GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-01 12:40:33, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XR_011016228            1028 bp    RNA     linear   VRT 08-SEP-2024
DEFINITION  PREDICTED: Danio rerio uncharacterized lncRNA (LOC137496124),
            ncRNA.
ACCESSION   XR_011016228
VERSION     XR_011016228.1
DBLINK      BioProject: PRJNA13922
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_007118.7) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_000002035.6-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/15/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1028
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="7"
     gene            1..1028
                     /gene="LOC137496124"
                     /note="uncharacterized LOC137496124; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 9 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:137496124"
     ncRNA           1..1028
                     /ncRNA_class="lncRNA"
                     /gene="LOC137496124"
                     /product="uncharacterized lncRNA"
                     /db_xref="GeneID:137496124"
ORIGIN      
ggatggatgggtggacagacaaacagacagacaaagagaaggatggatggatggatgtgtagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatagatgtagaaatacatagatggatgggtagagtgatggacagatgttcagtagatgaatagatagatgggtagatgcatacagttatgtataaatggcacattagtagataagggtaaacagatgacaagaagagattgatcaagctttaagactgaataagagtcatatagaagagtctaataaatagagagaaggttctagggttagctggatggacggatggatgattcaccattagacatgtgggagcttgatagatgagtatgaatggacagcggcacttttctgtaacactgttgactgttatcttatacttgtttcccccatcttctacatgtttcctaaacagcaggaagaaccggccgacaccagggtggagtatagactcactggagcagtgtcacatttaggaagcaaactgttttctggacactacataagtcacattcgggatccaagtgacgatggatggctgcgttgcagtgacttttccgtcaggaaaatcagctggacagaagcgtccgaagaaataaagaggaactgctacatgctgttctacatcaagcgatgagcagcagtttgtagccgacagtcctgaagaggtggagaacagcagactgagcttcagaagatccagagtcagaagattctgccagatacttgcaccaaaacccccctgagagcttcagaacacacatgaagatattttggattaaatcagagagctcctgaccctcatataaaggaaacattcatgttactccacccttgctgtatatggagggtcaggggacagatgaatgaaaggctgaacagtttggaactatatgagtgcaagtaaatgatggcagatttgatgtgaactgtaacttgagcactgcaatcaataaaaattatttttccaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]