515
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745244701"
variation 517
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1357350104"
variation 518
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1265044045"
variation 519
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:892129867"
variation 520
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561633837"
variation 521
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:867891240"
variation 521
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1745242213"
variation 522
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:780195488"
variation 523..554
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ac"
/replace="acagcaacagataatggaatctcttaatgtac"
/db_xref="dbSNP:1745237533"
variation 529
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157077028"
variation 532
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1363410017"
variation 541
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:756212865"
variation 544
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:750466231"
variation 548
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1325715984"
variation 551
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:767952170"
variation 553
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1406824741"
variation 554
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580929057"
variation 556
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:150254661"
variation 558
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451415236"
variation 559
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745235605"
variation 560
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1580928949"
variation 561..562
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="a"
/db_xref="dbSNP:749771436"
variation 561
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:751927567"
variation 562
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:141033147"
variation 567
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:775303734"
variation 568
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1471995857"
variation 574
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425234534"
variation 576
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1323742457"
variation 578
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745230797"
variation 582
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:540839130"
variation 583
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745229775"
variation 586
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745229292"
variation 587
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1475383930"
variation 591
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1240814809"
variation 592
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1201507225"
variation 593
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1452590609"
variation 597
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:199710596"
variation 598
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:776182305"
variation 599
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:770828450"
exon 601..727
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 604
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745162523"
variation 607
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1192069105"
variation 620
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745161624"
variation 623..626
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1238965408"
variation 625
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745161152"
variation 626
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:752112029"
variation 630
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1203948509"
variation 632
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150372287"
variation 635
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745159363"
variation 638
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745158892"
variation 641
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:764451391"
variation 642
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:758865586"
variation 643
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:753079695"
variation 647
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:765028924"
variation 649
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:376864120"
variation 658
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745154105"
variation 661..663
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gag"
/db_xref="dbSNP:1231746887"
variation 661
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1216777810"
variation 662
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745152720"
variation 666
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1378696125"
variation 673
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:538146502"
variation 674
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:868259372"
variation 676
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745150168"
variation 679
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1745149712"
variation 680
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:765914401"
variation 681
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1185768219"
variation 684
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:569355500"
variation 685
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:377239133"
variation 686
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773227049"
variation 688
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1745146291"
variation 689
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1745145818"
variation 691
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1172188810"
variation 695
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:866918568"
variation 696
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:771962047"
variation 698
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774114264"
variation 700
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1176885832"
variation 701
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468783521"
variation 706
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:770061194"
variation 708
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:151068525"
variation 711
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:781204320"
variation 712
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:759021447"
variation 716..720
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1284629517"
variation 718
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1745140405"
variation 722..726
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1745137975"
variation 722
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:757372616"
variation 727
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1409007703"
exon 728..781
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 728
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1213991862"
variation 729..739
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aa"
/replace="aaaacattcaa"
/db_xref="dbSNP:1743744485"
variation 732
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:774200181"
variation 734
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1270744844"
variation 735
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1561615890"
variation 737
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1219885542"
variation 741
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308635150"
variation 747
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:759382373"
variation 758
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:776934831"
variation 759
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580880398"
variation 763
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:376455824"
variation 766
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743741013"
variation 768
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:747162578"
variation 773
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743739935"
variation 775
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1440453004"
variation 781
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:777984796"
exon 782..1649
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/inference="alignment:Splign:2.1.0"
variation 783
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1193515151"
variation 784
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1457022289"
variation 787
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1407171241"
variation 788..794
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ata"
/replace="ataaata"
/db_xref="dbSNP:1410263007"
variation 788
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1484537441"
variation 789
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:779591294"
variation 791..794
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aata"
/db_xref="dbSNP:774484343"
variation 792
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1210752666"
variation 794
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1346222240"
