LOCUS       XR_002459917            1883 bp    RNA     linear   VRT 15-JUN-2017
DEFINITION  PREDICTED: Danio rerio highly divergent homeobox (hdx), transcript
            variant X2, misc_RNA.
ACCESSION   XR_002459917
VERSION     XR_002459917.1
DBLINK      BioProject: PRJNA13922
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_007125.7) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Danio rerio Annotation Release 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1883
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="14"
     gene            1..1883
                     /gene="hdx"
                     /note="highly divergent homeobox; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 7
                     ESTs, and 100% coverage of the annotated genomic feature
                     by RNAseq alignments, including 81 samples with support
                     for all annotated introns"
                     /db_xref="GeneID:797948"
                     /db_xref="ZFIN:ZDB-GENE-140106-165"
     misc_RNA        1..1883
                     /gene="hdx"
                     /product="highly divergent homeobox, transcript variant
                     X2"
                     /db_xref="GeneID:797948"
                     /db_xref="ZFIN:ZDB-GENE-140106-165"
ORIGIN      

tgtcacatctgacgtcacgatcatgattagaattgatgatcggacgttttgatttcattgtctagccaggggattcgtaaagaaatctgctgaattcgagggggccgttgattttctacgaaagatctggggagtctaacctgaagcgtgcaggaacacatgtgtttataacgtcctccctggtacagctttttttcctcccagaaacgtctcctaaaagcagatggctgaatgctggtgtgaatagatttacacccagcagtgcgtctctgctgcatgttcagattaatcaacctgattcctggggtctctcagcacatccatcagagggatggaaaaatggctggaaaagaggagcattcacactatgaacttgcggtctgtatttactgccgagcaacagcggatcctggaacgctattatgagaacggcatgaccaatcagagcaagagctgcttccagctcatcctgcagtgtgctcaagagaccaaacttgacttcagcgtggttcgaacatgggtaggaaacaagcggcgaaagttggcatctaaggcagatcagaatggggctactgctcatggtctaccccatcaacacttgggcgctgctggggcgtttgttgccggatcagtgttaacagcagagatggcagccatgcggaacattcagcgcggcccttcagtgacccacctccttcctccacaggcctcatcctcctcatcatcgtcttctccgtcatcttcctctccgctcagcggacacagtgacgtgatactgacaggcatatatgccagctgctttgatgcttctgctcaaaacaggacagggaccaagtcgttgcccttgcacacagaaatggagttgccaggtcatgatcgcacagatgcagctttgcatcgcaccactattgcagccgctatccagcgtaaagcccccatcatccccagtcccggtgcactcaaacccgtcacatccagagactctgcagtaatcgctcccagttgggccaagccatgcagaacatctcaacctccatcatggaatcttacctcccccctaaaaacgtctgtggctcatcggggtcctgtagacagcggtgctcaggttcagcaagctttgaccgtggctggattaggagagcgacctcccacaggaaacgctccagaaaccgtggtgagaaaatcgaggccggtcgatgcatcggagatcttctcgattgccatggaaacggcagacgctgatgacgaatattccagagaagaggagctggcgaacatggcggtgcagatgcagtgcagtaaaggatctgtggatggtgggcggagatccagcgcaggttcctctgccttggttgacagcccaggactatcagaaaagagccagtcagcctgtgcgctcaacctctcaaactctgctctttttggagagaagggatgcaaaaccagcagcttcttgctgaacagatcatcgtcccctatcagcttaccattaaaactgatctcccaggcatcgtccagaattccctgtctcaaggtaacaagtaacatgtcagctctttggcttcacagtaactcccggaaaagaacgtgtttattaagctgcaggacaggacgcagtttagcgacagagacttgtacacactgaagcgctactgggataacggcatgaccagcctgggctctctgtgcaaagagaagatcgcagccgcagctattcaactcaatgtggacactgaaatcatcaagacgtggattggtaaccgcagacggaagtaccgtctcatgggcattgaaattccaccacctaaaggaggaccaatcatgttctcaaatcagccagcgccgcattcacctcacatccctgaagatgactttcagactgc

//