ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-11-01 12:35:00, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_001293681 2340 bp mRNA linear VRT 04-APR-2024
DEFINITION Danio rerio staphylococcal nuclease and tudor domain containing 1
(snd1), transcript variant p100S, mRNA.
ACCESSION NM_001293681
VERSION NM_001293681.1
KEYWORDS RefSeq.
SOURCE Danio rerio (zebrafish)
ORGANISM Danio rerio
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE 1 (bases 1 to 2340)
AUTHORS Wang,B., Du,X., Wang,H., Jin,C., Gao,C., Liu,J. and Zhang,Q.
TITLE Comparative studies on duplicated tdrd7 paralogs in teleosts:
Molecular evolution caused neo-functionalization
JOURNAL Comp Biochem Physiol Part D Genomics Proteomics 30, 347-357 (2019)
PUBMED 31059868
REFERENCE 2 (bases 1 to 2340)
AUTHORS Dai,X., Shu,Y., Lou,Q., Tian,Q., Zhai,G., Song,J., Lu,S., Yu,H.,
He,J. and Yin,Z.
TITLE Tdrd12 Is Essential for Germ Cell Development and Maintenance in
Zebrafish
JOURNAL Int J Mol Sci 18 (6), 1127 (2017)
PUBMED 28590408
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 2340)
AUTHORS Bayes,A., Collins,M.O., Reig-Viader,R., Gou,G., Goulding,D.,
Izquierdo,A., Choudhary,J.S., Emes,R.D. and Grant,S.G.
TITLE Evolution of complexity in the zebrafish synapse proteome
JOURNAL Nat Commun 8, 14613 (2017)
PUBMED 28252024
REMARK Publication Status: Online-Only
REFERENCE 4 (bases 1 to 2340)
AUTHORS Pasquier,J., Cabau,C., Nguyen,T., Jouanno,E., Severac,D.,
Braasch,I., Journot,L., Pontarotti,P., Klopp,C., Postlethwait,J.H.,
Guiguen,Y. and Bobe,J.
TITLE Gene evolution and gene expression after whole genome duplication
in fish: the PhyloFish database
JOURNAL BMC Genomics 17, 368 (2016)
PUBMED 27189481
REMARK Publication Status: Online-Only
REFERENCE 5 (bases 1 to 2340)
AUTHORS Elkon,R., Milon,B., Morrison,L., Shah,M., Vijayakumar,S.,
Racherla,M., Leitch,C.C., Silipino,L., Hadi,S., Weiss-Gayet,M.,
Barras,E., Schmid,C.D., Ait-Lounis,A., Barnes,A., Song,Y.,
Eisenman,D.J., Eliyahu,E., Frolenkov,G.I., Strome,S.E., Durand,B.,
Zaghloul,N.A., Jones,S.M., Reith,W. and Hertzano,R.
TITLE RFX transcription factors are essential for hearing in mice
JOURNAL Nat Commun 6, 8549 (2015)
PUBMED 26469318
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 2340)
AUTHORS Phetrungnapha,A., Panyim,S. and Ongvarrasopone,C.
TITLE A Tudor staphylococcal nuclease from Penaeus monodon: cDNA cloning
and its involvement in RNA interference
JOURNAL Fish Shellfish Immunol 31 (3), 373-380 (2011)
PUBMED 21745576
REFERENCE 7 (bases 1 to 2340)
AUTHORS Hoffmann,J.L., Thomason,R.G., Lee,D.M., Brill,J.L., Price,B.B.,
Carr,G.J. and Versteeg,D.J.
TITLE Hepatic gene expression profiling using GeneChips in zebrafish
exposed to 17alpha-methyldihydrotestosterone
JOURNAL Aquat Toxicol 87 (2), 69-80 (2008)
PUBMED 18339436
REFERENCE 8 (bases 1 to 2340)
AUTHORS Abe,S., Wang,P.L., Takahashi,F. and Sasaki,E.
TITLE Structural analysis of cDNAs coding for 4SNc-Tudor domain protein
from fish and their expression in yellowtail organs
JOURNAL Mar Biotechnol (NY) 7 (6), 677-686 (2005)
PUBMED 16132464
REFERENCE 9 (bases 1 to 2340)
AUTHORS Zhao,C.T., Shi,K.H., Su,Y., Liang,L.Y., Yan,Y., Postlethwait,J. and
Meng,A.M.
TITLE Two variants of zebrafish p100 are expressed during embryogenesis
and regulated by Nodal signaling
JOURNAL FEBS Lett 543 (1-3), 190-195 (2003)
PUBMED 12753931
REMARK GeneRIF: Two alternative transcripts of p100 are expressed during
embryogenesis and regulated by Nodal signaling.