variation 795..798
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="gatt"
/db_xref="dbSNP:1240110785"
variation 800..802
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:1161999795"
variation 800
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1322275300"
variation 804
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1335325956"
variation 806
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:769017086"
variation 811
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:749715663"
variation 812
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:755866468"
variation 813..824
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="atg"
/replace="atgatccatatg"
/db_xref="dbSNP:1329394537"
variation 813..814
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="at"
/replace="ataat"
/db_xref="dbSNP:1373474133"
variation 813
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:542463893"
variation 814
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:145412104"
variation 815..816
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="tttttt"
/db_xref="dbSNP:771313026"
variation 818
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:960235172"
variation 819
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1454009624"
variation 820
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1362811635"
variation 823
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1580864222"
variation 824
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743131833"
variation 827..830
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1743131212"
variation 832
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:756782808"
variation 834
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:368786771"
variation 836
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1257572242"
variation 844
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:919152018"
variation 846
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489193688"
variation 847
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1034387973"
variation 848..849
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="cc"
/db_xref="dbSNP:749720138"
variation 849
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1484974307"
variation 850
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:112503088"
variation 852
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1001989973"
variation 853
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:899250076"
variation 856
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:762786158"
variation 866
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1016654387"
variation 868
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:141551708"
variation 870
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1206028496"
variation 872
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:752602369"
variation 873
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:147863579"
variation 874
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1004913643"
variation 875
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1207772442"
variation 876
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:759344010"
variation 877
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1161689071"
variation 878
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743117164"
variation 881
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1386097326"
variation 886
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:528929654"
variation 887..888
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1580863575"
variation 890
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743115124"
variation 892
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1001577205"
variation 894
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1334649862"
variation 900
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:773588233"
variation 902
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:772376049"
variation 903
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414102882"
variation 905
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1350727271"
variation 909
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:762026997"
variation 911
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:774554899"
variation 912
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:749758005"
variation 914
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:746284263"
variation 916
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:775999649"
variation 918
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:375568861"
variation 920
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:746181867"
variation 924
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1163495587"
variation 926
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1228791496"
variation 927
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:933805256"
variation 928
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1279834410"
variation 931
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1487486189"
variation 933
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1244285837"
variation 937
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:36068055"
variation 943
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:756880796"
variation 948..951
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1743101471"
variation 953
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1260071196"
variation 954
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:746580111"
variation 955
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1469027129"
variation 956
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:777142009"
variation 958
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:757857332"
variation 959
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="c"
/db_xref="dbSNP:1472961778"
variation 960
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:748983371"
variation 962
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:942422849"
variation 963
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:752587413"
variation 967..971
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1410026237"
variation 967
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:765169647"
variation 968
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743095898"
variation 972
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1554102945"
variation 973
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743094716"
variation 974
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:754847602"
variation 975
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:753650693"
variation 978
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:149505574"
variation 979
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1172922491"
variation 980
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1394689518"
variation 988
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:762116904"
variation 989..992
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="t"
/replace="tatt"
/db_xref="dbSNP:1743090541"
variation 989
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1459452062"
variation 990
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:774559990"
variation 991
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743091117"
variation 1003
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1649200052"
variation 1004
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743090066"
variation 1006
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329637299"
variation 1008
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:904709766"
variation 1012
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743088868"
variation 1015
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1039179836"
variation 1016
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2150328447"
variation 1017
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1312201262"
variation 1020..1022
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aca"
/db_xref="dbSNP:1561607792"
variation 1021..1023
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="cat"
/db_xref="dbSNP:1743086947"
variation 1026
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743086428"
variation 1029
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743085588"
variation 1033
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743084567"
variation 1034
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1370569166"
variation 1037
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743083080"
variation 1039
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1743082614"
variation 1040
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:978818163"
variation 1041
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:577792004"
variation 1042
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1349464377"
variation 1043
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:945753719"
variation 1044
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:913482577"
