2024-09-28 11:20:15, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_001025818 22326 bp mRNA linear INV 11-JUN-2024 DEFINITION Caenorhabditis elegans Muscle M-line assembly protein unc-89 (unc-89), partial mRNA. ACCESSION NM_001025818 VERSION NM_001025818.3 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 22326) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 22326) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (11-JUN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 22326) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (23-MAY-2024) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 22326) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003279). On Apr 15, 2020 this sequence version replaced NM_001025818.2. COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..22326 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="I" gene <1..>22326 /gene="unc-89" /locus_tag="CELE_C09D1.1" /db_xref="GeneID:171990" CDS 1..22326 /gene="unc-89" /locus_tag="CELE_C09D1.1" /standard_name="C09D1.1f" /note="Confirmed by transcript evidence" /codon_start=1 /product="Muscle M-line assembly protein unc-89" /protein_id="NP_001020989.1" /db_xref="GeneID:171990" /translation="
MASRRQKQFDRKYSSYRKFTATEDVNYSTHSSRSSYRSESLTSRTDGRGRSTSSEIIAGSESRSYPVYIAIQDYTPDKEDVEAIPLEQGQIVEVLDKKNSVRWLVRTKARPPRSGWVPGSYFETPTEFYKQRRRTREIENVSLSDEQAALVKRDQVYHELLRSEEEFVSSLRTCVDDYIKVLDDPEVPEAVKKNREELTLNIPELYNFHANVMLKGLNYYSDDPGKVGQTFVRLEKDFESHVEFYKQYADTLKLLEEPEIKRFFEGLSAKNDAGASSFVDHVKEIADRMVQYQNYFKEFVKYSARAHGSSKSIQKALELVTTIPQRVHDLEFTNNLKQHPGDTGKLGRIIRHDAFQVWEGDEPPKLRYVFLFRNKIMFTEQDASTSPPSYTHYSSIRLDKYNIRQHTTDEDTIVLQPQEPGLPSFRIKPKDFETSEYVRKAWLRDIAEEQEKYAAERDAISMTATSEMTASSVDFDMNASDQQSEFSEWSGSRKSSLFPGPEEGGPPRKKVKSPPVISPTGSSTSIYSGGSSSIDWTTTGTTLEMQGTRVTRTQYGFRTLQESSAKMCLKVTGYPLPDITWYKDDVQLHEDERHTFYSDEDGFFAMTIDPVQVTDTGRYTCMATNEYGQASTSAFFRVLKVEKEAAPPAFVTKLRDKECKEGDVIDFECEVEGWPEPELVWLVDDQPLRPSHDFRLQYDGQTAKLEIRDAQPDDTGVYTVKIQNEFGSIESKAELFVQADPDKNHVAPEFQATIEYVECDEGEEVRFKSVITGDPNPEIIWFINGKPLSESEKVKFISEDGICILTIKDVTRHFDGMVTCQGSNRLGSASCDGRLKVRVPPAPPTFNKPLEDKTVQEKSTVVFEVDVSGWPEPTLTFTLCGKELKNGEEGVEIVGHDGFYRISIPNTSMDKHDGEIVAKAQNEHGTAESRARLTVEQEEEESRSAPTFLKDIEDQTVKTGEFAVFETTVRGNPNPEVTWFINGHKMDQGSPGVKIEAHNHDHKLTIDSAQYAGTVLCRAENAVGRFETKARLVVLAPEKQKKPPKFVEILVDKTETVDNTVVFEVRVEGEPKPTVTWYLKGEELKQSDRVEIREFDGSIKISIKNIKIEDAGEIRAVATNSEGSDETKAKLTVQKKPFAPEFDLRPVSLTVEKGSEAVFSAHAFGIPLPTYEWSVNGRKVRDGQEGARVTRDESTVDGASILTIDTATYYSEVNHLTISVVAENTLGAEETGAQLTIEPKKPPAPKLTRDLKLQTVNKTDLAHFEVVVEHATECKWFLDGKEITTAQGVTVSKDDQFEFRCSIDTTMFGSGTVSVVASNAAGSVETKTELKVLETPKETKKPEFTDKLRDMEVTKGDTVQMDVIALHSPLYKWYQNGNLLEDGKNGVTIKNEENKSSLIIPNAQDSGKITVEASNEVGSSESSAQLTVNPPSTTPIVVDGPKSVTIKETETAEFKATISGFPAPTVKWTINEKIVEESRTITTIKTEDVYTLKISNAKIEQTGTVKVTAQNSAGQDSKQADLKVEPNVKAPKFKSQLTDKVADEGEPLRWNLELDGPSPGTEVSWLLNGQPLTKSDTVQVVDHGDGTYHVTIAEAKPEMSGTLTAKAKNAAGECETSAKVTVNGGNKKPEFVQAPQNHETTLEESVKFSAIVTGKPMPNVTWYLNNKKLIQSEEVKVKYVHETGKTSIRIQKPLMEHNGTIRVEAENVSGKVQATAQLKVDKKTEVPKFTTNMDDRQVKEGEDVKFTANVEGYPEPSVAWTLNGEPVSKHPNITVTDKDGEHTIEISAVTPEQAGELSCEATNPVGSKKRDVQLAVKKVGDAPTFAKNLEDRLITEGELTLMDAKLNIVKPKPKITWLKDGVEITSDGHYKIVEEEDGSLKLSILQTKLEDKGRITIKAESEFGVAECSASLGVVKGRPMAKPAFQSDIAPINLTEGDTLECKLLITGDPTPFVKWYIGTQLVCATEDTEISNANGVYTMKIHGVTADMTGKIKCVAYNKAGEVSTEGPLKVVAPIPVEFETSLCDATCREGDTLKLRAVLLGEPEPVVSWYVNGKKLEESQNIKIHSEKGTYTVTIKDITCDYSGQVVCEAINEYGKATSEATLLVLPRGEPPDFLEWLSNVRARTGTKVVHKVVFTGDPKPSLTWYINNKEILNSDLYTIVTDDKTSTLTINSFNPDVHVGEIICKAENDAGEVSCTANMITYTSDMFSESESEAQAEEFVGDDLTEDESLREEMHRTPTPVMAPKFITKIKDTKAKKGHSAVFECVVPDTKGVCCKWLKDGKEIELIARIRVQTRTGPEGHITQELVLDNVTPEDAGKYTCIVENTAGKDTCEATLTVIESLEKKSEKKAPEFIVALQDKTTKTSEKVVLECKVIGEPKPKVSWLHDNKTITQESITVESVEGVERVTITSSELSHQGKYTCIAENTEGTSKTEAFLTVQGEAPVFTKELQNKELSIGEKLVLSCSVKGSPQPHVDFYSFSETTKVETKITSSSRIAIEHDQTNTHWRMVISQITKEDIVSYKAIATNSIGTATSTSKITTKVEAPVFEQGLKKTSVKEKEEIKMEVKVGGSAPDVEWFKDDKPVSEDGNHEMKKNPETGVFTLVVKQAATTDAGKYTAKASNPAGTAESSAEAEVTQSLEKPTFVRELVTTEVKINETATLSVTVKGVPDPSVEWLKDGQPVQTDSSHVIAKVEGSGSYSITIKDARLEDSGKYACRATNPAGEAKTEANFAVVKNLVPPEFVEKLSPLEVKEKESTTLSVKVVGTPEPSVEWFKDDTPISIDNVHVIQKQTAVGSFSLTINDARQGDVGIYSCRARNEAGEALTTANFGIIRDSIPPEFTQKLRPLEVREQETLDLKVTVIGTPVPNVEWFKDDKPINIDNSHIFAKDEGSGHHTLTIKQARGEDVGVYTCKATNEAGEAKTTANMAVQEEIEAPLFVQGLKPYEVEQGKPAELVVRVEGKPEPEVKWFKDGVPIAIDNQHVIEKKGENGSHTLVIKDTNNADFGKYTCQATNKAGKDETVGELKIPKYSFEKQTAEEVKPLFIEPLKETFAVEGDTVVLECKVNKESHPQIKFFKNDQPVEIGQHMQLEVLEDGNIKLTIQNAKKEDVGAYRCEAVNVAGKANTNADLKIQFAAKVEEHVTDESGQLEEIGQFETVGDTASSKTDTGRGAPEFVELLRSCTVTEKQQAILKCKVKGEPRPKIKWTKEGKEVEMSARVRAEHKDDGTLTLTFDNVTQADAGEYRCEAENEYGSAWTEGPIIVTLEGAPKIDGEAPDFLQPVKPAVVTVGETAVLEGKISGKPKPSVKWYKNGEELKPSDRVKIENLDDGTQRLTVTNAKLDDMDEYRCEASNEFGDVWSDVTLTVKEPAQVAPGFFKELSAIQVKETETAKFECKVSGTKPDVKWFKDGTPLKEDKRVHFESTDDGTQRLVIEDSKTDDQGNYRIEVSNDAGVANSKVPLTVVPSETLKIKKGLTDVNVTQGTKILLSVEVEGKPKTVKWYKGTETVTSSQTTKIVQVTESEYKLEIESAEMSDTGAYRVVLSTDSFSVESSATVTVTKAAEKISLPSFKKGLADQSVPKGTPLVLEVEIEGKPKDVKWYKNGDEIKDGKVEDLGNGKYRLTIPDFQEKDVGEYSVTAANEAGEIESKAKVNVSAKPEIVSGLVPTTVKQGETATFNVKVKGPVKGVKWYKNGKEIPDAKTKDNGDGSYSLEIPNAQVEDAADYKVVVSNDAGDADSSAALTVKLADDGKDKVKPEIVSGLIPTTVKQGETATFNVKVKGPVKQVKWYKNGKEIPNAKAKDNGDGSYSLEIPNAQLDDTADYKVVVSNDAGDADSSAALTVKLPGIAIVKGLEDAEVPKGKKAVLQVETNKKPKEIKWYKNGKEITPSDKAQPGSDGDNKPQLVIPDAGDDDAAEYKVVLTDEDGNTADSSCALTVKLPAKEPKIIKGLEDQVVSIGSPIKLEIETSGSPKTVKWYKNGKELPGAAAKTIKIQKIDDNKYVLEIPSSVVEDTGDYKVEVANEAGSANSSGKITVEPKITFLKPLKDQSITEGENAEFSVETNTKPRIVKWYKNGQEIKPNSRFIIEQKTDTKYQLVIKNAVRDDADTYKIVLENTAGEAESSAQLTVKKAKAGLCKIVKGLEDQVVAKGAKMVFEVKIQGEPEDVRWLRDANVISAGANAIIEKIDDTTYRLIIPSADLKDAGEYTVEVINESGKAKSDAKGEVDEKPEIVRGLENIEIPEGDDDVFKVEVSAPVRQVKWYKNDQEIKPNSHLEAKKIGPKKYELAINRAQLDDGADYKVVLSNAAGDCDSSAALTVVKPNVLKIVDGLKDVDVEEPQPVELKVKVEGIPKVIKWYKNGQELKPDADGFKFEEKPESGEFSLTIPSSKKSDGGAYRVVLGNDKGEVYSGSVVHVKSAKSSEPTSGANFLSPLKDTEVEEGDMLTLQCTIAGEPFPEVIWEKDGVVLQKDDRITMRVALDGTATLRIRSAKKSDIGQYRVTAKNEAGSATSDCKVTVTEQGEQPSKPKFVIPLKTGAALPGDKKEFNVKVRGLPKPTLQWFLNGIPIKFDDRITLDDMADGNYCLTIRDVREEDFGTLKCIAKNENGTDETVCEFQQGAGHDDGSRDDLRYPPRFNVPLWDRRIPVGDPMFIECHVDANPTAEVEWFKDGKKIEHTAHTEIRNTVDGACRIKIIPFEESDIGVYMCVAVNELGQAETQATYQVEILEHVEEEKRREYAPKINPPLEDKTVNGGQPIRLSCKVDAIPRASVVWYKDGLPLRADSRTSIQYEEDGTATLAINDSTEEDIGAYRCVATNAHGTINTSCSVNVKVPKQEVKKEGEEPFFTKGLVDLWADRGDSFTLKCAVTGDPFPEIKWYRNGQLLRNGPRTVIETSPDGSCSLTVNESTMSDEGIYRCEAENAHGKAKTQATAHVQMALGKTEKPKMDEGKPPKFILELSDMSVSLGNVIDLECKVTGLPNPSVKWSKDGGPLIEDSRFEWSNEASKGVYQLRIKNATVHDEGTYRCVATNENGSATTKSFVRMDDGLGSGVVTASQPPRFTLKMGDVRTTEGQPLKLECKVDASPLPEMVWYKDGAIVTPSDRIQISLSPDGVATLLIPSCVYDDDGIYRVIATNPSGTAQDKGTATVKKLPRDSGARRSADRDVFDANKAPKLMEPLENIRIPEKQSFRLRCKFSGDPKPTIKWFKDGERVFPYGRLQLIESPDGVCELVVDSATRQDAGGYRCVAENTYGSARTSCDVNVIRGDRKPRDIDSSIREGKAPGFTTPLTIRRAKPGDSVTFECLPFGNPFPSIKWLKDGLELFSDEKIKMEAAADGTQRLILSDVTFLSEGYFRCVATNEHGTASTKAELVIEGDRTIGSRPLPEVNGEPEECKPRIRRGLYNMSIHEGNVVEMIVCATGIPTPTVKWYKDGQEIVGDGPDGKRVIFTDERGIHHLVIVNASPDDEGEYSLEATNKLGSAKTEGSLNIIRPRHIADADERGGMPFPPGFVRQLKNKHVFNHMPTIFDCLVVGHPAPEVEWFHNGKKIVPGGRIKIQSCGGGSHALIILDTTLEDAGEYVATAKNSHGSASSSAVLDVTVPFLDSIKFNGEIDVTPYLTEEYGFKKLNTASLPTPPDRGPFIKEVTGHYLTLSWIPTKRAPPRYPQVTYVIEIRELPEKQWSLLEYNIPEPVCKVRNLELGKSYQFRVRAENIYGISDPSPASPPSRLMAPPQPVFDRRTNKVIPLLDPYAEKALDMRYSEQYACAPWFSPGVVEKRYCAENDTLTIVLNVSGFPDPDIKWKFRGWDIDTSSPTSKCKVYTYGGSETTLAITGFSKENVGQYQCFAKNDYGDAQQNIMVDLATRPNFIQPLVNKTFSSAQPMRMDVRVDGEPFPELKWMKEWRPIVESSRIKFVQDGPYLCSLIINDPMWRDSGIYSCVAVNDAGQATTSCTVTVEAEGDYNDVELPRRRVTIESRRVRELYEISEKDEKLAAEGAPFRVKEKATGREFLAQLRPIDDALMRHVDIHNSLDHPGIVQMHRVLRDEKLALVVFDNANSTIDGLSSLAHPGVEIAEPKGVNRETCVRVFVRQLLLALKHMHDLRIAHLDLRPETILLQDDKLKLADFGQARRLLRGLITGEIKGSPEFVSPEIVRSYPLTLATDMWSTGVLTYVLLTGLSPFHGDNDNETLANVDSCQFDSSPLGNFSYDAGDFVKKLLTEIPVSRLTVDEALDHPWINDEKLKTEPLSADTLREFKYQHKWLERRVFVQQTPSEQILEAILGPATAQAQQNAPVAPEGRRPAEIYDYLRIQPKKPPPTVEYVPQPRKEHPPFIDEFGQLIDGDAFDRPEGTGFEGPHRQPPQIPPQPQRPNQAAHDSRRHEQQPQHQGQPQRIPVDQYGRPLVDPRYLNDPSHRPSSLDDAPFYVDKYGNPVHFDKYGRPMAPQNLEKRKLIPQDKGETPSHSKKEKTQHPVATPILASPGGDQQQQKIPMRMIRGERREIEEEIANRILSDISEEGSIAGSLASLEDFEIPKDFQVEASEPSTPTLTPEVTIRETIPKPTPSPTSPQKSPVPQPQGLLIPAKVTYSDSILAGLPAADKKVLEDAENDPSIPVGAPLFLEGLHGSDLTIDTTSASGLIKVTSPAINLSPNPKSPRRSTPGTKSPVVLSPRQEHSMEVLIATKRGKPGFLPPGELAEDIDDEDAFMDDRKKQVKPKDHDGENDFKDEKERLEKDKNRRTVNLDDLDKYRPSAFYKDDSDFGHPGYDIDATPWDSHYQIGPDTYLMAARGAAFNSRVRNYREELFGMGAPTVKQGFLGVRNRDITVRERRRYTDILRETTQGLEPKSHEQSTALLQKAPSATAIERIKADIEKVTPCATKKNDDGTFAPIFTARLRDVYLRKNQPAIFECAVSASPAPKVTWDFQGKILESNDRVTIEQDNNVARLILNHAAPYDLGEYVCTAINEYGTDKSSCRLISGETPSRPGRPEAELSSDTEIFIQWEAPEGPTYLEGITYRLEYRVAGPNDHGDPWITVSEKIDDESVIVKHLSPLGIYQFRVTAQNGFGLGLPSLSSRIVQTHGKGAPKLQIDVLKSEIRLNVVSMPQKSTNQLGGISEESEEDSEARTANEDMKSNLQLQTDDPTGRFQIGGLKFKGRFSVIRDAVDSTTEGHAHCAVKIRHPSSEAISEYESLRDGQHENVQRLIAAFNNSNFLYLLSERLYEDVFSRFVFNDYYTEEQVALTMRQVTSALHFLHFKGIAHLDVNPHNIMFQSKRSWVVKLVDFGRAQKVSGAVKPVDFDTKWASPEFHIPETPVTVQSDMWGMGVVTFCLLAGFHPFTSEYDREEEIKENVINVKCDPNLIPVNASQECLSFATWALKKSPVRRMRTDEALSHKFLSSDPSMVRRRESIKYSASRLRKLAAMIRQPTFSQPISEELESKYGK"
misc_feature 193..372 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Src homology 3 domain of Obscurin and similar proteins; Region: SH3_Obscurin_like; cd12025" /db_xref="CDD:212958" misc_feature order(214..216,220..222,244..249,298..306,346..348, 352..354,358..363) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="peptide ligand binding site [polypeptide binding]; other site" /db_xref="CDD:212958" misc_feature 457..984 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Guanine nucleotide exchange factor for Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous (DH) domain. It appears that PH domains invariably occur C-terminal to RhoGEF/DH domains; Region: RhoGEF; cd00160" /db_xref="CDD:238091" misc_feature order(475..477,487..489,766..768,835..840,847..852, 856..861,868..873,880..885,892..894,970..972,982..984) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="GTPase interaction site [polypeptide binding]; other site" /db_xref="CDD:238091" misc_feature 1021..1365 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="unc89 pleckstrin homology (PH) domain; Region: PH_unc89; cd13325" /db_xref="CDD:270134" misc_feature 1693..1707 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature <1708..1914 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 1732..1746 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1810..1824 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1852..1869 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1891..1902 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1942..2211 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 1993..2007 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2032..2046 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2107..2121 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2149..2166 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2188..2199 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2242..2511 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 2293..2307 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2332..2346 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2407..2421 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2449..2466 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2488..2499 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2530..2805 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 2581..2595 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2620..2634 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2698..2712 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2743..2760 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2782..2793 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2836..3102 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 2887..2901 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2926..2940 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3004..3018 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3028..3057 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3079..3090 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3130..3399 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 3181..3195 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3220..3234 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3295..3309 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3337..3354 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3376..3387 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3418..3711 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 3469..3483 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3508..3522 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3598..3612 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3622..3666 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3688..3699 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4024..4284 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 4075..4089 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4108..4122 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4186..4200 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4222..4239 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4261..4272 