REFERENCE 10 (bases 1 to 2340)
AUTHORS Abe,S., Sakai,M., Yagi,K., Hagino,T., Ochi,K., Shibata,K. and
Davies,E.
TITLE A Tudor protein with multiple SNc domains from pea seedlings:
cellular localization, partial characterization, sequence analysis,
and phylogenetic relationships
JOURNAL J Exp Bot 54 (384), 971-983 (2003)
PUBMED 12598568
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BX897731.7 and BX855622.6.
Transcript Variant: This variant (p100S) lacks multiple 3' exons
and extends beyond a splice site used in variant p100L. The
resulting protein (isoform p100S) is shorter and has a distinct
C-terminus compared to isoform p100L.
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF422806.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
SAMEA2168446, SAMEA2168447
[ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-288 BX897731.7 53106-53393
289-438 BX897731.7 56770-56919
439-559 BX897731.7 60710-60830
560-641 BX897731.7 60959-61040
642-802 BX897731.7 65530-65690
803-894 BX897731.7 70026-70117
895-1053 BX897731.7 71936-72094
1054-1160 BX897731.7 81197-81303
1161-1251 BX897731.7 82218-82308
1252-1356 BX897731.7 95334-95438
1357-1458 BX855622.6 19861-19962
1459-1562 BX855622.6 33936-34039
1563-1673 BX855622.6 38455-38565
1674-1746 BX855622.6 41870-41942
1747-2340 BX855622.6 46665-47258
FEATURES Location/Qualifiers
source 1..2340
/organism="Danio rerio"
/mol_type="mRNA"
/strain="Tuebingen"
/db_xref="taxon:7955"
/chromosome="4"
/map="4"
gene 1..2340
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/note="staphylococcal nuclease and tudor domain containing
1"
/db_xref="GeneID:324404"
/db_xref="ZFIN:ZDB-GENE-030131-3124"
exon 1..288
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
misc_feature 124..126
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/note="upstream in-frame stop codon"
CDS 211..1935
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/EC_number="3.1.31.1"
/note="isoform p100S is encoded by transcript variant
p100S; staphylococcal nuclease domain-containing protein
1; 4SNc-Tudor domain protein; p100 co-activator; 100 kDa
coactivator; staphylococcal nuclease domain containing 1"
/codon_start=1
/product="staphylococcal nuclease domain-containing
protein 1 isoform p100S"
/protein_id="NP_001280610.1"
/db_xref="GeneID:324404"
/db_xref="ZFIN:ZDB-GENE-030131-3124"
/translation="
MASAVPAQVQSSQASAPQLQRGIVKMVLSGCAIIVRGQPRGGPPPERQINLSNIRAGALARRAIQGQPDTKDTPDEPWAFQAREFMRKKVIGKEVCFTVENKTPQGREYGMVYLGKDTSGENIAESLVAEGLAMVRREGIRGNNPEQVRLCDLEDQAKSSKKGLWSEGGGSHTIRDLKYTIENPRNFVDSLHQKPVNAIIEHVRDGCMVRALLLPDYYLVTVMLSGIKSPTFKREADGSETPEPFAAEAKFFTESRLLQRDVQIILESCPNQVILGTILHPNGNITELLLKEGFARCVDWSMAVYTQGAEKLRAAERSAKERKVRIWKDYVAPTANLDQKDRQFVAKVMQVVNADAIVVKLNSGEYKTIHLSSIRPPRLEGEEKNKDKDKRFRPLYDIPYMFEAREFLRKKLIGKKVNVTVDYIRAATNAMEMGVPAFPERTCATVTIGGINIAEALVSKGLATVIRYRQDDDQRSSHYDELLAAEARAIKNGKGLHSKKEVPIHRVADISGETQKAKQFFPFLQRAGRSEAVVEYVFSGSRLKLYMPKETCLITFLLAGKCQPASACQLYHHL"
misc_feature 262..711
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/note="Staphylococcal nuclease homologues; Region: SNc;
smart00318"
/db_xref="CDD:214615"
misc_feature order(301..303,355..357,373..375,382..384,520..525,
529..531)
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/note="Catalytic site; other site"
/db_xref="CDD:238102"
misc_feature 790..1197
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/note="Staphylococcal nuclease homologues; Region: SNc;
smart00318"
/db_xref="CDD:214615"
misc_feature order(829..831,874..876,892..894,901..903,1018..1023,
1027..1029)
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/note="Catalytic site; other site"
/db_xref="CDD:238102"
misc_feature 1261..1707
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/note="Staphylococcal nuclease homologues. SNase
homologues are found in bacteria, archaea, and eukaryotes.
