ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-23 10:35:05, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001383707 3105 bp mRNA linear INV 01-DEC-2025
DEFINITION Caenorhabditis elegans Protein argonaute-2 (alg-5), mRNA.
ACCESSION NM_001383707
VERSION NM_001383707.1
DBLINK BioProject: PRJNA158
KEYWORDS RefSeq.
SOURCE Caenorhabditis elegans
ORGANISM Caenorhabditis elegans
Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
Caenorhabditis.
REFERENCE 1 (bases 1 to 3105)
AUTHORS Sulson,J.E. and Waterston,R.
CONSRTM Caenorhabditis elegans Sequencing Consortium
TITLE Genome sequence of the nematode C. elegans: a platform for
investigating biology
JOURNAL Science 282 (5396), 2012-2018 (1998)
PUBMED 9851916
REMARK Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE 2 (bases 1 to 3105)
CONSRTM NCBI Genome Project
TITLE Direct Submission
JOURNAL Submitted (01-DEC-2025) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
REFERENCE 3 (bases 1 to 3105)
AUTHORS WormBase.
CONSRTM WormBase Consortium
TITLE Direct Submission
JOURNAL Submitted (10-OCT-2025) WormBase Group, European Bioinformatics
Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE 4 (bases 1 to 3105)
AUTHORS Sulson,J.E. and Waterston,R.
TITLE Direct Submission
JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
at Washington University, St. Louis, MO 63110, USA
COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This
record is derived from an annotated genomic sequence (NC_003279).
FEATURES Location/Qualifiers
source 1..3105
/organism="Caenorhabditis elegans"
/mol_type="mRNA"
/strain="Bristol N2"
/db_xref="taxon:6239"
/chromosome="I"
gene 1..3105
/gene="alg-5"
/locus_tag="CELE_T23D8.7"
/db_xref="GeneID:172861"
/db_xref="WormBase:WBGene00011945"
CDS 3..2720
/gene="alg-5"
/locus_tag="CELE_T23D8.7"
/standard_name="T23D8.7"
/note="Confirmed by transcript evidence"
/codon_start=1
/product="Protein argonaute-2"
/protein_id="NP_001370006.1"
/db_xref="GeneID:172861"
/db_xref="WormBase:WBGene00011945"
/translation="
MEDQWLLSAIYDDDLVEKLKVRSSTSSRSTSINVPSLENEFLSSSSGSRVSDDLYLHPIEENREPFKLIGKPLPSTTGRFLSLLANHFQITCNGSIIHQYYIRFDPDIPSKKLNRTILRTLQEQNPGLIECPLVFDGIHTVYSTELINVKEVNNSVINVAGVVNTKESPNLFKLYLTHVDSFLLDTKIITGNQDQNQKLRMMHAIDTVFRQTSTGNFHAVLQSFFSIAQNSAIEPSHGLGWGTVNLGVGREVCYGFYQNVVETFDTLTMNLDVATTTFYRPVALVEFLAEILEVPLATVTDGRSLSDVQKKKFNREVAGLKVETRHCSCPRRFRVARCTWKPTENISFHLSETAGNQDSKPLSLVEYYKRRYNIDLTYKHLPCIEVGRTRECILPLELCYVVSGQRCIKKLNEQQIANLIRATSRNATERQNAVMSLQNRLKMDNDVNAVKFGLKVEAQLLKIEGRVLPVPRLLYRSPNLKRQECVTVPNNGTWDMRGKNFYSGIQIREWAIVCFASPEIIGEASMRSFVRNLVNVASEIGMPFLEEHRFCRYAEPDQTVKLLEHLNEQYNLQLVLCIVPGKSVVYGELKRKGELLGLTTQCVRSQNVSKASPHTLSNLCMKINSKLGGINVILSSPPQSLNSEPVLFIGCHLTRSSLASSSDSTSSIAHCDSSIACLVGSMDGHPTQFSPIFRTQPRHQRTIVDMCEMTREAIINFRKSTGFKPHKIIIYRAGIADVTVDEIMQTELRAVRDACAMIEYGFQPGITFIGLDVTHHTRLFAANEKDRVGNSQNVPAGTLVETGITVNNLFEFYLVSHAGIQGTSRPTKYVVMWDDNSIPSADIHEMTYQLCHTQSRCTRSVSIPSPVYYAKLVAQRAKILMADENFDMERFRLCGIGRNDGMSFT"
misc_feature 657..842
/gene="alg-5"
/locus_tag="CELE_T23D8.7"
/note="Argonaute linker 1 domain; Region: ArgoL1;
pfam08699"
/db_xref="CDD:462567"
misc_feature 930..1262
/gene="alg-5"
/locus_tag="CELE_T23D8.7"
/note="PAZ domain; Region: PAZ; pfam02170"
/db_xref="CDD:460472"
misc_feature 1344..2645
/gene="alg-5"
/locus_tag="CELE_T23D8.7"
/note="PIWI domain, Argonaute-like subfamily. Argonaute is
the central component of the RNA-induced silencing complex
(RISC) and related complexes. The PIWI domain is the
C-terminal portion of Argonaute and consists of two
subdomains, one of which provides the...; Region:
Piwi_ago-like; cd04657"
