2025-09-18 09:53:09, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_001383707 3105 bp mRNA linear INV 16-MAY-2025 DEFINITION Caenorhabditis elegans Protein argonaute-2 (alg-5), mRNA. ACCESSION NM_001383707 VERSION NM_001383707.1 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 3105) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 3105) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (16-MAY-2025) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 3105) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (01-MAY-2025) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 3105) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003279). FEATURES Location/Qualifiers source 1..3105 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="I" gene 1..3105 /gene="alg-5" /locus_tag="CELE_T23D8.7" /db_xref="GeneID:172861" /db_xref="WormBase:WBGene00011945" CDS 3..2720 /gene="alg-5" /locus_tag="CELE_T23D8.7" /standard_name="T23D8.7" /note="Confirmed by transcript evidence" /codon_start=1 /product="Protein argonaute-2" /protein_id="NP_001370006.1" /db_xref="GeneID:172861" /db_xref="WormBase:WBGene00011945" /translation="
MEDQWLLSAIYDDDLVEKLKVRSSTSSRSTSINVPSLENEFLSSSSGSRVSDDLYLHPIEENREPFKLIGKPLPSTTGRFLSLLANHFQITCNGSIIHQYYIRFDPDIPSKKLNRTILRTLQEQNPGLIECPLVFDGIHTVYSTELINVKEVNNSVINVAGVVNTKESPNLFKLYLTHVDSFLLDTKIITGNQDQNQKLRMMHAIDTVFRQTSTGNFHAVLQSFFSIAQNSAIEPSHGLGWGTVNLGVGREVCYGFYQNVVETFDTLTMNLDVATTTFYRPVALVEFLAEILEVPLATVTDGRSLSDVQKKKFNREVAGLKVETRHCSCPRRFRVARCTWKPTENISFHLSETAGNQDSKPLSLVEYYKRRYNIDLTYKHLPCIEVGRTRECILPLELCYVVSGQRCIKKLNEQQIANLIRATSRNATERQNAVMSLQNRLKMDNDVNAVKFGLKVEAQLLKIEGRVLPVPRLLYRSPNLKRQECVTVPNNGTWDMRGKNFYSGIQIREWAIVCFASPEIIGEASMRSFVRNLVNVASEIGMPFLEEHRFCRYAEPDQTVKLLEHLNEQYNLQLVLCIVPGKSVVYGELKRKGELLGLTTQCVRSQNVSKASPHTLSNLCMKINSKLGGINVILSSPPQSLNSEPVLFIGCHLTRSSLASSSDSTSSIAHCDSSIACLVGSMDGHPTQFSPIFRTQPRHQRTIVDMCEMTREAIINFRKSTGFKPHKIIIYRAGIADVTVDEIMQTELRAVRDACAMIEYGFQPGITFIGLDVTHHTRLFAANEKDRVGNSQNVPAGTLVETGITVNNLFEFYLVSHAGIQGTSRPTKYVVMWDDNSIPSADIHEMTYQLCHTQSRCTRSVSIPSPVYYAKLVAQRAKILMADENFDMERFRLCGIGRNDGMSFT"
misc_feature 657..842 /gene="alg-5" /locus_tag="CELE_T23D8.7" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 930..1262 /gene="alg-5" /locus_tag="CELE_T23D8.7" /note="PAZ domain; Region: PAZ; pfam02170" /db_xref="CDD:460472" misc_feature 1344..2645 /gene="alg-5" /locus_tag="CELE_T23D8.7" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1758..1760,1770..1772,1803..1814,1821..1823, 1845..1847,1854..1856,1866..1868,1878..1880) /gene="alg-5" /locus_tag="CELE_T23D8.7" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1956..1958,1962..1964,2199..2201,2613..2615) /gene="alg-5" /locus_tag="CELE_T23D8.7" /note="active site" /db_xref="CDD:240015" ORIGIN