variation 1047..1053
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="gccatct"
/db_xref="dbSNP:3050538"
variation 1047..1053
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="gccatct"
/replace="gccatctgccatct"
/db_xref="dbSNP:2150328214"
variation 1047
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1580862389"
variation 1051..1054
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="t"
/replace="tctt"
/db_xref="dbSNP:764130293"
variation 1052..1058
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ctt"
/replace="cttactt"
/db_xref="dbSNP:750310884"
variation 1052
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:993073629"
variation 1053
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:199686668"
variation 1055
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:960287476"
variation 1056
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:557852862"
variation 1061
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150328136"
variation 1066
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1217910725"
variation 1067
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:11952932"
variation 1071
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743074804"
variation 1072
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207342510"
variation 1074
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1051477604"
variation 1079
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:980313749"
variation 1081
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1379083883"
variation 1083
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743072067"
variation 1084
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:771152778"
variation 1086
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1476923760"
variation 1088
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:963780201"
variation 1102
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1172842501"
variation 1104
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743069976"
variation 1110
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743069574"
variation 1112
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743069146"
variation 1113
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743068751"
variation 1121
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1016373653"
variation 1135
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743067853"
variation 1139
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743067391"
variation 1140
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743066970"
variation 1144
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743066553"
variation 1145
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743066123"
variation 1147
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:377015673"
variation 1148
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743065238"
variation 1149
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1431598611"
variation 1150
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1476832769"
variation 1161
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743063753"
variation 1162
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743063346"
variation 1165
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743062908"
variation 1167
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743062518"
variation 1181
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005290916"
variation 1184
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743061710"
variation 1187
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743061305"
variation 1191
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1395176719"
variation 1192..1193
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1743060475"
variation 1194
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:950730610"
variation 1195
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:918903214"
variation 1199..1203
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="cttac"
/replace="cttacttac"
/db_xref="dbSNP:1743058362"
variation 1201
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743059183"
variation 1202
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1580861850"
variation 1203
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743057940"
variation 1204
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1030344060"
variation 1207
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:998061561"
variation 1210
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743056633"
variation 1212
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743056190"
variation 1215..1219
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttctt"
/db_xref="dbSNP:1379062344"
variation 1218
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743055799"
variation 1225
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1232536793"
variation 1226
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743054584"
variation 1228
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:901106029"
variation 1235..1237
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="ttt"
/db_xref="dbSNP:2150327537"
variation 1242
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1303180714"
variation 1248
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743053398"
variation 1252
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:963227783"
variation 1270
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039911851"
variation 1271
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:926467233"
variation 1272
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743050692"
variation 1274..1275
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1743050266"
variation 1276
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1231285212"
variation 1278
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743049462"
variation 1280
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:138007557"
variation 1282
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743048540"
variation 1283
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338827386"
variation 1287
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1210597400"
variation 1287
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743047305"
variation 1289
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1743046847"
variation 1290
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150327342"
variation 1292..1295
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1743045993"
variation 1292
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1269715863"
variation 1296
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260858610"
variation 1302
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:2150327288"
variation 1306
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1195775126"
variation 1307
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:970156172"
variation 1313
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:2150327248"
variation 1314
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743044194"
variation 1324
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:555421066"
variation 1331
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743043231"
variation 1332
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743042786"
variation 1334
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743042345"
variation 1336
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743041595"
variation 1339
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1248470707"
variation 1342
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:535728857"
variation 1344
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743040225"
variation 1345
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743039797"
variation 1348
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743039346"
variation 1354
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743038929"
variation 1360
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743038506"
variation 1365
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743038099"
variation 1366..1369
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaaa"
/replace="aaaaaa"
/db_xref="dbSNP:1743037214"
variation 1367
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743037649"
variation 1370..1371
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:1743036202"
variation 1370
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:181291384"
variation 1373
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:956248428"
variation 1374
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1457981299"
variation 1375
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:191377833"
variation 1376..1380
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ta"
/replace="taata"
/db_xref="dbSNP:1743032082"
variation 1376
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743033537"
variation 1378
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:539417576"
variation 1382
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1164554935"
variation 1384
