2024-09-28 11:21:34, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_001026808 1305 bp mRNA linear INV 11-JUN-2024 DEFINITION Caenorhabditis elegans Serine palmitoyltransferase 1 (sptl-1), partial mRNA. ACCESSION NM_001026808 VERSION NM_001026808.4 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 1305) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 1305) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (11-JUN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1305) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (23-MAY-2024) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 1305) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003280). On Apr 15, 2020 this sequence version replaced NM_001026808.3. COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1305 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="II" gene <1..>1305 /gene="sptl-1" /locus_tag="CELE_C23H3.4" /db_xref="GeneID:173389" CDS 1..1305 /gene="sptl-1" /locus_tag="CELE_C23H3.4" /standard_name="C23H3.4b" /note="Confirmed by transcript evidence" /codon_start=1 /product="Serine palmitoyltransferase 1" /protein_id="NP_001021979.1" /db_xref="GeneID:173389" /translation="
MRNRSKRQQEKLSKKLTERQKDELIADWTPEPLVPETPQDHPVLNPKYADGKMTKDVSIDGEKYLNMASTNFLSFIGVKRIEDRAKQTIFKYGVGSCGPRGFYGTVDVHLDLEKELAKFMGCEEAVLYSYGFATVSSAIPAYAKKGDVIFVDEGVNFAIQKGLQASRSRVEYFKHNDMEHLERLLLEQEQRDKKDPKKAKSVRRFIVVEGLYVNYADLCPLPKIIEFKWRFKVRVFIDESWSFGVIGKTGRGVTEHFNVPMEDVDMVMASLENALASTGGFCVGRSYVVGHQRLSGLGYCFSASLPPLLATAASEAISIIDEEPSRVQKVTEMAINGQKKLQDALSGSKFSLQGCPESPMKHIYYNGEDEEKQLDTFVETVFTKNHLLLTRARYLDKDELFKIRPSIRVMFQHDLTEEEIQRAVDAIRVVAHKF"
misc_feature 37..1293 /gene="sptl-1" /locus_tag="CELE_C23H3.4" /note="Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl18945" /db_xref="CDD:450240" misc_feature order(391..396,403..405,625..627,712..714,721..723, 808..810,817..819) /gene="sptl-1" /locus_tag="CELE_C23H3.4" /note="pyridoxal 5'-phosphate binding pocket [chemical binding]; other site" /db_xref="CDD:99747" misc_feature 817..819 /gene="sptl-1" /locus_tag="CELE_C23H3.4" /note="catalytic residue [active]" /db_xref="CDD:99747" ORIGIN
atgcggaacagatccaaacgtcaacaagaaaaactttcaaagaaactaactgaaaggcagaaagatgaattaattgctgattggactccggaaccattggttcctgaaacaccacaagaccatcctgtactgaatccaaaatatgctgatggaaaaatgacaaaggatgtttcgatcgatggcgaaaagtatctcaacatggcatcaacaaatttcctcagctttatcggagtcaaacggattgaagaccgtgcgaaacagacgattttcaagtacggcgtaggatcgtgcgggccacgtggattctacggaactgttgatgttcatttggaccttgaaaaagaattggcaaaatttatgggatgtgaggaggctgttctgtacagctatgggtttgctacagtatcttcagcaattcccgcatacgctaaaaagggagatgtcatctttgttgacgaaggtgttaactttgcaatccaaaaaggtcttcaagcatcacgaagtcgtgttgaatatttcaagcataacgacatggagcacttggagaggttattactggaacaagaacaaagagacaagaaagacccgaaaaaggccaagtctgtacggcgattcattgttgttgaaggcctctatgtaaattatgcggatctttgcccacttcccaagattatcgagttcaaatggcgattcaaagttcgtgttttcattgacgaaagctggtcatttggagtcattggaaaaaccggaagaggagtcaccgagcacttcaacgttccgatggaggacgttgatatggtaatggcctcactcgaaaacgcattggcgtcaactggaggattctgtgttggaagatcatatgtagttgggcatcagcggctttcaggactcggatattgcttttctgcttctcttccacctcttcttgcaacggccgcgtctgaagctatttctatcattgatgaagaaccaagtagagttcaaaaagttactgaaatggctataaatggtcagaaaaagctacaagatgcgctgagtggatcgaaattttcattgcaaggatgtccagaaagtccaatgaagcatatctattacaatggggaagatgaagaaaagcaattggatacatttgtggagacagtcttcacaaaaaatcatctcctactgaccagagctcgatacctcgacaaggacgaattgttcaaaattcggccaagcattcgagtaatgttccaacacgacttaactgaagaggagattcaaagagctgtcgatgctatccgagttgttgctcataaattctaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]