GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-20 05:25:00, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_004226774             776 bp    mRNA    linear   INV 22-OCT-2018
DEFINITION  PREDICTED: Ciona intestinalis 40S ribosomal protein S5
            (LOC100186730), transcript variant X1, mRNA.
ACCESSION   XM_004226774
VERSION     XM_004226774.3
DBLINK      BioProject: PRJNA187185
KEYWORDS    RefSeq.
SOURCE      Ciona intestinalis (vase tunicate)
  ORGANISM  Ciona intestinalis
            Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia;
            Cionidae; Ciona.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_020178.2) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 22, 2018 this sequence version replaced XM_004226774.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Ciona intestinalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..776
                     /organism="Ciona intestinalis"
                     /mol_type="mRNA"
                     /db_xref="taxon:7719"
                     /chromosome="13"
     gene            1..776
                     /gene="LOC100186730"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 1277 ESTs, 35 Proteins,
                     and 100% coverage of the annotated genomic feature by
                     RNAseq alignments, including 227 samples with support for
                     all annotated introns"
                     /db_xref="GeneID:100186730"
     CDS             124..738
                     /gene="LOC100186730"
                     /codon_start=1
                     /product="40S ribosomal protein S5"
                     /protein_id="XP_004226822.1"
                     /db_xref="GeneID:100186730"
                     /translation="
MEEDYEADVIVAEAPEVKLFGRWTTSDVQINDISLTDYLPVKDKYSKYLPHSSGRYQIKRFRKAQCPIVERLVNSMMMHGRNTGKKLLTVRIIKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQSVDVSPLRRVNQAIWLLCTGAREASFRNIKTIAECLADELINAHKGSSNSYAIKKKDELERVAKSNR"
     misc_feature    175..735
                     /gene="LOC100186730"
                     /note="Eukaryota homolog of Ribosomal Protein S7; Region:
                     uS7_Eukaryote; cd14867"
                     /db_xref="CDD:271246"
     misc_feature    order(175..177,262..270,274..285,382..384,394..396)
                     /gene="LOC100186730"
                     /note="S9 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(274..276,280..282,292..303,310..312,334..336,
                     343..345,349..363,373..387,394..396,514..522,526..528,
                     556..558,577..579,598..600,607..609,625..630)
                     /gene="LOC100186730"
                     /note="rRNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(406..408,415..420,427..429,625..627,631..636)
                     /gene="LOC100186730"
                     /note="S25 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(511..513,520..522,526..528,733..735)
                     /gene="LOC100186730"
                     /note="S11 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
ORIGIN      
tttatttaaccatactactcccctatgagatttaccatttagcgccggcagtggtggaaaatcgcgtgtagtttctcttttttaagtcgtcatttcccttttcagaaaagtcgccacgaaaatatggaggaagactacgaagcagacgttatcgtagctgaagcacccgaggtgaaattgttcggacgatggacaacaagtgatgttcagatcaatgacatctcactcacggactacttacccgtgaaggacaaatactccaagtatcttcctcacagctccggtcgttaccagatcaaacgcttccgtaaagcacaatgtcccattgtggagcgcttggttaactccatgatgatgcatggacgaaacactggcaagaaactgctgactgttcgaatcatcaaacatgcgtttgagatcatccatcttttgactggtgaaaatccacttcaagttttggtgaatgctattatcaacagtggtccacgtgaagattccactcgtattggtcgtgcgggtacagtaagaagacagtctgtggacgtatcaccattacgtcgagtcaaccaagctatctggttattgtgcaccggtgcacgcgaggcttctttccgtaacattaagacgattgctgagtgtttggctgatgaactcattaacgctcataagggctcatctaactcgtatgccatcaagaagaaggatgaacttgagagagtcgcaaaatccaaccgttaaaatgcatcggcaataatggaaataaaatctcaaaccaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]