LOCUS       XM_021476989            1201 bp    mRNA    linear   VRT 08-SEP-2024
DEFINITION  PREDICTED: Danio rerio claudin 10d (cldn10d), transcript variant
            X1, mRNA.
ACCESSION   XM_021476989
VERSION     XM_021476989.2
DBLINK      BioProject: PRJNA13922
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_007117.7) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 8, 2024 this sequence version replaced XM_021476989.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_000002035.6-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/15/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1201
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="6"
     gene            1..1201
                     /gene="cldn10d"
                     /note="claudin 10d; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 10 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments"
                     /db_xref="GeneID:563994"
                     /db_xref="ZFIN:ZDB-GENE-120215-133"
     CDS             261..1076
                     /gene="cldn10d"
                     /codon_start=1
                     /product="claudin-10"
                     /protein_id="XP_021332664.1"
                     /db_xref="GeneID:563994"
                     /db_xref="ZFIN:ZDB-GENE-120215-133"
                     /translation="

MASRTVIMYVEIACFVSCLSGWVLICSTMVTEYWIVSESAEVVLAAGDFYSNLWMDCVSDATGASDCKYFPSMMDLPAFLHISRALAVIAVIFGFWGAVLTLIGMKCTKIGGSELVNARITFAAALTYMASGLSGMTVYSWWGEKSRSEYLDPYYLDLKYELGAALFIGWGGSCLIIGGSGVMGYFSGKEAFPQSFSKQFRKPPTYLTARTRRTYMMGSRPTTVVIPPSQQSYSKRRASRVSRASRGRTETQESQSSRSVRPAWPLLDSVV"

     misc_feature    282..797
                     /gene="cldn10d"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
     polyA_site      1201
                     /gene="cldn10d"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

gccggataattgagtattccaggaagggagaacgggaagagccgtttgagaaatgatggttggccgctgatgtctgtttggttttaatgggaacactttagctggctggagcagatccagaaaagagctcgtgaaattctgccagagtgaactttaggtttgcactgtaggagattcagaagcgattaaggataaaaaagctctacaatgatgacccggatcttacctggatctgcaggagcatctcttgtgccggcagaatggccagtcgaacagtgatcatgtatgtggagatcgcctgttttgtgtcctgtctgagtggctgggttttaatctgctccactatggtcactgaatactggatcgtgtcagaaagtgctgaagtggtcctcgccgccggtgatttttactcaaacctttggatggactgtgtttcagatgctacaggagcttcagactgtaaatactttccctccatgatggacctgcctgctttcctccacatctccagggctcttgctgtcatcgctgtgatctttggcttttggggggctgttcttactctcattgggatgaaatgtaccaaaatcggaggatctgaactggtcaacgccagaatcacatttgctgcagcattgacatacatggcatcagggctttctggaatgacagtttattcctggtggggagagaaatcacgctctgaatatctggatccatattatttggatttaaagtatgagcttggtgcagctctcttcatcggctggggaggctcgtgtctgattataggtggaagtggagtcatgggctatttctctggaaaagaggcttttccccaaagttttagtaaacaattcagaaaaccaccaacctatttgacagctcggaccagacggacatacatgatgggctccagacccacgacagtggtgattcctccgtcgcagcagtcctacagcaagaggagagccagcagagtgagcagagccagtcgggggaggacagaaactcaagaaagtcagtcttcaagatctgttcggcctgcctggcctcttctagactctgttgtttgacctatacaatgcaatatgtttctggatcaacatctttattcttccttgaacagctttccattcggcctgggacagtagagggacagtatacagttacttctcaataaaaataaggattagtgctt

//