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4321..4572 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 4354..4368 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4393..4407 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4468..4482 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4510..4527 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4549..4560 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4591..4866 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 4642..4656 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4684..4698 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4756..4776 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4804..4821 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4843..4854 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4885..5160 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 4936..4950 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4975..4989 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5056..5070 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5098..5115 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5137..5148 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5179..5448 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 5230..5244 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5269..5283 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5344..5358 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5386..5403 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5425..5436 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5467..5742 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 5518..5532 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5560..5574 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5638..5652 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5680..5697 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5719..5730 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5767..6036 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 5857..5871 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5932..5946 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5974..5991 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6013..6024 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6055..6321 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6103..6117 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6142..6156 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6217..6231 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6259..6276 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6298..6309 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6340..6609 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 6430..6444 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6505..6519 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6550..6567 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6589..6600 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6739..7023 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6790..6804 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6829..6843 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6919..6933 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6961..6978 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7000..7011 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7060..7326 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 7111..7125 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7150..7164 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7216..7236 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7264..7281 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7303..7314 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7339..7629 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 7390..7404 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7429..7443 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7525..7542 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7570..7587 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7645..7917 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 7696..7710 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7732..7746 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7813..7827 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7855..7872 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7894..7905 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7936..8211 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 7987..8001 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8026..8040 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8107..8121 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8149..8166 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8188..8199 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8230..8496 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8281..8295 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8320..8334 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8401..8415 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8443..8460 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8482..8493 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8524..8799 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8575..8589 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8614..8628 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8695..8709 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8737..8754 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8776..8787 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8818..9093 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8869..8883 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8908..8922 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8989..9003 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9031..9048 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9070..9081 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9136..9408 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9187..9201 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9226..9240 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9304..9318 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9346..9363 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9385..9396 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9529..9786 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9580..9594 