GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-01 12:48:09, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       NM_001130608             794 bp    mRNA    linear   VRT 13-MAR-2023
DEFINITION  Danio rerio SIX homeobox 9 (six9), mRNA.
ACCESSION   NM_001130608 XM_684623
VERSION     NM_001130608.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 794)
  AUTHORS   Kubra K, Gaddu GK, Liongue C, Heidary S, Ward AC, Dhillon AS and
            Basheer F.
  TITLE     Phylogenetic and Expression Analysis of Fos Transcription Factors
            in Zebrafish
  JOURNAL   Int J Mol Sci 23 (17), 10098 (2022)
   PUBMED   36077499
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 794)
  AUTHORS   Seo HC, Curtiss J, Mlodzik M and Fjose A.
  TITLE     Six class homeobox genes in drosophila belong to three distinct
            families and are involved in head development
  JOURNAL   Mech Dev 83 (1-2), 127-139 (1999)
   PUBMED   10381573
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from BC163024.1.
            
            On May 28, 2009 this sequence version replaced XM_684623.3.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC163024.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2168447, SAMEA4476780
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..794
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="18"
                     /map="18"
     gene            1..794
                     /gene="six9"
                     /gene_synonym="si:dkey-149j18.3"
                     /note="SIX homeobox 9"
                     /db_xref="GeneID:30623"
                     /db_xref="ZFIN:ZDB-GENE-990621-11"
     exon            1..437
                     /gene="six9"
                     /gene_synonym="si:dkey-149j18.3"
                     /inference="alignment:Splign:2.1.0"
     CDS             30..737
                     /gene="six9"
                     /gene_synonym="si:dkey-149j18.3"
                     /note="sine oculis homeobox homolog 9"
                     /codon_start=1
                     /product="SIX homeobox 9"
                     /protein_id="NP_001124080.1"
                     /db_xref="GeneID:30623"
                     /db_xref="ZFIN:ZDB-GENE-990621-11"
                     /translation="
MAMGFSPEQVACVCEVLLQSGSMDRLSSFLCSLPSISTSSNMYMGFGQSQESVLKARAAVAFHHCRFTELYALLEGNVFSPRSHPLLQQLWLRAHYMEAELQRGRPLGAVGKYRIRRKFPLPRTIWDGEETSYCFKEKSRSVLREWYCRKPYPSPREKRDLAAATGLTATQVSNWFKNRRQRDRAATSRQGTSAGAFLSSDEEISPPGSPRTLFSCSQQLSAHPPPLRHLGPAHY"
     misc_feature    42..395
                     /gene="six9"
                     /gene_synonym="si:dkey-149j18.3"
                     /note="Transcriptional regulator, SIX1, N-terminal SD
                     domain; Region: SIX1_SD; pfam16878"
                     /db_xref="CDD:465293"
     misc_feature    426..581
                     /gene="six9"
                     /gene_synonym="si:dkey-149j18.3"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(429..431,549..551,558..563,570..572)
                     /gene="six9"
                     /gene_synonym="si:dkey-149j18.3"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            438..601
                     /gene="six9"
                     /gene_synonym="si:dkey-149j18.3"
                     /inference="alignment:Splign:2.1.0"
     exon            602..794
                     /gene="six9"
                     /gene_synonym="si:dkey-149j18.3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
tgggacctttcaggatctttggtccagagatggcgatgggcttctcacctgagcaggtggcgtgtgtttgtgaggttcttctccaaagtggaagcatggatcgcttgtcttcattcttatgctctttaccttcaatctccacatcatccaacatgtatatgggttttggccagagtcaggagagtgtgttgaaagcacgtgctgcggtcgccttccaccactgccgttttacagagctgtatgccttgttagagggtaacgtgttttccccgcgcagtcaccctctcctccagcagctgtggctccgggctcactacatggaggctgaactgcagcggggccgccctcttggggctgtgggaaagtatcgcatacgccgaaagttccctcttcctcgcaccatctgggatggagaggagaccagctactgcttcaaggaaaagtctcgaagtgtgctgagagagtggtactgcagaaagccgtatccctcgccgcgagaaaaacgagatttggctgcagccaccggactgacagctacacaagtcagtaactggttcaagaaccgccgccagcgggacagagctgcgaccagccgccaaggaacttcagcaggagcgttcttgagttcagatgaggagatctctcctccaggaagccccagaacactgttctcctgctcccagcagctctctgcccacccacctcctctccgccatctgggacctgcacactactgagtgcactggaacacaggtcaaacaacagcaatctaatgtgctgcaagcatgtttgtg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]