2024-07-02 03:30:44, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS XM_009861931 1488 bp mRNA linear INV 22-OCT-2018 DEFINITION PREDICTED: Ciona intestinalis homeobox protein unc-4 homolog (LOC778790), partial mRNA. ACCESSION XM_009861931 VERSION XM_009861931.3 DBLINK BioProject: PRJNA187185 KEYWORDS RefSeq; corrected model. SOURCE Ciona intestinalis (vase tunicate) ORGANISM Ciona intestinalis Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia; Cionidae; Ciona. REFERENCE 1 AUTHORS Imai,K.S., Hino,K., Yagi,K., Satoh,N. and Satou,Y. TITLE Gene expression profiles of transcription factors and signaling molecules in the ascidian embryo: towards a comprehensive understanding of gene networks JOURNAL Development 131 (16), 4047-4058 (2004) PUBMED 15269171 REFERENCE 2 AUTHORS Satou,Y. and Satoh,N. TITLE Genomewide surveys of developmentally relevant genes in Ciona intestinalis JOURNAL Dev. Genes Evol. 213 (5-6), 211-212 (2003) PUBMED 12736827 COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_020176.2) and transcript sequence (AB210740.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Oct 22, 2018 this sequence version replaced XM_009861931.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Ciona intestinalis Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## assembly gap :: added 216 transcript bases to patch genome assembly gap ##RefSeq-Attributes-END## COMPLETENESS: incomplete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1114 EAAA01000755.1 21338-22451 1115-1272 EAAA01000755.1 25018-25175 1273-1488 AB210740.1 600-815 FEATURES Location/Qualifiers source 1..1488 /organism="Ciona intestinalis" /mol_type="mRNA" /db_xref="taxon:7719" /chromosome="11" gene 1..>1488 /gene="LOC778790" /note="The sequence of the model RefSeq transcript was modified relative to its source genomic sequence to represent the inferred CDS: added 216 bases not found in genome assembly; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 29 samples with support for all annotated introns" /db_xref="GeneID:778790" CDS 805..>1488 /gene="LOC778790" /note="The sequence of the model RefSeq protein was modified relative to its source genomic sequence to represent the inferred CDS: added 216 bases not found in genome assembly" /codon_start=1 /product="homeobox protein unc-4 homolog" /protein_id="XP_009860233.1" /db_xref="GeneID:778790" /translation="
MYAPQPLVPSSMMTYPPPLYHRPSARFSLSPSAGNGGSGCPKNYYQHHVTNHAAAAAAAMYAGGAYDGFLQNYVPTDPCKQALMMASQAAGFTGMGNDYNACLDDSKPTKQRRARANYSQWQLEELERAFHTTHYPDIFMREALALRLDLIEARIQVWFQNRRAKLRRQLKMQNKTNKNDAEKNKDENSDESKSENSSVTEDVCKKGEAPVFDDVNGQGETKQDKKKR"
misc_feature 1138..1308 /gene="LOC778790" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" ORIGIN
ttatgtgcttaaggtgtcccgtcttacctcaccctacaatatataaacatggattgtaacagaaacttataaatcttacattttattaactgggcaaaaaacacagatttttttgaacagttttaacaccatcattacagtttctatatatataataaaacgatcgtcttcatgttaaacgttacgcatattttacattttaaatacgaaagatggttttagtttttacacctaacgaaataaataaaatatcaaatatatgtttgtgttgaaaactgttgcgttatttggaaattttaaagtgtaacttcacctgtgttcgactggatcagatttttgaaactttttctttttcttcgtcagcactcgtactcgttcttgccaactgtagcagacgcgtctggaagaggaaagccaccttcgggcagactggatgaagccgtaagcttcaagaccactaatctgatggaaagaataacatattggttaaaatttggagcaaattttagattaagtaaacatgcagtgaaatgcatatacagtcaggctgcatcagggatgttaaagacattacgaactgtatcagttattaacgtttttatttaccgttttattcaaactatttaccgttttttagcaaaaatttacaaacttattctgtttttaggttcaggaattctcatagccataatttctctttgcaaaaaaaaaatcggaatcgccattttgtaaaacgagccaagagcttatcactcactgtactggtagcgcgaagaaactcaacaacggacaatatacctcgcaatgtacgcaccccaacccttggtcccatcttcaatgatgacctacccgccaccattgtaccacagaccctcagcccggttctcactttcgccttccgcgggaaacggaggctccggatgcccgaagaattactaccaacaccacgttacgaaccatgccgctgccgccgccgctgctatgtacgctggaggtgcatatgacgggtttctgcagaattatgtcccaactgatccttgcaaacaagcgctaatgatggcatcacaagcagcagggttcactggaatgggaaacgactacaatgcttgtttagacgacagtaagcccaccaagcagcgcagagcacgtgccaactacagccaatggcagctcgaggaattggagcgagcgttccatacaacacactaccccgatattttcatgcgagaagctctggctctaagactcgatcttatagaggctcgaatacaggtttggtttcaaaacagaagagccaagctccggcgtcagttaaaaatgcaaaacaagacgaacaaaaatgacgcagagaagaacaaagatgaaaactcagatgagagcaaaagcgagaactcctccgttacagaggatgtttgcaagaaaggggaagccccggtttttgatgacgtcaacggccagggagagacgaagcaggataagaaaaaaagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]