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9619..9633 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9697..9711 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9739..9756 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9778..9789 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9838..10110 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9889..9903 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9928..9942 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10000..10020 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10048..10065 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10087..10098 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10132..10401 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10183..10197 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10219..10233 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10297..10311 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10339..10356 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10378..10389 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10420..10686 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 10468..10482 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10504..10518 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10624..10641 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10663..10674 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10714..10974 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 10765..10779 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10801..10815 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10870..10884 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10912..10929 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10951..10962 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10984..11244 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11035..11049 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11071..11085 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11140..11154 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11182..11199 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11221..11232 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11278..11538 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11329..11343 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11365..11379 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11434..11448 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11476..11493 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11515..11526 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11557..11826 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 11602..11616 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11638..11652 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11716..11730 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11758..11775 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11800..11811 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11842..12117 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 11893..11907 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11929..11943 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12013..12027 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12055..12072 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12094..12105 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12133..12396 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 12178..12192 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12214..12228 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12292..12306 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12334..12351 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12373..12384 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12421..12687 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 12469..12483 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12508..12519 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12583..12597 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12625..12642 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12664..12675 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12697..12966 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 12748..12762 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12784..12798 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12862..12876 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12904..12921 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12943..12954 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13015..13260 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 13033..13047 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13069..13083 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13153..13167 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13195..13212 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13234..13245 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13297..13563 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 13342..13356 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13381..13395 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13459..13473 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13501..13518 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13540..13551 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13591..13860 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 13642..13656 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13681..13695 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13759..13773 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13801..13818 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13846..13857 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13909..14181 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 13960..13974 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13999..14013 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14077..14091 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14119..14136 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14158..14169 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14227..14499 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 14278..14292 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14317..14331 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14395..14409 