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743030703"
variation 1386
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042853202"
variation 1389
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1199984915"
variation 1400
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1388092390"
variation 1406
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743028067"
variation 1410
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1343109599"
variation 1411
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1031647042"
variation 1412
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1437815344"
variation 1413
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743024787"
variation 1416
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743024219"
variation 1418
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743023557"
variation 1419
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294075340"
variation 1425
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:945709709"
variation 1427
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:2150326827"
variation 1428
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743021901"
variation 1429
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1326412701"
variation 1431
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743021208"
variation 1434
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000450375"
variation 1435..1436
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="tt"
/db_xref="dbSNP:1743019563"
variation 1437
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:374187039"
variation 1444
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="g"
/db_xref="dbSNP:1743018191"
variation 1450
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743017506"
variation 1451
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1354485971"
variation 1452
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056728221"
variation 1458
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743016253"
variation 1459
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1213331032"
variation 1464
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268486647"
variation 1475
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743014908"
variation 1477..1478
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1743014111"
variation 1477
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743014523"
variation 1478
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/db_xref="dbSNP:1039250611"
variation 1479
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743013272"
variation 1483
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743012845"
variation 1491
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1186533991"
variation 1495
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743011987"
variation 1498
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743011557"
variation 1502..1505
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tt"
/replace="tttt"
/db_xref="dbSNP:1743010647"
variation 1502
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1340299966"
variation 1505
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743010222"
variation 1510
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424395658"
variation 1511
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:532743192"
variation 1512..1519
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tatta"
/replace="tattatta"
/db_xref="dbSNP:1743008574"
variation 1513
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366225240"
variation 1518..1522
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="ta"
/replace="taata"
/db_xref="dbSNP:1159449444"
variation 1519
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1460556343"
variation 1522..1528
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="at"
/replace="atatcat"
/db_xref="dbSNP:1459141015"
variation 1523
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1389766148"
variation 1524
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1743006871"
variation 1527
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1743006467"
variation 1531
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:927562539"
variation 1532
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:2150326376"
variation 1533
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1743005152"
variation 1534
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743004554"
variation 1537
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1287552641"
variation 1539
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1361828535"
variation 1541
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:980658237"
variation 1545
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314885435"
variation 1546
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1743001315"
variation 1550
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1743000469"
variation 1555
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace=""
/replace="g"
/db_xref="dbSNP:1353680059"
variation 1558
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="t"
/db_xref="dbSNP:1327594781"
variation 1559
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051966282"
variation 1564
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1289235686"
variation 1565..1571
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="atta"
/replace="attatta"
/db_xref="dbSNP:1331567359"
variation 1568
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1742997647"
variation 1570
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742996975"
variation 1572
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742995591"
variation 1575
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1742994796"
variation 1576
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:929048520"
variation 1578
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:369693784"
variation 1596
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1259977140"
variation 1603
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1483507690"
variation 1604
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1202138533"
variation 1605
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1742990821"
variation 1609..1612
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:897488737"
variation 1617
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:1176718170"
variation 1623..1631
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="aaat"
/replace="aaataaaat"
/db_xref="dbSNP:1421192369"
regulatory 1624..1629
/regulatory_class="polyA_signal_sequence"
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="hexamer: AATAAA"
variation 1625
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="c"
/db_xref="dbSNP:1464857841"
variation 1630..1635
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="att"
/replace="attatt"
/db_xref="dbSNP:1580860318"
variation 1638
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="g"
/replace="t"
/db_xref="dbSNP:1742987371"
variation 1639
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="a"
/replace="g"
/db_xref="dbSNP:1742986932"
variation 1646
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="t"
/db_xref="dbSNP:879097828"
variation 1647
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1182336846"
polyA_site 1649
/gene="CENPK"
/gene_synonym="AF5alpha; CENP-K; FKSG14; P33; Solt"
/note="major polyA site"
ORIGIN
gcagaagtccggggctggcaagcgcttcctgcgcagcgcctaggcgacctggagtttgtgacgctgtgatggtctagaggctggagattcaagatctgggtgccatcattttctggttctgttgatgaccctcttccaggaggatctagatccggatagtactacagatgtgggagatgttacaaatactgaagaagaacttattagagaatgtgaagaaatgtggaaagatatggaagaatgtcagaataaattatcacttattggaactgaaacactcaccgattcaaatgctcagctatcattgttaattatgcaagtaaaatgtttaaccgctgaactcagtcaatggcagaaaaaaacacctgaaacaattcccttgactgaagacgttctcataacattaggaaaagaagagttccaaaagctgagacaagatcttgaaatggtactgtccactaaggagtcaaagaatgaaaagttaaaggaagacttagaaagggaacaacggtggttggatgaacagcaacagataatggaatctcttaatgtactacacagtgaattgaaaaataaggttgaaacattttctgaatcaagaatctttaatgaactgaaaactaaaatgcttaatataaaagaatataaggagaaactcttgagtaccttgggcgagtttctagaagaccattttcctctgcctgatagaagtgttaaaaagaaaaagaaaaacattcaagaatcatctgtaaacctgataacactgcatgaaatgttagagattcttataaatagattatttgatgttccacatgatccatatgtcaaaattagtgattccttttggccaccttatgttgagctgctgctgcgtaatggaattgccttgagacatccagaagatccaacccgaataagattagaagctttccatcagtaaaaggatgttttcttttttcacacagtaaaaattcttatcattcaaggatattggaaccacaggactatttggataaaaaacattatttgcaaattaatgcgcataggccatcttacttttattgcaaaatggcatgtgctgccatctattattcatttttaaatggtcatttcttattcagtgagtgctttagtgttttaaactatatggataagaatgcaggtagataatattctaggcataaaacatttaatgtaccttacctcatgcaatattctttggattctttgttgatttatgatattgctaatataatattttcttaaaatatataacaatatcttttatgcattttgagttccagctggtgcttctttatatttagaaattataatgggaaggtcatttaatttacagatggttttaaaattgaggtaatatctgaggtggcataatttaaaaatatttagcaaatttgtttcatatatactgtcttatttctagatttgtttaaaattggaatatgaaaaactaatggataaagctagcataaaattgatattttagtttgtattattaatatatcatgttaccttatatattaatctactcttgattctgctaattattaccaacaaaattgtattcatgacattttattaatcctctgtgaattttctgtaaataaaattatttctgaaaatctcta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]