gtatggaagaccaatggttgctgtcggcaatttatgatgatgatttggtcgaaaagttaaaagtgaggagttccacttcatcaagaagtacttcgatcaacgtgcccagtttggaaaatgagtttctcagcagttcttctggatccagagtttccgatgatctctacctgcatcctattgaagaaaacagagagccattcaaattgataggaaagccacttcccagcactacaggacgattcttatcacttctcgccaatcattttcaaatcacgtgcaatggatcgattattcatcaatactatattcgattcgatccagatattccgtcgaaaaagctgaacagaacgattttgagaactctgcaagaacagaatcccggacttatcgagtgcccgttagttttcgatggaattcacactgtgtactcaacagagctgattaatgtcaaggaagtgaataattcagtcatcaatgttgcaggagttgttaatacaaaagaatcacctaatctattcaaactctatctaacacatgtcgacagcttcctcttggatactaaaattatcacaggaaatcaggatcagaaccagaagttgcgaatgatgcatgcaattgatactgtcttccgtcaaacttctactggaaatttccatgccgtgcttcaatctttcttctcaattgcacaaaattctgcaatcgaaccctcgcatggccttggatggggaactgtcaatttaggagttggacgagaagtttgctacggtttttatcaaaatgttgttgagacattcgatacactcactatgaatctcgacgttgcaacaactacattctaccgccccgtggctctcgtggaattccttgctgaaattctggaagttccactggcaacagtcaccgacggacgttcgctgagcgatgttcaaaagaaaaagttcaaccgtgaagtggccggactcaaagttgaaaccagacactgtagttgtccacgaagatttcgtgtcgcccgttgcacttggaaaccaactgaaaatattagtttccatctctccgagactgccggcaatcaagattctaaacctctctcattggttgaatactataaaaggcgttataatatcgatctgacatataagcatcttccgtgtattgaagttggacgcactcgagaatgtattcttcctttggagctttgttacgtagtcagtggccaacgatgtatcaagaaactgaatgaacaacagattgcaaatctgatcagagcaacgagccgaaatgcaactgaacgacaaaatgcagtcatgagccttcagaatcggctgaaaatggataatgatgtcaatgcggttaaatttggattaaaagttgaagctcaattgttgaagattgaaggacgtgtcttgccggttccgcgtcttctctatcgttccccaaatttgaagagacaagagtgtgtaacagttccgaataatggaacatgggatatgagaggaaagaatttttacagcggaatccagattcgagaatgggcaattgtttgtttcgcaagcccagagattatcggagaagccagcatgcgttcatttgtcagaaatctcgtcaatgttgcctctgaaattggaatgccttttctcgaagaacaccgattctgcagatacgcagaaccagaccagactgtgaagcttctcgaacatttgaatgaacaatacaatcttcaactcgttttatgcattgtccccggaaaatctgtagtttatggagaattgaaacgaaaaggagagctacttggtttgacaactcaatgtgttcgatctcaaaatgtttcgaaagcgtcaccacacactctttctaatctctgtatgaaaatcaactcgaaactcggaggcattaatgtaatcctatcctctcctccacaatctctaaattctgaaccagtactttttatcggatgtcatttaactcgaagttcactcgcctcatcttctgattccacatcttctatagctcattgtgattcctccatcgcttgtctcgtcggttcaatggatggacatcctactcagttttctccaatctttcgtactcaaccacgtcatcaaagaactattgtcgatatgtgtgaaatgacacgtgaagctattatcaatttccgaaagtctacaggatttaaaccccacaaaattatcatttatcgtgctggaatcgcagatgtgactgtcgatgaaatcatgcaaacggaattacgtgctgtacgggatgcatgtgctatgatcgaatacggtttccagccaggaatcacttttattgggttagatgtcactcatcatacgagactttttgcagctaatgaaaaagatcgcgtcggaaatagtcaaaatgtgccagctggaactctcgtggaaacaggaatcactgtgaataatctcttcgagttctacctcgtatcacatgcaggaattcaaggaacttctcgcccgacgaagtatgttgtcatgtgggacgataattcaataccatctgccgatattcatgagatgacctatcagctatgtcacactcaatccagatgcacaagaagcgtctccattccttcgccagtatactatgcaaaattagtagctcaacgagcaaaaatattgatggctgatgagaattttgatatggaacgattccgtttgtgtggaattggtcggaacgatggaatgtcattcacctaattctacgtcatttacatttcaacttactcgtcatttacatcatactcacccgaaatgcgggtcttttaaaaagtcatttatctatttattttctcatttttcacactagtttacagatattcaatatcccatttttctaatagtcaatccacgatgtcgttcttattgttatattttgttgttacagtccaccttttcatagatcttgttctcaattatacggttccggacaaatacttgttactttttgttgttgtcatacatttttgttacaattttccattttttgttgttttctattttcgtgccaatatttgtgagtttttattttgcgtgctaagcagcgtttctcagaataattatgataaagaataaggaacgggca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]