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14437..14454 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14476..14487 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14539..14811 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 14590..14604 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14629..14643 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14707..14721 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14749..14766 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14791..14802 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14863..15132 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 14953..14967 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15028..15048 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15076..15093 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15118..15129 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15181..15453 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 15232..15246 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15271..15285 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15349..15363 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15391..15408 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15523..15795 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 15574..15588 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15613..15627 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15691..15705 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15733..15750 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15772..15783 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15853..16125 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 15904..15918 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15943..15957 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16021..16035 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16063..16080 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16102..16113 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16192..16473 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 16243..16257 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16282..16296 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16369..16383 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16411..16428 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16450..16461 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16528..16800 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 16579..16593 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16618..16632 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16696..16710 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16738..16755 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16777..16788 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16903..17154 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature order(16903..16905,17104..17106,17149..17151) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature <17377..17565 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 17398..17412 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 17485..17499 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 17527..17544 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 17608..17871 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="immunoglobulin-like domain of telokin and similar proteins; a member of the I-set of IgSF domains; Region: IgI_telokin-like; cd20973" /db_xref="CDD:409565" misc_feature 17608..17619 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand A [structural motif]; Region: Ig strand A" /db_xref="CDD:409565" misc_feature 17623..17634 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand A' [structural motif]; Region: Ig strand A'" /db_xref="CDD:409565" misc_feature 17644..17673 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409565" misc_feature 17686..17706 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409565" misc_feature 17713..17721 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409565" misc_feature 17737..17754 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409565" misc_feature 17761..17787 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409565" misc_feature 17809..17832 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409565" misc_feature 17839..17871 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409565" misc_feature 17938..18714 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="The protein kinase superfamily is mainly composed of the catalytic domains of serine/threonine-specific and tyrosine-specific protein kinases. It also includes RIO kinases, which are atypical serine protein kinases, aminoglycoside phosphotransferases; Region: Protein Kinases, catalytic domain; cl21453" /db_xref="CDD:473864" misc_feature order(17971..17982,17989..17991,17995..17997,18034..18036, 18040..18042,18112..18114,18163..18174,18325..18327, 18337..18342,18346..18348,18373..18378) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" misc_feature 20662..20928 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 20713..20727 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 20752..20766 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 20827..20841 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 20869..20886 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 20908..20919 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 20941..21228 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(20941..20943,21148..21150,21193..21195) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(21196..21201,21205..21210) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 21421..22185 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Catalytic kinase domain, second repeat, of the Giant Serine/Threonine Kinase Uncoordinated protein 89; Region: STKc_Unc-89_rpt2; cd14112" /db_xref="CDD:271014" misc_feature order(21451..21465,21469..21471,21475..21477,21520..21522, 21526..21528,21598..21600,21646..21651,21655..21657, 21664..21666,21670..21672,21781..21783,21787..21789, 21793..21798,21802..21804,21838..21843,21850..21852, 21889..21900) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="active site" /db_xref="CDD:271014" misc_feature order(21451..21465,21469..21471,21475..21477,21520..21522, 21526..21528,21598..21600,21646..21651,21655..21657, 21664..21666,21793..21798,21802..21804,21838..21843) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:271014" misc_feature order(21463..21465,21664..21666,21670..21672,21781..21783, 21787..21789,21793..21795,21850..21852,21889..21900) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="polypeptide substrate binding site [polypeptide binding]; other site" /db_xref="CDD:271014" misc_feature order(21838..21876,21880..21900) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="activation loop (A-loop); other site" /db_xref="CDD:271014" ORIGIN
