2024-11-01 14:41:17, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XM_017356690 6733 bp mRNA linear VRT 08-SEP-2024 DEFINITION PREDICTED: Danio rerio cell adhesion molecule L1-like b (chl1b), transcript variant X6, mRNA. ACCESSION XM_017356690 VERSION XM_017356690.3 DBLINK BioProject: PRJNA13922 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_007117.7) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Sep 8, 2024 this sequence version replaced XM_017356690.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_000002035.6-RS_2024_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/15/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..6733 /organism="Danio rerio" /mol_type="mRNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="6" gene 1..6733 /gene="chl1b" /note="cell adhesion molecule L1-like b; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 11 ESTs, 1 long SRA read, 5 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 33 samples with support for all annotated introns" /db_xref="GeneID:100318566" /db_xref="ZFIN:ZDB-GENE-091105-1" misc_feature 1 /gene="chl1b" /experiment="COORDINATES: cap analysis [ECO:0007248]" /note="transcription start site" CDS 343..4164 /gene="chl1b" /codon_start=1 /product="neural cell adhesion molecule L1-like protein isoform X5" /protein_id="XP_017212179.2" /db_xref="GeneID:100318566" /db_xref="ZFIN:ZDB-GENE-091105-1" /translation="
MRLLRKTLLLLAACLNMSSRYQTNALEIPLDVEQLPTITEYSPASLIAFPFEESFPVKCEATGNPEPEFRWTKNGQDFDPYQDTRLITLDDSGTFIIPNTGNLTEFQGIYRCFATNKLGTAMSEEIEFIIPNVPKFPKEIIDPIEVMEGQSVILECNPPTGIPPLQIYWMTISLQHIEQDERVSVGLNGNLYFSNTVETDSRRDYCCFAAFPRIRTIVQKTAMSMVVKSTNSLLERKPSLLAPTGMESHTRLVKGEDLQLECIAEGFPTPKVEWVKIGFNKLPERVVVESHGKLLTVEMVNEEDEGKYMCRAKNPHGEVVHHFHVTVEEPPEFEIEPQSQLVTIGADVLIKCVVKGNPQPTVGWRVNGRPLNEVPTSNRKILKDGTISIHNANPENSAVYQCEATNKHGTILANANIMIMNIQPLILTENNLQYMAVEGKSVVMHCKVFSSPASSITWSKADSANAVEGERFTVHQNGSLEIHNVMKEDMGEYSCFAQNTEGKVAIAATLEVKDPTRIVDPPRDLRVLAGTTIQFSCQPEFDPSFGDDFEVLWEKDGIALNGSEDGRYILEDGVLEIINVSFGDQGFYACVARTPVDQDVAVAQLSVVDVPDPPEDVILSEHNGRSVKLQWTPGDDHNSSITEFVLEFEESQHEPGSWREMMRVPGNHHSAPLKLYGHVDYRFRVSAINEVGKGRPSQSTERYKTPASAPDKNPENIKIEAHLPHEMDINWEPLSPIEHNGPGLEYKVSYRRHGSDEDWTERMVKRHSFLVKNTPTFVLYEIKIQAKNHAGWGPDPKIITAYSGEDFPSAAPDDVAVEVLNNTMVKVRWEHVHKDKIHGHLGGYRVSWWRLRSLLDSKKTHGDKHTLTFSGERNHAVVTGLKPFSEYSLIVMAFNSRGNGPGSHSVNFKTPEGVPGQAAAFSATNIQKHKVTLTWSPPVDANGVLIGYILQYQLINNTEELGPLMTLNISADSNKQHLENLEALSKYKFYLRCCTRVGCGPAVSEERTTVPEATSTDVASFNIRKSSSRFPPRKTTVSPVANATLSSIAVLNISTSVSHNYANISWIPGTEQTESELYVAFMNNREGNWKISDMLNSSKTFHIIEGLEPGTEYTVRLMTKSWVDNSSIFEDVIRTRAKGLASIHGSISNQGWFIGLMCAIALLTLIVLIACFVNRNKGGKYSVKEKEDLHPDLESQGINDDTFCEYSDNDEKPLKSSQHSLNGDLKGGDSGDSMVDYCDEDAHFNEDGSFIGEYSGRKDRASMEIKGNNQSTA"
misc_feature 448..729 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 505..519 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409396" misc_feature 544..558 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409396" misc_feature 619..633 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409396" misc_feature 667..684 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409396" misc_feature 709..720 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409396" misc_feature 754..1026 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 796..810 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409432" misc_feature 