/db_xref="CDD:240015"
misc_feature order(1758..1760,1770..1772,1803..1814,1821..1823,
1845..1847,1854..1856,1866..1868,1878..1880)
/gene="alg-5"
/locus_tag="CELE_T23D8.7"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:240015"
misc_feature order(1956..1958,1962..1964,2199..2201,2613..2615)
/gene="alg-5"
/locus_tag="CELE_T23D8.7"
/note="active site"
/db_xref="CDD:240015"
ORIGIN
gtatggaagaccaatggttgctgtcggcaatttatgatgatgatttggtcgaaaagttaaaagtgaggagttccacttcatcaagaagtacttcgatcaacgtgcccagtttggaaaatgagtttctcagcagttcttctggatccagagtttccgatgatctctacctgcatcctattgaagaaaacagagagccattcaaattgataggaaagccacttcccagcactacaggacgattcttatcacttctcgccaatcattttcaaatcacgtgcaatggatcgattattcatcaatactatattcgattcgatccagatattccgtcgaaaaagctgaacagaacgattttgagaactctgcaagaacagaatcccggacttatcgagtgcccgttagttttcgatggaattcacactgtgtactcaacagagctgattaatgtcaaggaagtgaataattcagtcatcaatgttgcaggagttgttaatacaaaagaatcacctaatctattcaaactctatctaacacatgtcgacagcttcctcttggatactaaaattatcacaggaaatcaggatcagaaccagaagttgcgaatgatgcatgcaattgatactgtcttccgtcaaacttctactggaaatttccatgccgtgcttcaatctttcttctcaattgcacaaaattctgcaatcgaaccctcgcatggccttggatggggaactgtcaatttaggagttggacgagaagtttgctacggtttttatcaaaatgttgttgagacattcgatacactcactatgaatctcgacgttgcaacaactacattctaccgccccgtggctctcgtggaattccttgctgaaattctggaagttccactggcaacagtcaccgacggacgttcgctgagcgatgttcaaaagaaaaagttcaaccgtgaagtggccggactcaaagttgaaaccagacactgtagttgtccacgaagatttcgtgtcgcccgttgcacttggaaaccaactgaaaatattagtttccatctctccgagactgccggcaatcaagattctaaacctctctcattggttgaatactataaaaggcgttataatatcgatctgacatataagcatcttccgtgtattgaagttggacgcactcgagaatgtattcttcctttggagctttgttacgtagtcagtggccaacgatgtatcaagaaactgaatgaacaacagattgcaaatctgatcagagcaacgagccgaaatgcaactgaacgacaaaatgcagtcatgagccttcagaatcggctgaaaatggataatgatgtcaatgcggttaaatttggattaaaagttgaagctcaattgttgaagattgaaggacgtgtcttgccggttccgcgtcttctctatcgttccccaaatttgaagagacaagagtgtgtaacagttccgaataatggaacatgggatatgagaggaaagaatttttacagcggaatccagattcgagaatgggcaattgtttgtttcgcaagcccagagattatcggagaagccagcatgcgttcatttgtcagaaatctcgtcaatgttgcctctgaaattggaatgccttttctcgaagaacaccgattctgcagatacgcagaaccagaccagactgtgaagcttctcgaacatttgaatgaacaatacaatcttcaactcgttttatgcattgtccccggaaaatctgtagtttatggagaattgaaacgaaaaggagagctacttggtttgacaactcaatgtgttcgatctcaaaatgtttcgaaagcgtcaccacacactctttctaatctctgtatgaaaatcaactcgaaactcggaggcattaatgtaatcctatcctctcctccacaatctctaaattctgaaccagtactttttatcggatgtcatttaactcgaagttcactcgcctcatcttctgattccacatcttctatagctcattgtgattcctccatcgcttgtctcgtcggttcaatggatggacatcctactcagttttctccaatctttcgtactcaaccacgtcatcaaagaactattgtcgatatgtgtgaaatgacacgtgaagctattatcaatttccgaaagtctacaggatttaaaccccacaaaattatcatttatcgtgctggaatcgcagatgtgactgtcgatgaaatcatgcaaacggaattacgtgctgtacgggatgcatgtgctatgatcgaatacggtttccagccaggaatcacttttattgggttagatgtcactcatcatacgagactttttgcagctaatgaaaaagatcgcgtcggaaatagtcaaaatgtgccagctggaactctcgtggaaacaggaatcactgtgaataatctcttcgagttctacctcgtatcacatgcaggaattcaaggaacttctcgcccgacgaagtatgttgtcatgtgggacgataattcaataccatctgccgatattcatgagatgacctatcagctatgtcacactcaatccagatgcacaagaagcgtctccattccttcgccagtatactatgcaaaattagtagctcaacgagcaaaaatattgatggctgatgagaattttgatatggaacgattccgtttgtgtggaattggtcggaacgatggaatgtcattcacctaattctacgtcatttacatttcaacttactcgtcatttacatcatactcacccgaaatgcgggtcttttaaaaagtcatttatctatttattttctcatttttcacactagtttacagatattcaatatcccatttttctaatagtcaatccacgatgtcgttcttattgttatattttgttgttacagtccaccttttcatagatcttgttctcaattatacggttccggacaaatacttgttactttttgttgttgtcatacatttttgttacaattttccattttttgttgttttctattttcgtgccaatatttgtgagtttttattttgcgtgctaagcagcgtttctcagaataattatgataaagaataaggaacgggca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]