GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-01 10:33:03, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_017353733            3764 bp    mRNA    linear   VRT 15-JUN-2017
DEFINITION  PREDICTED: Danio rerio FYVE and coiled-coil domain containing 1a
            (fyco1a), transcript variant X3, mRNA.
ACCESSION   XM_017353733
VERSION     XM_017353733.2
DBLINK      BioProject: PRJNA13922
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_007134.7) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 15, 2017 this sequence version replaced XM_017353733.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Danio rerio Annotation Release 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3764
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="23"
     gene            1..3764
                     /gene="fyco1a"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 ESTs, 10 Proteins, and 97%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 26 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:565649"
                     /db_xref="ZFIN:ZDB-GENE-110411-276"
     CDS             156..3692
                     /gene="fyco1a"
                     /codon_start=1
                     /product="FYVE and coiled-coil domain-containing protein
                     1-like isoform X2"
                     /protein_id="XP_017209222.1"
                     /db_xref="GeneID:565649"
                     /db_xref="ZFIN:ZDB-GENE-110411-276"
                     /translation="
MATGAAVGDSQIQRIIRDLRDAVSELTKEYKESGEPITDDSSNLHKFSYKLEYLLQFDQKEKTTFLGSRKDYWDYFSDCLAKIKGANDGIRFVKSISELKTSLGKGRAFIRYSLVHQRLADTLQQCLMNSRVTSDWYNPRSPFLKPHLSVDIISYLYELNDVQFDVASRGHDLDAEWPTFARRTLGMTSSPSHLWKAPSRSSSINSLASTYSQQHHEFPGSPDFGPGLLSDMSMQNSSILNDTSMSAIDELRLELDQSELKQRELIDRIQQLGDEGSELRGVVVELQRQLDVSLAAQGNHQELQRNLEVLIESEHALSREVEVLRDRETRREVSHKDLQDMLAAAERKNEELMTRLDGVLDEKGQRAASDFNSAQKIHELLNELKEAEKKRMDALAEGEEKRRHAEHLAEEVKVKDEALKEAEVKMAAWMEKGEQLQTRAVEQRNFMEKLQGALAVREKETSNLQRQLRDLQNSLENMEKQANVEKKRMQDDKEELEMKMNGLEGLLQSLRTQLKVKESDLLSSTKRVHFLERESEKLRSENQKLEYELENSTKKEAKKIDEYKDSCAKLIEQNTKLLQTVNKNEESKKELLENKSSLESELAGLRASEKQLRAQIDDAKVTVDEREQRLREENRNLDESLQKANMQLEESESSIRQKEQENKDLMEVQVTLKSALAAMQKEIRDINNQIGELEKNLGVARCNEANLNAQLKDKATQLEDREKLCEELQGRVEELESRQRDLEVEKTKAERAFVKQTEMIQSLEAQRNLAEKTQLEKSTCQAKETKEMALKLTLLEDQLGLSAKEVSKLQEEVVNLRAKLHSAVEEKDKTQAKLEVTEASCAELRILTEHLKKQAEEQNRLHVSELLQSSEHVDKLTSQLNQETSAHEKTTAALASAKEDLVALKAQNERMVLENAETRESLHRVNTEMAELGMTICKLTAEREEARERWAAEAVRIQELQQHGVKETERLNASLVALHQENSSLQEELQQTDKLSETMLELKQLLDKTEGERDAAREEITAVKFQMSTESMSLKHQMKSLQEEIDGLKDQLDTERKKKSELEAKLSELEGANVEYSRLIEEKDSHITYCETLLRESESETQQLQERASRSKEALSDVEKEREELKQKLDQVLMETQNQHLRMSAELEDLGQTKVNLEERLIELIRSVFHLKLQLFFL"
     misc_feature    183..653
                     /gene="fyco1a"
                     /note="RUN domain found in FYVE and coiled-coil
                     domain-containing protein 1 (FYCO1) and similar proteins;
                     Region: RUN_FYCO1; cd17698"
                     /db_xref="CDD:439060"
     misc_feature    <858..1808
                     /gene="fyco1a"
                     /note="chromosome segregation protein SMC, common
                     bacterial type; Region: SMC_prok_B; TIGR02168"
                     /db_xref="CDD:274008"
     misc_feature    1494..>3680
                     /gene="fyco1a"
                     /note="chromosome segregation protein SMC, common
                     bacterial type; Region: SMC_prok_B; TIGR02168"
                     /db_xref="CDD:274008"
ORIGIN      