They contain no disufide bonds; Region: SNc; cd00175"
/db_xref="CDD:238102"
misc_feature order(1273..1275,1315..1317,1333..1335,1342..1344,
1522..1527,1531..1533)
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/note="Catalytic site; other site"
/db_xref="CDD:238102"
exon 289..438
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 439..559
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 560..641
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 642..802
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 803..894
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 895..1053
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 1054..1160
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 1161..1251
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 1252..1356
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 1357..1458
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 1459..1562
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 1563..1673
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 1674..1746
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
exon 1747..2340
/gene="snd1"
/gene_synonym="SN4TDR; TDRD11; wu:fc27g10"
/inference="alignment:Splign:2.1.0"
ORIGIN
gcgcgggtgacgctctgaccgaggaagtgcaacatttcgacgtgtacattcacgcgctgtgcttccggttaagcaaagcgtgatcagtcgtgctcagtctctcttcccttcctcggctctcagtagagacgtctcgtaggactctcccggctcctttacctctctctctcttttccctccctaacggaatactcattcatcccagcggccatggcatctgcggtaccggcacaagttcagtccagccaagcgtcagccccgcagctgcagaggggaatagtgaagatggtgttatcgggttgtgctatcattgttcgaggtcagccacgaggtggacctcctccagaacgacagatcaacctgagtaacataagagccggagctctagcccgtcgtgcaattcagggtcagccagacaccaaggacacaccagatgagccatgggctttccaggcacgagagtttatgcgcaagaaggtaatcggcaaagaagtctgcttcactgtggagaataaaactcctcaaggcagagaatatggcatggtttacctgggaaaagacacatcaggagaaaatattgccgaatccctggtggctgagggtcttgctatggttcgcagagaaggcatcagaggaaacaatcctgagcaggtcagactgtgtgatttggaggatcaagccaagtcttctaaaaagggcctgtggtctgagggtggaggctcgcacaccattcgagatctcaagtacaccatcgagaaccctcgcaacttcgtggactccctgcatcagaaaccagtcaacgctattatcgagcatgtgcgcgatggctgcatggttcgagcactacttctgcccgactactatctggtgacagtcatgctgtctggaatcaagagccctacgtttaagcgggaggcagatggcagcgagacccctgagcccttcgcagcagaggcaaagttcttcaccgagtctcgacttcttcagcgagatgtgcagatcattttggagtcctgtccaaaccaggtcattctgggaaccatcttgcatccgaacggaaacatcacggagctgctgctgaaggagggctttgctcgctgtgttgactggtccatggctgtttacactcagggtgcagagaagctcagagcagcagagcgatcagcaaaagagcgtaaagtgagaatttggaaggactatgttgctcccacagccaatctggaccagaaggacagacagtttgttgcaaaggtgatgcaggtcgtgaacgcagatgccatcgtggtgaagctgaactctggggaatataagaccatccacctgtccagcatcagacccccgaggctcgaaggcgaggagaagaacaaggacaaggacaagcgtttccgtccactctatgacattccttacatgtttgaggcacgcgaattcttgaggaagaagctcattggcaagaaggttaatgtcacagttgattacatcagagctgccaccaatgccatggaaatgggcgtcccggctttcccagagcgcacctgtgctacagtcaccattggaggaataaacatcgccgaggcactggtcagcaaaggtcttgccacagtgatcagataccgccaagatgacgatcaaagatcttctcattacgacgagctcctggcagcagaggcgagggcgatcaagaatggcaaaggacttcacagcaagaaagaagtgcccattcatagagtggcggacatttcaggggagacacagaaggcgaaacagtttttcccattcctgcagagagcgggccgctcggaggctgtggtggagtacgtgttcagtggctccagactcaagctctacatgcccaaagagacgtgtctcatcaccttcttgctcgctggtaagtgtcagccggcctcggcctgtcaactataccaccatctgtgaccacataaccaccacaatgtggcagctgaccgctgttgcgccaccgctctaatgctttttgttcacttgggctagaaaatgaaaatccagtcatgttttcatccatatgctgttgtgtgttttctctttggttgaacaatagagaagtttaagctgctctcatcatatattgaaaatgagaatctctaaaaagcacaaaagtcctcactatattctatataacttgcgatataaataaaattctcttacatttcctgcgttgataaggttggagtttgcatgtacgaccaggaactagaacatatggctttactataagactaaaaaagtaagtgtacggcaggaccatatgtttgatgaggtgttatgaaaaggagcggaataaaacatgattatgcaacactg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]