LOCUS       XM_009291199            1610 bp    mRNA    linear   VRT 08-SEP-2024
DEFINITION  PREDICTED: Danio rerio vimentin-related 2 (vimr2), mRNA.
ACCESSION   XM_009291199
VERSION     XM_009291199.4
DBLINK      BioProject: PRJNA13922
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_007125.7) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 8, 2024 this sequence version replaced XM_009291199.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_000002035.6-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/15/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1610
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="14"
     gene            1..1610
                     /gene="vimr2"
                     /note="vimentin-related 2; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 4
                     ESTs, 2 long SRA reads, and 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 114
                     samples with support for all annotated introns"
                     /db_xref="GeneID:798092"
                     /db_xref="ZFIN:ZDB-GENE-160113-76"
     misc_feature    1
                     /gene="vimr2"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             29..1201
                     /gene="vimr2"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_009289474.1"
                     /db_xref="GeneID:798092"
                     /db_xref="ZFIN:ZDB-GENE-160113-76"
                     /translation="

MALLRVSSYRKLFEEEQTSLAAGRCGVQARFTARGGVSEIECPELDFAAARALNKEGASRFVHERSVIAALNDRLAGLIDVVRGLEEENESLEAEIIELKEKKESEQISTTTVSIRDPADFSLDAVIERLRKEKEEILCNTEELKGELRCLQMKCDQVVEHRTLIQQEREDVSVEVDAITTDCLALREQVGIYEEQLAAMERQHEMRLENLCEPGPLDEGFSTVSLQFPPFDITPAIMDIKGYYRTLAENLKFEFKGSHAAAVDAAGKEKKEEQLARLTGGKVKDISKETDVNVLKDLSAELEKELAELKKHGDELESEVKARKAKNLEEIEELENYISQLDEEEADLQFQIKDQSEDYEELLNQKMNLDIEIAAYRGLVEEEEERLSCL"

     misc_feature    218..1186
                     /gene="vimr2"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:459643"
     polyA_site      1610
                     /gene="vimr2"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

atcttgtcttttctcttgtgctgctgtcatggctctgctgagagtgtcttcataccgtaagctgtttgaggaggagcagacgagtctggctgcaggacgctgtggagtccaggcccgcttcactgcaaggggtggagtgtcagagattgaatgtcctgagctggattttgcagcagctcgtgcactaaacaaggagggtgcgtctcgatttgtccatgagcgttctgtcatcgctgccctcaatgatcgcctcgccggactcatcgatgtggttcggggattagaagaagagaacgagtctctggaggctgagatcattgagctgaaggagaagaaagagtcagaacagatctccaccaccaccgtcagcatcagagaccctgccgacttcagcctggatgctgtgatagagaggctgcgcaaagaaaaggaggagattttgtgtaacacggaggagctgaagggtgaactgcggtgtctgcagatgaaatgtgatcaggtggtggagcacaggactctcatccagcaagagcgagaggatgtttctgtggaggtggatgcaattaccactgactgcctggcccttcgagaacaagttggcatctatgaggagcagctggctgctatggagaggcagcatgaaatgaggctggaaaatctgtgtgagcccgggcctctggatgaaggtttttcaactgtatccttacagttccctccctttgacataacaccagccatcatggatatcaaggggtactataggacactggctgaaaatctcaagtttgagttcaaaggctcgcacgccgccgccgttgatgccgcaggaaaggagaaaaaggaggagcagctggccaggttgactggagggaaagtgaaggacatctctaaagagactgatgtgaatgtcctcaaagacttgagtgcagagctggagaaagagttggcagagctgaagaaacatggagatgagttggagagtgaagtaaaagctagaaaagccaaaaacctggaggaaattgaagagctggagaattacatttctcagctcgacgaggaggaggctgatcttcagttccagataaaggatcaaagtgaggactatgaagaactgctgaatcagaagatgaatttagacatagagattgctgcttacaggggtttggttgaagaagaagaggaaagactgagctgcctgtaagatgcaagaacaggtgatgctctcctctggactgaagcaaacgcataaaaacactaaaaccgcatgtagttcaacccttaacagcaagtctcacaaatcaggcaggtaaagaaaacagctgtcagacacacttaaccttctgaacagatgtaaaccttcactgacagctgaagttcagggagtttgtgtaagctcattgataacgggtcagtggcaggtaacctgggtcttgaagaaaccccaggatctgttcagcagtgggagtgtgtgctgagagtgatggggggattattagcacagagactgggagtttcattaatgcacattcctatatacagatacactactgttcaaaagttgggggcgagtaaggttttattaaacagaaagcattacttttattcagcaa

//