838..852 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409432" misc_feature 907..921 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409432" misc_feature 952..969 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409432" misc_feature 1000..1011 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409432" misc_feature 1078..1323 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 1114..1128 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409394" misc_feature 1153..1167 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409394" misc_feature 1219..1233 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409394" misc_feature 1261..1278 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409394" misc_feature 1300..1311 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409394" misc_feature 1354..1593 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 1384..1398 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409367" misc_feature 1423..1437 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409367" misc_feature 1495..1509 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409367" misc_feature 1537..1554 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409367" misc_feature 1576..1587 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409367" misc_feature 1618..1878 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 1666..1680 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409544" misc_feature 1705..1719 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409544" misc_feature 1774..1788 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409544" misc_feature 1816..1833 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409544" misc_feature 1855..1866 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409544" misc_feature 1882..2184 /gene="chl1b" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 1939..1953 /gene="chl1b" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409359" misc_feature 1990..2004 /gene="chl1b" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409359" misc_feature 2059..2073 /gene="chl1b" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409359" misc_feature 2101..2118 /gene="chl1b" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409359" misc_feature 2140..2151 /gene="chl1b" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409359" misc_feature 2173..2445 /gene="chl1b" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(2173..2175,2371..2373,2416..2418) /gene="chl1b" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature <2383..3582 /gene="chl1b" /note="Fibronectin type 3 domain [General function prediction only]; Region: FN3; COG3401" /db_xref="CDD:442628" misc_feature order(2419..2424,2428..2433) /gene="chl1b" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 3487..3705 /gene="chl1b" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature 3865..4116 /gene="chl1b" /note="Bravo-like intracellular region; Region: Bravo_FIGEY; pfam13882" /db_xref="CDD:464016" polyA_site 6733 /gene="chl1b" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