acactcctgagaagaagaagaaggcgaagacttcaatggcggagatgtctgtcaatcaaaaagtaggtcgtgccgtgatgtaaaggacaataacaacaaagcacaaaagtctaccgatgacctcttgacacctccagcaggaagctagtcagaccatggccactggtgctgcagtcggggacagtcagatccagaggattatcagagatctgcgcgatgctgtttccgaactgacaaaggagtataaagagagcggtgagcccattactgatgacagctccaatctgcacaagttctcctacaagctggagtatctgcttcagttcgaccaaaaggagaaaacaacatttctgggctccagaaaagactactgggattacttcagcgactgcctggccaaaatcaaaggagcaaatgatggaattcgcttcgttaaatcaatttcagagctgaagacgtctctgggcaagggcagagcatttatccgttactctctggtgcatcagcggctggcagacacactccagcagtgcctcatgaactccagagtcaccagtgactggtataatccgaggagtccgtttctcaaaccccatctcagcgtggacatcattagttatctctacgagctcaatgatgtccagtttgatgtggcatccagaggtcatgaccttgacgcagaatggcccacttttgccaggaggacattaggaatgactagctctcccagtcacttgtggaaagcaccgagtcgtagttccagcatcaacagtctggccagcacatactcacagcagcaccatgagttccctgggagtccagactttggacctgggcttttatcagatatgtctatgcaaaactccagcatactgaatgatacctcaatgagtgctatagacgaactccgtctggagcttgaccagtctgaattaaagcaaagagagcttattgaccggattcagcagttaggtgatgaggggagtgaactgcgtggagttgttgtggaactgcaaaggcagctagatgtttctttagcggcccaaggtaaccatcaggagctacaacgtaacctggaggtcttaattgagagcgaacatgcactctcccgtgaggtggaggtcttaagagatcgagaaaccaggagggaggtttcccataaagaccttcaggacatgctggcagcagcggagcgtaaaaacgaggagctgatgacaaggctagatggagtattggatgagaaaggtcaaagggcggccagtgatttcaactcagcccagaagattcacgagcttttgaatgaattaaaagaggctgagaagaagaggatggatgctctggctgaaggagaagagaagaggaggcatgctgaacatcttgccgaggaagtcaaagtgaaagatgaagctctcaaagaggctgaggtgaaaatggcagcttggatggagaagggtgaacaactgcaaaccagggcggtggagcagcgtaatttcatggagaaacttcaaggtgcacttgcagtaagagagaaagagaccagcaacctgcagaggcaactacgagatcttcagaactctctggagaacatggaaaagcaggccaatgtggagaagaagaggatgcaagatgataaagaagagcttgagatgaaaatgaatggtctagaggggctgttacaatcacttcggacacagttaaaggttaaagaatctgatcttctctccagtaccaagagagttcatttcctggagagggaatcagagaagcttaggagcgagaatcagaagttggagtatgagttggagaacagcaccaaaaaggaggccaagaagattgatgaatacaaggatagctgcgccaagcttattgagcaaaacactaagcttctgcagacggtgaataagaatgaagagagcaagaaagagttgcttgaaaacaaatcatccttggagagcgagttggcgggattgagggcctcagagaagcagttacgagctcaaatcgatgatgccaaagtgactgtggatgaacgagagcagcggctgagagaggagaacagaaatctggatgagagtctgcagaaggccaacatgcagctggaggaatccgagagctcaattcggcaaaaggagcaggagaacaaggacctcatggaggttcaggtcactcttaaatcagctctcgcagccatgcagaaagagatacgtgacataaacaaccagatcggtgaacttgagaagaatcttggagttgcgaggtgtaacgaagcaaatctgaacgcgcagcttaaagataaggccacccagctggaagatcgagagaagctctgtgaggagctccagggaagagtggaagaactggaaagtcggcagagggatttggaagtggagaagacaaaagcagaaagagcctttgttaaacaaacagagatgattcagagtcttgaagcacagagaaacctggcagagaagacacaacttgaaaaaagcacatgtcaagctaaagaaactaaagagatggccttaaaattgactcttctagaagatcaactgggattgagtgcgaaggaagtttctaagctacaagaggaagtggttaatctcagggctaaacttcacagtgctgtggaggagaaggacaagacgcaagcaaagcttgaggtcaccgaagcttcctgtgctgaactgcggatcttgactgagcacttgaagaagcaggccgaggagcagaatcggctgcatgtgagcgagctgctgcagtctagtgaacatgttgataaattaacttcgcagctgaaccaggagacctcagcgcatgagaaaaccactgcagcacttgcttccgctaaagaggatctagtggctctcaaggcccagaatgagcggatggtcctggagaatgcggaaaccagagagagtctccaccgggtcaacactgaaatggcagagttgggaatgactatttgcaagctcaccgccgagcgggaagaggcccgggaacgttgggccgctgaagctgtacgcatccaagaacttcagcagcacggagtgaaggagacagagcgactcaatgccagcttggtggctctgcatcaagaaaactccagtctgcaggaagagctccagcaaacagacaaactgtcagaaaccatgctggagctaaagcagctgctggacaaaactgagggcgaacgggacgctgcacgggaagagatcaccgctgtgaaattccagatgagcacagagagcatgtctctcaagcaccaaatgaagagtcttcaagaagagattgacggtttgaaagatcagctagacacagagaggaagaagaaatcagagctggaggccaaattatccgaactagagggagcgaatgtggaatactctcgtctgattgaggagaaggactcgcacattacttactgtgagactttgctgcgtgagagcgagtctgagacacagcaactgcaggaaagagcatcaagatccaaagaggctcttagtgatgtagagaaggagagggaagaattgaagcagaaattggatcaagtgttgatggagactcagaaccagcatctccgcatgtctgctgaactggaggacctgggacaaactaaagtcaacctggaggaacggctcattgaacttattaggtctgtgtttcacctaaaactgcagctattttttctttagatcaagttttatggctgaacatttagttttgtaaattaaataaagtgtaaatcatttttagtacataaaaca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]