GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-02 04:16:53, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XM_026837967            1573 bp    mRNA    linear   INV 22-OCT-2018
DEFINITION  PREDICTED: Ciona intestinalis Myc-induced nuclear antigen with a
            molecular mass of 53 kDa-like 1 (mina53-like1), transcript variant
            X2, mRNA.
ACCESSION   XM_026837967
VERSION     XM_026837967.1
DBLINK      BioProject: PRJNA187185
KEYWORDS    RefSeq.
SOURCE      Ciona intestinalis (vase tunicate)
  ORGANISM  Ciona intestinalis
            Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia;
            Cionidae; Ciona.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004190363.2) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Ciona intestinalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1573
                     /organism="Ciona intestinalis"
                     /mol_type="mRNA"
                     /db_xref="taxon:7719"
                     /chromosome="Unknown"
     gene            1..1573
                     /gene="mina53-like1"
                     /note="Myc-induced nuclear antigen with a molecular mass
                     of 53 kDa-like 1; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 48 ESTs, 1 Protein, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 39 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:494417"
     CDS             103..1440
                     /gene="mina53-like1"
                     /codon_start=1
                     /product="myc-induced nuclear antigen with a molecular
                     mass of 53 kDa-like 1 isoform X2"
                     /protein_id="XP_026693768.1"
                     /db_xref="GeneID:494417"
                     /translation="
MPARLKWTDEYMKENYGDLRVKLESKYEKDFKPEGDRGMGQDSMRRFLDTYIEHDKYMVSQLPDPLSEEVTVPQPILCGSFRERILEANIWMSSGNTKSLLHRDADNAFNCLLNGTKDWILIDPVHQDLLPVAVESGSPYGGYTLINVNKVDLIEFPEFKEVPWYYANVSAGDCLFLPKGHWHQVRSYGAKNLAVSILFSRLNDFNPKGCPKEGVPPSELLSEVPMVWTYDGFEAQTMGNADPFELKDELEMKCKHAEGKLTLEMFEEDMISGLDVEEEAYKGTLKVDADEYEIPDENIEIMKQRAKAIMDLIDPDNIGYYDCSQLEDMTVDTLKKISDIKDPDPANTDQYEFLHLHPNLVRKTILSSLELSKESFMEKYHSHEGSMAGAQWIFETLDSDNDGRCTVAEVKGNMEKVLERFQDSLLADVTAHQAKKINQNSKDEL"
     misc_feature    106..717
                     /gene="mina53-like1"
                     /note="Cupin-like domain; Region: Cupin_8; pfam13621"
                     /db_xref="CDD:463936"
     misc_feature    1000..1335
                     /gene="mina53-like1"
                     /note="Ca2+-binding protein, EF-hand superfamily [Signal
                     transduction mechanisms]; Region: FRQ1; COG5126"
                     /db_xref="CDD:444056"
ORIGIN      
attgttcatatacgaacggctgaagttcccaccccacaaaagttctgggaggattattgtagtttgggcaaaccagtcttgttgaagggaattgcattggatatgcctgcaaggctgaaatggacagatgaatacatgaaagaaaactatggggatttgagggtgaaacttgaaagcaaatatgaaaaagacttcaaacctgagggtgaccgtggtatgggtcaagactccatgcgacgattccttgacacctatattgagcatgacaagtacatggtgtcacagttacctgacccactctcagaagaagtaacagtcccccaaccaatcttatgtggttcattccgggaaagaattctggaagcaaatatttggatgagttcaggaaacacaaagagtttgttgcacagagatgcagacaatgcattcaattgtcttttgaacggaacaaaagattggattctgattgaccctgtgcatcaggaccttctgcctgttgctgtagaaagtggttcaccatatggcgggtacacactaatcaatgtgaacaaagttgatttgatagaatttccggaattcaaagaagtaccgtggtattacgcgaatgtatctgcaggagattgtctgtttcttcctaaaggacattggcaccaggttcgatcctacggagcgaaaaacttggctgtgagcatcttgttttcgcgcttgaatgattttaatcccaaaggctgccccaaggagggagttcctccttcagagttgttaagtgaggtaccgatggtgtggacatacgacgggtttgaggctcaaactatgggaaatgcagatccatttgagttaaaagatgagcttgagatgaagtgcaaacatgcagaggggaaactaacacttgagatgttcgaggaagacatgatatctgggttggatgtggaggaagaagcttacaaaggaacactcaaggtggatgcagatgaatacgagattcctgatgaaaatatcgagattatgaagcaaagagctaaagcgatcatggacctcattgatcctgataatattggatattatgattgtagtcaacttgaggatatgacagtagacacactgaagaaaatatcggatataaaagatcccgatcctgctaataccgatcaatatgaattcttacatcttcatcccaatcttgttaggaaaactattctgagttctcttgaattatcgaaagaaagtttcatggagaaatatcattcacacgagggttcgatggccggggctcaatggatctttgagactttggattcggacaatgacggtcgatgcacagtggctgaagtaaagggaaatatggagaaggttttggaaagattccaagacagtttgcttgcagatgttacagcccaccaagctaagaagatcaatcaaaattccaaggatgaattatgatcacgttatatttgatgccataagagatttgccacgatgagattattttatttgtaaaatccacttttgatcgtctgttcaatcggtatcttgtgcaatttgtacaataataaaagaaaaagaaatagtttta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]