agatctggctttgtgggagtgattgtcactcgtttaatgagcttctttgccaggcgagaggctttggcaacatatgtctccccagtcgcctctctcgctctgttagtaccgggtctgctgtggtggacgtttctctggattttcttctctttctcaagcctgtgggattagacagagcagaaaaggaagggtttgtctgtatttctgaggacgagcggactagaatgaagcagattcctgtagcgagaccacagcctgggttggagtgagatgcactgactcctggcagactgcagatttccctgtcatcctccgctctcgcctctgaaactgtggccagtcatgcggttgttacggaaaaccctgcttcttttggctgcttgccttaatatgagcagcaggtatcaaactaacgccctggaaattccacttgatgtggagcagctgcccacaattacagagtactctcctgcctcgctcatcgccttccctttcgaagagagcttccctgtgaagtgtgaggccacaggaaaccctgaaccagaattcaggtggacaaagaacggccaagactttgatccgtatcaggacaccagattgataacgttagatgattccggaacattcatcattcccaataccggaaatctcactgaattccagggcatttatcgctgttttgcaaccaacaaattggggacagccatgtcagaagaaattgagttcattattcctaatgtcccaaagttccccaaagagatcatcgatccgattgaggtgatggaaggtcagtcagtcattctagagtgcaatccacctacagggatccctccattgcaaatctactggatgacaataagtctacagcacatcgagcaggacgaaagagtgtcagtgggtctgaatggaaacctgtacttctcaaacaccgttgaaactgatagccgcagagactattgctgctttgctgccttccctcgcatccgaactatcgtccagaaaaccgctatgtccatggtggtcaaaagcacaaactccctgttggagaggaagcccagcctgttggcgcctacaggaatggagtcacatacacgcctggtgaaaggtgaagatcttcagttggagtgtatagcagagggattccccacgccaaaggtggaatgggttaaaataggcttcaacaagcttccagaaagggttgttgtggagagtcatgggaagctgctcactgttgagatggtgaatgaggaggatgaaggcaaatatatgtgcagagccaaaaatccccacggagaggtggtgcatcattttcatgtgacagtagaggagcctcctgagtttgagattgaacctcaaagccaactggtgacgattggagctgatgtattgatcaagtgtgtcgtgaaaggaaatcctcaacctactgtaggatggagagttaacgggcggccactgaacgaggtcccaacatccaacaggaagatcttgaaagatggcacaatttccatccacaatgcaaacccagaaaacagtgctgtttaccaatgcgaggcaaccaacaaacacggcaccatcctggccaatgccaacatcatgattatgaacatccagccgctgatcttaacagaaaacaatctgcaatatatggcggtggaggggaaaagtgtggtcatgcactgcaaggtcttcagctctccagcctccagcattacgtggagtaaagctgacagtgcaaatgcagtggaaggagaacggtttactgttcaccagaatggttcactggagatccataatgtgatgaaagaggacatgggagagtattcttgctttgcacaaaacaccgaaggcaaagttgccattgctgcaacacttgaagtcaaagatcccaccagaatagtcgatcctccacgtgatttgcgggttttggcgggaaccactattcagttttcatgccagccagagtttgatccctcttttggtgatgactttgaagtcctgtgggagaaagatggcattgccctcaacggcagcgaagatggaagatatatcctggaagacggagtgctggagatcattaatgtgagtttcggagaccagggcttttacgcgtgtgtggccagaacgcccgttgaccaagacgttgcagtggcacagctttcagtcgtggatgttcctgatccaccagaggatgtgatactgtctgaacataatggccgaagtgtgaaactgcagtggactccgggagatgaccataatagctccattaccgagtttgttctagagtttgaagaaagccaacatgagccaggcagctggagggagatgatgagagtcccaggaaaccatcactcagctccgctgaagctttatggacatgtggactaccgcttcagagtctccgccatcaacgaggtgggcaaaggtcggccaagccagtccactgaaagatacaaaactccagcatcagcacccgacaagaacccagaaaatatcaagatcgaagctcatttgccacatgaaatggatatcaactgggagccgttgtcacctattgaacacaacgggcctggtctggagtacaaagtgagctacaggagacatggcagcgatgaagactggacggagcgcatggtgaagaggcactcatttctggtcaaaaacaccccgacgttcgtcctttacgagatcaaaattcaggccaagaaccacgcgggctggggtccggaccctaaaataataacagcgtactcgggagaggatttcccctcagcagctccagatgatgtagccgtagaagtgttgaacaacactatggtgaaggtcagatgggaacatgttcacaaggacaaaatacatggacatctgggtggctacagggtgagctggtggaggcttcgtagtctgctggactcaaagaaaacacacggcgacaagcacacattgacattctcaggcgagaggaaccatgcggtggtcacaggtcttaagccgttctccgaatacagcctcattgtcatggcctttaacagcagaggaaacggtcctggcagtcattcggtcaacttcaaaacccctgagggagttcctggtcaagcagctgctttcagtgctacaaacatccagaagcacaaggtcaccttgacctggtctcctccagttgacgcaaatggagtcctaattggctacatcctccaatatcagctaataaacaacacagaggaactaggccctctgatgacactcaacatctccgccgacagcaataagcagcacctcgaaaacctggaagccctgagcaaatacaaattttaccttcggtgttgcacgcgggtgggctgcggtcctgcggtcagcgaggagcgcaccaccgtccctgaagccacttcaacagatgtggcctctttcaacatcagaaaatccagctcacgatttcctccaagaaaaaccactgtttcccctgtggctaatgctactctttcttctatagcggtgttgaatattagcacctcagttagtcacaactatgcaaatatcagctggattccaggcacagaacagacggagtcagagttatatgttgcctttatgaacaaccgtgaaggtaactggaagatatccgacatgctaaactcttctaagactttccacatcattgaagggctcgaacctggaaccgaatacacagtgcgtcttatgacaaaaagctgggttgataattctagtattttcgaagacgttatcaggaccagggccaaaggtctggccagcattcatggaagcatctcaaaccagggatggttcatcggactcatgtgtgccatagcgcttctcaccctcattgtgctcatagcgtgctttgtcaaccgaaacaaaggcggcaaatactcagtaaaagagaaggaagacctccaccccgacctggagtcccagggcataaatgatgacaccttctgtgaatacagtgataatgatgagaaaccgctgaaaagcagccagcattcattgaatggcgacttgaaaggaggagacagcggagacagcatggtggactactgtgatgaggacgctcacttcaacgaggacggctcttttatcggagaatactctggacgcaaggacagggcctccatggaaatcaagggaaacaatcagagcacagcgtaatggaccacggacaatttatttgttggacaagctctcacaaaaggtcagtcaaaaggaagcggagggaataaaagtgtggcgtaacagcacccgaaggacatttttgcaattaatgtgttattgtcaaatcctcagtcatactcacatcattttttacagggcttagttgtttccatttttttctgcgtgctgttactgatcaatcatgtcagttgtgtatacttttgtgaggtgtttttgtattaaatctttgcaaatcattgatgactgccgggaaagttctgctttcaacgtcatcatgtagccaagccagtttttctgtcagggtatatgaactttgtatttttatttttcattccaggcaaatattattgacattttatatttcagacactgtatactgtgcgttcattaaatgtgggttattatgtgtacaaaaggagttgttgcttaaataatcataagttctgttaaaatccaaaaaaaatgaaagaaagcgtaaggcgatgtaagggtttacaattagtgtaaaatgctttgatgaacagtttcacattgagctatactaacaagcttaatagccatattcagcaccacataaaccctacagtgcatctgctgctgttttaaccctttacatacagtataatacagtattttatcaaaaagacacctaatgttcatacatttaaagaaaaaaaaatgcctcaattgccttataatgactttgaatctggtaagtaagatataacaatggggtatgtgcacatggagttttaatttcagccagccagcctcagtgtttccggtgaactgtctttcctttataaaatcgccacgtttaagatctggtttcgttagaaatcagtgatcctcactgcctgatagatatacaatgtgaagagggtctcagatcgaaaaaagaagcactgcatttaatttcattttccctttccatgtctttaaaatatgtacaattaatttttgtattttcaattgagtttctgcattagcctgctgatactgatggcgtgtcacagatgttttcatactgcatgactatctagggtagcattctgttagtgatgtgtttacattttaggatggattggcgacagggggtttcacactgcatgactttacagtaggaagaatcgccgttgactttgtccaaactttgtctcacaatcaaacacacaagagaagtgacatggaaaaggatgtccgcgaggtcctaaaatgtattaaaagttgattaatcaattaagagaaaattaaagcttaaaaggtatttaaaaagtcttaatcacacttttacgaggttttataaattagctcaagcattgtccaaagtgtttgattccaaaaagtataatatatttatggctcgatccacgcgattggttcaggccggggtatgtccggccaagctcctccgttcgagtgatgtcacgtaatttgcaacaaatacgggaaggtgatgctctccacatgtagcgaaaccatagagcgaaacagacggcaaaatgagaaaatgtaagtactcctggttggagaaagacgagtttaaacagtagctgaagcctgtcgtttaaaacaaccacgtaatttattctttcaagctttgtttcttcttgagttctgttgcatgattatgctctattgatttaactacaacacgtagtgtatcttgggttatcaaccatatgcctttagtggggtagcaaatgtacttatttctcctcaacattttattctttatcgatccagttgtggtgttgctcagatgacatgtcaaacagatgcgtgtgctcctgccaaatttccatagttttcctccttttcttggatccaaataaactgagattgagcgcttttaacttctccctgctgatacccatactagcggatgcagctctctcattggctgcaggtaatcgcaaatgttattttcaatcagaacacatttcacacagcatgatttgaatcgccgacagacccaaatatttagcacgccaaatatctcaagggtgtcagcgactcatctgggattctctcagatcgcgtctttgatagttcatactgtgtgattgttactcacatgaatgagcaacgattcacttttgatttcaggcatttgtctgcgatttctcaaaacctgtcggcaaaaaatctgggctaaactcttgcagtctgaactcggcataagtctatttaactgaatgtatttgaattacattataacattgatgctgtaaaaggaacattatgaaactgagaatgtctggctggaaacactagctgtgcatataccccattctcatggattccgtgatacagggttggaattctacaaattccacattggcatcctttgaaatatttctcttcacaaacggacagttctgaaagccaacaagtcttgtttgaacaattctgtatgtttttttgcaatggctccacatatagagtcaaagccagattctgtacaatgttctgtgaattctgtttgcatgttgaaagaggtctgtgtgcagatttgacattaaattgtatcatttctttcttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]