atggctagtcgacgccaaaagcagttcgatcggaagtacagctcctatcgaaaattcactgcaaccgaagatgtcaactacagtacccactcgtcaagatcatcctatcgatctgaatcattgacttcgagaaccgatggacgcgggcggtccacgtcatccgaaatcattgccggatcggaatcccgatcttatccagtgtacattgcgattcaagactacactcctgacaaagaagacgtggaagcgattcccttagaacaaggtcaaattgtcgaggtgctcgacaagaagaactcggttcgatggcttgttagaacaaaggcacgtccaccacgttccggttgggttccgggatcgtactttgaaactccgaccgagttttacaagcaaagaagacgaacgagagaaattgagaacgtcagtctgtctgatgaacaggcggctcttgtcaagagagaccaagtctaccatgagctgctccgttccgaagaggaattcgtctcatctcttcgaacttgcgtcgatgattacatcaaagttctcgatgatcccgaagtaccagaagccgtcaaaaagaaccgcgaagagcttactctcaacattccagagctctataatttccacgccaatgtgatgctgaaaggcctcaactattattctgacgatccgggcaaggtcggtcagacttttgtccgtcttgaaaaagactttgagagccacgtggagttctataagcagtacgcagatacactgaaattgcttgaagaacctgaaattaagagattctttgagggtctctccgcaaaaaatgacgctggagcatcctcattcgtcgaccatgtcaaagagatcgccgatcgaatggtccaatatcaaaattattttaaagagtttgtcaagtattctgcaagagcacacggttcatcaaaaagtattcaaaaggcgctggaattggtcaccactattccgcaaagagttcacgatctagaattcaccaataatttgaagcaacatccaggagatactggaaagttgggacggattatcagacatgacgctttccaagtgtgggaaggagatgagccaccgaaacttcgctacgtgttcctgttccgaaataaaataatgttcacggaacaagatgcatcgacaagtccaccaagttatacacattattcatcaattcgattggacaaatacaatatcagacaacacacgacagacgaggatactattgtccttcaacctcaggaaccgggacttccaagtttcagaatcaaaccaaaggactttgaaacttcggagtacgtgcgcaaagcctggctgagggacatcgcagaggagcaggagaaatatgctgctgaacgagatgcgatctcgatgacggcaacgtcagagatgaccgcatcctcggtcgatttcgatatgaacgcgtcggaccagcaatccgaattttcggaatggtccggctcccgaaagagcagcttgttccctggtccagaagaaggaggtccaccacgaaagaaggtaaaatcaccgccggtgatttcacctaccggctcgtccaccagtatctattcaggaggaagtagtagtattgattggacaacaactggaacgacactcgaaatgcaaggaacgcgtgtaaccagaacccaatacggtttcagaaccttgcaagaatcatcagcgaaaatgtgtctgaaagtaactggatatccattacctgatatcacatggtacaaagatgatgtacaacttcatgaagatgagagacacactttttattcggatgaagatggtttctttgcgatgaccattgatccagttcaggtgaccgacactggtcgttacacatgtatggcaacaaacgaatacggtcaggcatccacttctgcctttttccgagttttgaaagtcgaaaaagaagctgctccaccagcatttgtcacaaaactcagagacaaagaatgcaaagaaggtgatgttattgatttcgaatgtgaagttgaaggatggcctgaaccggaacttgtatggcttgtcgacgatcagccactccgaccatcccacgactttcggctgcaatatgatggacagacggcaaagctcgaaattcgtgatgctcagccggatgatactggagtctatacagtcaagattcaaaatgagttcggatcgattgaaagcaaggctgagctctttgttcaagcagatccagataagaaccatgtggctccagagttccaggcaacaattgaatatgttgagtgtgatgagggagaggaagttcgattcaagtcagttattactggagatcctaatccagaaatcatttggttcatcaatggaaaaccactgagtgaatcagaaaaagtcaagttcatctcggaagatggaatctgcatcttaacgattaaagacgtaaccaggcatttcgatggaatggttacatgtcaaggatcaaacagattgggttcagcgtcttgtgatggaaggctaaaagtcagagttccaccagcaccaccaacctttaataagccactcgaagataagacagtccaggagaagagtactgttgtgttcgaagtggatgtcagcggatggccagagccaacactaaccttcacactttgcggaaaagagttgaaaaacggtgaagaaggcgttgaaatcgtagggcacgacggtttctatcgcatttcgatcccgaacacatcgatggacaagcacgacggtgaaattgtggcaaaggctcaaaatgagcatggaaccgcggagagtagggcacggctcactgtggaacaggaggaggaggagtcgcgcagtgcgccgactttcttgaaggatattgaagatcaaaccgtaaaaaccggcgagttcgccgtcttcgagacaaccgttcgcggaaatccgaatccggaggttacttggttcatcaacgggcacaagatggatcagggcagtccgggcgtcaagatcgaggcgcacaatcacgaccataagctgactatcgactcggcacagtacgcgggcaccgtactctgcagagctgaaaatgctgttggacgattcgaaacgaaagcccgactcgttgttctggccccagaaaaacagaagaaaccaccgaaattcgtggagattcttgtcgacaaaaccgaaaccgtcgacaacacagttgtgtttgaagttcgcgttgaaggtgaaccaaaaccgactgtaacatggtatttaaaaggagaagaactcaaacaatcggatcgcgtcgagattcgagaattcgatggatcaataaaaatctcaatcaagaacatcaaaattgaagatgccggagagatcagggctgttgcgacaaactctgaaggatctgatgagacgaaggcgaaattgactgttcagaagaagccattcgctccagaatttgatttgcgaccagttagcttgacagtcgaaaagggatccgaagcagttttcagtgcacacgcttttggtattccattgccaacttatgaatggtctgtcaatggaagaaaggtgcgagatggacaggaaggggcgcgcgtaacacgtgacgagagcaccgtcgacggcgcatcgatcctgacgatcgacacggcgacatactattccgaagtgaaccatctgacaatttctgttgtcgcagaaaacacactcggagccgaagagacgggcgcccagttgacgatcgagccgaagaagcctccagcgccaaagctcactcgcgacctcaaattgcagacagtcaacaagaccgacttggcccatttcgaagttgtcgttgaacatgcaaccgagtgcaaatggttcttggatggaaaagagattacgacagcccaaggggttacggtttcaaaggacgatcaatttgaattccgttgctcaattgatacaaccatgtttggaagtggaactgtgtctgttgtggcttcaaatgctgctggttccgtggagactaagactgaattgaaggttttggaaactccaaaggaaaccaagaaaccagaattcactgacaagctcagagatatggaagtcacaaagggagatacagtacagatggacgtcatcgccctacactcgcctctatacaaatggtaccaaaatggaaatctgttggaagatggaaagaatggagttaccattaagaacgaggaaaacaaatcttcattgatcattccaaatgctcaagattctggaaagatcacagttgaagcttcgaacgaagtcggatcatctgaatcctctgctcaactgactgtcaatccaccatcaactaccccaattgttgttgatggaccaaagtcggtgactatcaaggaaacggaaactgctgagttcaaggcaacaattagcggattcccagcaccaactgtcaaatggacgattaatgaaaagatcgtagaggaatctagaactatcaccactatcaagacggaagacgtctatactttgaagatctctaatgcaaagatcgagcagactggaactgtgaaagttactgctcaaaattcagctggacaggatagcaagcaagctgaccttaaggttgaaccaaatgtgaaagctccaaagttcaagtctcagctcactgataaggttgctgatgaaggagaaccactccgttggaatcttgaattggatgggccatcacctggaactgaagtctcttggcttcttaacggacagccacttacaaagagtgatactgttcaagtagtcgatcatggagatggaacttatcatgtgacgattgcagaggccaagccagaaatgtctggaactcttacagcaaaagcaaagaacgccgcaggagagtgtgagacatcggcaaaggttactgtgaatggaggaaacaagaaaccagaatttgttcaagctccacaaaatcacgagacaactcttgaagaaagtgttaagttcagcgctattgttactggaaaaccaatgccaaatgtgacatggtatttgaacaacaagaagttgatccagagtgaggaggttaaagtgaagtatgttcatgagactggaaagacatcaatccgcattcaaaagccactcatggagcacaatggaactatccgcgttgaagctgagaatgtgtcaggaaaggttcaagccacagctcaattgaaggttgacaaaaagactgaagttccaaagttcactacgaacatggatgatcgtcaagtcaaagagggagaagatgtgaagttcactgcaaatgtggaaggataccctgaaccatctgtagcatggactttgaatggagaaccagtttctaagcatccaaacatcactgttaccgacaaggacggagagcacaccatcgaaatttccgccgtcacacccgaacaagctggagagctgtcttgcgaagcgacaaaccccgtcggatccaaaaagagagatgttcaactcgctgttaaaaaggtcggtgatgcaccaacgtttgcaaagaatctcgaagatcggttgatcaccgagggagagttgacattgatggatgctaaattaaacattgtaaaaccaaagccaaagatcacctggcttaaggatggtgttgaaattacttctgatgggcattataagattgttgaagaggaagatggatccttgaaacttagcattcttcaaactaaactggaagataagggaagaatcacgattaaagcggaaagcgaatttggcgttgcggaatgttcagcatctcttggagttgttaagggacgcccaatggccaaaccagcattccaaagtgatattgcaccaattaacctcaccgaaggagatacccttgaatgcaagcttctcatcaccggagacccaacacctttcgtcaagtggtacattggaacacaactcgtttgtgccactgaagatactgagatctctaatgccaatggagtttacactatgaagattcatggtgtgactgctgacatgactggaaagatcaagtgcgtcgcatacaataaggctggagaagtgagcaccgagggtccactcaaggttgttgcaccgattccggttgaatttgaaacatctctatgtgatgctacctgcagagaaggagatactctcaaattgagggcagtattgctcggagagccagaaccagttgtctcgtggtatgtgaacggaaagaagttggaagaatctcagaatatcaagattcattctgagaaaggaacatacacggttacaatcaaagacatcacatgcgattattctggacaagtcgtctgcgaggcaatcaacgagtatggaaaagcaacatctgaggctacattgctcgtgctgccacgtggtgaacctccagatttcttggaatggctcagcaatgttcgcgcaagaactggaaccaaggtcgtgcacaaggttgtcttcacaggagacccgaaaccaagccttacatggtacatcaataataaggagattctcaactcggatctttacaccatcgtcacagatgataaaacatcaacgttgacaatcaacagcttcaacccagatgttcatgttggagaaattatctgcaaggccgagaacgatgctggagaagtttcctgtaccgcaaacatgatcacctacacatctgacatgttcagtgaatctgaaagtgaagcccaagctgaagaatttgtcggagacgatctcactgaagatgagagtcttcgagaggaaatgcaccgtactccaactccagttatggcacccaaattcatcacaaagatcaaggataccaaagccaagaagggacactctgctgtctttgaatgcgttgttccagacaccaagggagtgtgctgcaagtggttgaaggacggaaaagagattgagctgattgccagaatccgggttcaaactagaactggaccagagggacacatcactcaagaacttgtcctcgacaacgtcactccagaagatgccggcaagtacacgtgcatcgttgagaacaccgccggaaaagatacctgtgaggcgacgctaactgtcattgaatcattggagaagaagtcggagaaaaaagctccagaattcattgttgctcttcaagataagacaacaaagacatccgagaaggttgttcttgaatgcaaagtcatcggagagccaaagccgaaagtcagctggcttcacgataataagacaattactcaagagtctatcacagttgaatcagtggaaggcgtcgaaagagtcacaatcacttcatctgaattgtctcatcaaggaaaatacacctgcattgccgagaacactgaaggaacatctaagactgaagcattcttgactgtccaaggcgaagctccagtgttcacaaaggaactgcagaacaaggagttatcaattggagagaagctcgttctctcgtgttctgtcaaaggatccccacagccgcatgtcgatttttattcgttctcggaaactacgaaggtggagacgaagatcacctcatccagtcgaatcgccattgagcatgaccagaccaatacgcattggagaatggttatcagtcaaatcacaaaagaagatattgtctcctacaaagctattgccacaaattcaattggaactgctacttcaacatcaaagatcaccacgaaggtagaggcaccagtctttgagcaaggattaaagaagacaagtgtgaaggagaaggaagaaattaagatggaagtaaaggtcggaggaagtgctccagatgttgaatggtttaaggatgacaaaccagtcagtgaagatggaaatcatgagatgaagaagaatccagaaactggagtgtttactctggttgtgaaacaagctgcaactacagatgctggaaagtataccgccaaggcttccaatccagcaggtactgctgaatcttctgcagaggctgaggtcactcaatctctcgagaaaccaactttcgtgagggaacttgtcacaactgaagtcaagatcaatgaaactgcaactttgtccgttacagtgaaaggagttccagatccgagtgttgaatggcttaaggatggacaaccagtgcaaactgattcaagtcatgtgattgctaaggttgaaggatccggaagctactcgattaccattaaggatgcgagactcgaggactctggaaagtacgcatgccgtgcaaccaatccagcaggtgaagccaaaactgaggctaactttgcagttgtcaagaacttggttccaccagaatttgttgagaaactcagtccactcgaagtgaaggagaaggaaagtaccaccttgtccgtcaaggttgtaggaacaccagaaccatctgttgaatggttcaaggatgatactccaattagtatcgacaatgttcatgtcattcagaagcagacagctgttggatccttcagtttaaccatcaatgacgcgagacagggagatgttggaatctactcttgccgtgctaggaatgaagctggggaagctcttacaacagcgaactttggaatcatcagggattctattccaccagagtttactcaaaaacttcgaccacttgaagtcagagagcaggagactcttgatttgaaagttactgtaattggaaccccagtaccaaatgttgaatggttcaaggatgataagccaatcaatattgataactcgcacatttttgcaaaggatgaaggatcaggacatcatactctcacaattaaacaagctagaggagaagatgttggagtctacacctgcaaagccaccaacgaagccggagaagccaaaaccactgcaaacatggctgttcaagaagagattgaagcaccattgtttgttcaaggcctgaaaccatacgaggtggaacaaggcaagccagctgaattggtggttcgtgtagaaggaaagccagagcctgaggttaaatggttcaaggatggagttccgattgctattgacaatcagcatgtgattgagaagaagggagagaatggatctcatactcttgtcatcaaagacaccaacaatgctgacttcggaaagtacacatgccaagctacaaacaaggctggaaaggatgaaactgttggagagctcaagattccaaagtattcattcgaaaagcaaactgctgaagaagtcaagccactgttcattgagccactaaaggaaacatttgccgttgaaggagataccgttgttcttgaatgcaaggtgaacaaggaatcacatccacaaatcaagttcttcaagaatgatcaaccagtggagattggacaacacatgcaattggaagtattggaagatggaaatatcaagctcacaattcaaaatgccaagaaagaagacgttggtgcatatcgttgcgaggctgtgaatgttgccggaaaggccaacacgaatgctgatttgaagattcaattcgctgctaaagttgaagaacatgtcaccgatgaaagtggccagcttgaggagattggacagtttgagactgtcggagatactgcatcctctaagaccgacactggacgtggagctccagaatttgtggagcttctccgttcgtgtacagttaccgagaagcaacaagcgatccttaagtgcaaggtgaaaggagagccacgaccaaagatcaagtggactaaggaaggaaaggaggtcgaaatgtcggcacgtgttcgcgctgagcacaaggatgatggaactttgacgctgacatttgataatgttactcaagccgacgccggagaatacagatgtgaggctgagaacgagtatggaagtgcatggaccgaagggccaattattgtcacattggaaggagctccaaagattgacggtgaagctccagacttcttgcaaccagtcaagccagctgttgttacagttggtgagactgcagttcttgaaggaaagatttctggaaaaccgaaaccaagtgttaaatggtacaagaatggagaagagctcaagccatccgatagagttaagattgagaatttggatgatggaactcaaagactcaccgttaccaacgctaaactcgacgatatggatgagtaccgctgtgaagcttcaaatgagtttggagatgtttggagtgacgtcactcttacagtcaaggaaccagctcaagttgctccaggattcttcaaggaactctctgctattcaggttaaggagactgaaaccgccaagtttgaatgcaaggtttcgggaactaagccagatgtgaaatggttcaaggacggaactccattgaaggaagacaaacgagtgcacttcgaatcaaccgacgatggaactcaaagacttgtcatcgaagattccaagactgatgatcaaggaaactaccgtattgaagtttccaatgatgctggagttgcgaacagcaaggttccactcacagtcgttccatcagaaaccctcaagatcaagaagggactcacagatgtaaatgttacacagggaaccaagatccttctctctgttgaagttgaaggaaaaccaaaaactgtcaaatggtacaagggaacagaaactgtcaccagctcccagaccacaaagatcgtgcaggtgaccgagtcagaatacaagttagaaatcgaaagcgctgagatgtctgatactggagcttaccgcgttgttctctctactgattcgttttctgttgagtcgtctgctacagtaactgtcaccaaggctgctgaaaagattagtcttccttcattcaagaagggactcgctgatcaatccgttccaaagggaactccattggttttggaagttgaaatcgaaggaaagccaaaagatgttaaatggtataagaatggagatgagatcaaggacgggaaggtcgaggatcttggaaacggaaaataccgactcacaattccagacttccaagagaaagatgttggagagtacagtgtcactgctgctaacgaggctggagaaattgaatcaaaggccaaggtaaacgtgagtgccaagcctgaaattgtttctgggctggtaccaactactgtgaagcaaggagaaactgccacctttaacgtcaaggtcaagggaccagtcaagggagtcaagtggtacaagaacggaaaagagattcctgatgctaaaacaaaggacaatggagatggatcctactctcttgagattccaaacgctcaagttgaagatgcagctgactataaggttgttgtctccaatgatgctggagatgctgattcttcagctgctcttaccgtcaaacttgctgacgatggaaaggataaggtgaaaccagaaattgtatcgggacttattccaactacagtgaagcaaggagaaactgccacctttaacgtcaaggtcaagggtccagtgaaacaggtcaagtggtataagaatggaaaagaaattcccaacgccaaggctaaggacaacggagatggatcctactctctggaaattccaaacgcgcaacttgatgacactgccgactacaaggttgttgtgtcgaatgatgctggagatgctgattcttcagctgctcttactgttaagcttcctggaatcgctattgttaagggacttgaagacgccgaagtgccaaagggcaagaaggctgttctccaagttgaaaccaacaagaagccaaaggaaattaaatggtataagaatggaaaggagattactccaagcgacaaggcacaacccggaagcgacggagacaacaaaccacagctggttattccagatgctggtgacgatgatgctgctgaatataaggttgtgttgactgatgaagatggaaatactgccgattcgtcatgcgccttgactgttaaattaccagcaaaagagccaaagatcatcaaaggactcgaggatcaagtggtgtcgattggatctccaattaagttggaaatcgaaacttctggatcaccgaagactgtgaaatggtacaaaaacggaaaggagcttccaggagctgccgccaagaccatcaagattcagaagatcgacgataacaagtatgttcttgagatcccatccagtgttgttgaagataccggagactacaaagtcgaagttgccaacgaggcaggatctgcaaacagcagtggaaagatcactgtggaaccaaagatcacgttcttaaagccactgaaggatcaatcgatcactgagggagaaaatgccgaattctcagttgaaaccaacaccaagccaagaattgtcaaatggtataagaatggacaagaaattaagccaaattcccgattcatcattgaacaaaagactgataccaagtatcaacttgttattaagaacgctgttcgtgatgatgcagacacctacaagattgttcttgaaaacaccgctggagaagccgaatcttctgctcaattgactgttaagaaagctaaggctggactctgcaagatcgtcaaaggtcttgaagaccaggttgttgccaagggtgccaagatggtatttgaggttaagatccaaggagagccagaggatgtcagatggcttcgtgatgcaaatgttatcagtgcaggagctaatgcaatcattgagaaaattgatgacaccacctacaggttgataattccatccgctgatttgaaggatgctggtgaatacactgtcgaagtaatcaatgagagtggaaaagccaagagtgatgcaaagggagaggttgatgagaaaccagagattgttcgaggacttgagaacatcgaaattccagagggagatgacgatgtgttcaaggttgaagtcagtgctccagtcagacaagtcaaatggtataaaaatgaccaggagatcaaaccaaacagccatttggaagccaaaaagatcggtccaaagaagtacgaacttgctatcaaccgtgctcaattggacgatggagccgactacaaggttgtgctatcgaatgctgcaggagattgtgattcttccgcggctctcactgttgtcaagccaaatgttctgaagattgtcgatggattgaaggatgttgatgttgaggaaccccaaccagttgaacttaaggtcaaggttgagggtattccaaaggttattaaatggtacaagaacggacaggagcttaagccagatgctgacggattcaaatttgaagagaaaccagaatctggagagttctctctcactatcccatcgtctaagaaatctgatgggggtgcataccgtgttgttcttggaaatgacaagggagaagtatacagtggatctgttgttcatgttaaatctgccaaatcatccgaaccaacatcaggagccaacttcctctccccactcaaggataccgaggttgaagaaggagatatgctcactcttcagtgcactattgctggagaaccattccccgaagtcatctgggagaaggatggtgttgtccttcagaaggatgatagaatcacgatgagagtcgcacttgatggtactgctaccctcagaattcgttctgccaagaagagtgacattggacaatatcgtgttactgcgaagaacgaagctggaagcgctacaagtgactgcaaggttaccgtcactgaacaaggagagcaaccatcgaagccaaagttcgttattccattgaagacgggagcagctcttccaggcgacaagaaggaattcaatgtgaaggttcgaggacttccaaagccaacattgcaatggttcttgaacggaatcccaatcaaattcgatgatagaatcaccctcgatgacatggctgatggaaactactgtcttacgattcgtgacgttcgtgaagaagacttcggaaccttgaagtgtattgcaaagaatgagaatggaacagatgaaactgtctgtgaattccaacaaggtgctggacacgatgatggatctagagacgatcttcgttatccaccaagattcaatgttccactttgggacagaagaatccctgttggtgacccaatgttcatcgagtgtcatgttgatgccaacccgaccgccgaagttgaatggttcaaggatggaaagaagatcgaacacactgcacataccgaaatcagaaacaccgttgatggagcatgtcgcatcaagatcattccattcgaggagtctgatattggagtttacatgtgcgttgctgtaaacgagttgggacaagctgaaactcaagccacataccaagttgagattttggaacatgtggaggaggagaagcgccgagaatatgctccaaagattaatccaccattggaagataaaactgtcaatggaggtcaaccaatcagattatcatgcaaggttgacgctatcccaagagcttcagtggtttggtacaaggatggacttccacttcgtgctgattctagaacctctattcaatatgaagaggatggtacagctacccttgcgatcaatgacagtaccgaggaagacattggagcataccgttgtgttgctacaaatgctcatggaacgatcaacaccagttgcagtgtgaacgtcaaggttccgaagcaggaagtcaagaaggagggagaagagccattcttcacaaagggacttgtcgatttgtgggcggatcgtggagattcgttcactttgaagtgcgcagtcaccggagatccattcccagaaatcaagtggtacagaaatggacaacttcttagaaatggaccaagaactgttattgaaacatcgccagatggttcatgttcacttactgtcaatgaatctacaatgagtgatgaaggaatctatcgatgtgaagctgaaaatgctcatggaaaggccaagactcaagctactgctcatgtgcaaatggctcttggaaagactgaaaaaccaaaaatggatgaaggaaaaccaccaaagttcattttggagctttctgatatgtcagtttctcttggaaatgttattgatttggaatgcaaggttaccggactaccaaatccatcagtcaaatggtcgaaggatggaggtccactgattgaggactccagattcgaatggtccaatgaagccagcaagggagtctatcagctcagaatcaagaacgccaccgtacatgacgagggaacttatcgctgcgttgccacaaatgagaatggaagtgctactaccaagtcatttgtaagaatggatgatggtcttggatcaggtgttgtgactgccagtcagccaccaagattcactttgaagatgggagatgttcgtacaactgaaggacaaccattaaaattggagtgtaaggttgacgctagcccacttccagagatggtttggtataaggatggagccattgttacaccatctgacagaattcaaattagtctgtcacctgatggagttgcaactcttcttatcccatcttgcgtctatgatgatgatggaatctaccgtgtaattgccaccaacccatctggaactgcccaggataagggaactgctactgttaagaaacttccaagagatagcggtgccagaaggtctgctgacagagatgtatttgatgctaacaaggcaccaaagcttatggagccactggagaatatcagaattcccgaaaagcagtcgttccgtcttcgttgcaagttcagcggagatccaaagccaacaatcaaatggttcaaggatggagaacgtgtattcccatacggacgtcttcaactcatcgagtctccagatggtgtctgtgagttggtggttgattctgccactcgtcaagatgctggaggatacagatgcgttgctgaaaacacttatggatctgctagaacatcttgcgatgttaatgttattcgcggtgatcgtaagccacgcgacattgactcgtccattcgtgaaggaaaggctccaggattcaccaccccattgacaatccgtcgtgctaagccaggagattccgtgacattcgaatgccttccattcggaaatccattcccatcaatcaagtggcttaaggatggacttgagctgttctctgatgaaaagatcaagatggaagctgctgcagatggaacccagcgactcattctttccgatgtcaccttcttgagtgaaggatacttcagatgtgtagctaccaatgagcatggaactgcttctacaaaggctgaacttgtcatcgaaggagaccgaactattggatcccgcccacttccagaagtaaacggagagcctgaagaatgcaagccaagaatccgtcgtggactgtacaacatgagtattcacgagggtaatgttgtggagatgatcgtctgtgcaactggtatcccaacgccaactgtcaagtggtacaaggatggacaggagattgtcggagatggacctgatggaaagagggtcatctttacggatgaacgaggaattcatcacttggttattgtgaatgcatctccagatgatgaaggagagtactcgttggaagcaacgaataagttgggatcagccaagaccgaaggatccttgaacattatcagaccaagacatattgcagatgctgacgagagaggaggcatgccattcccaccaggattcgtgcgtcaactaaagaacaagcacgtcttcaatcacatgccaacaatcttcgactgccttgttgtcggacacccagcccctgaagtagagtggttccacaatggaaagaagattgttccaggaggacgaatcaagattcaatcgtgtggaggaggatctcatgccctcatcattctcgatacaacccttgaagatgcaggagagtacgttgctactgcgaagaactctcatggatccgccagctcatcagcagtgcttgatgtgactgttccattcctggacagcatcaagttcaatggagagattgatgtgactccatacctcaccgaggaatatggattcaagaagcttaacaccgccagtctcccaactccaccagatcgtggaccattcatcaaggaggtcaccggacattatcttacactctcatggattccaacaaagagagctccaccacgttatccacaagtcacatatgttattgagattcgtgaacttccagagaaacaatggtctctcttggagtataacattccagagccagtatgcaaggttcgtaatttggaactcggaaagtcatatcaattccgtgttcgtgctgagaacatctatggaatctctgatccatcgccagcatctccaccatcaagactcatggctccaccacaaccagtattcgatagaagaacgaacaaagttattccacttcttgacccatatgcagaaaaagctcttgatatgagatactctgaacagtacgcgtgtgctccatggttctcaccaggagtcgttgagaagcgatactgcgccgagaacgataccctcacaattgttctgaatgtgtccggattcccggatccagatatcaaatggaagttccgtggatgggatattgacacgtcatcgccaacctctaaatgcaaagtgtacacttatggaggttccgagacaacattagccatcactggattcagcaaggagaatgttggacaatatcaatgtttcgccaagaacgattacggagatgcacaacaaaatattatggttgatcttgcaacacgaccaaacttcatccaaccactcgtgaacaagaccttctcatcagctcagccaatgagaatggacgtgagagtcgacggagaacctttcccagaattgaaatggatgaaggaatggcgcccaattgtcgagtcgtctcgcatcaagtttgttcaagacggaccttatttgtgctctttgatcattaatgatccaatgtggagagactccggaatctattcatgtgttgctgtaaatgatgccggacaagccacgacgtcgtgtactgttactgttgaagctgaaggcgactacaatgacgtcgaacttccccgtcgccgagtgacaatcgaatcgcgacgagtgcgagagctctacgaaatctctgaaaaagacgaaaagttggcggccgaaggagcaccatttcgagtcaaagaaaaagccacgggacgcgagtttttggcgcagttgagaccgatcgatgatgctctaatgcgccacgtggatatccacaattcgttggatcatccaggaattgtgcaaatgcatcgggtgcttagagatgagaaattggcattggtggtgtttgataatgcaaactcaactatcgacggcctctcaagccttgcgcaccctggcgtcgaaattgctgagccaaaaggagtcaaccgtgaaacatgtgttcgtgtctttgttcgtcaacttcttcttgctctcaagcacatgcatgatttgcgaattgcccatctagatctccgtcccgaaaccattcttcttcaagatgataagctgaaattagcagacttcggtcaagcaagacgccttctacgcggccttatcaccggagaaatcaagggatcgcccgagttcgtgagccctgaaatcgtgagaagttacccattgaccctggcaactgatatgtggagtactggagttttgacatatgtattactaaccggattgtcaccattccacggagataatgacaatgagacccttgcaaacgttgatagttgccaatttgattcgtctcctcttggcaacttctcctatgacgccggagatttcgtcaagaaactgttgaccgagattccagtctcacgtttgacagttgatgaagcattagaccatccatggattaacgatgaaaagctgaaaactgaacctttgtcagctgacacgttgagggaattcaaatatcagcataagtggctggaacgtcgcgtgttcgttcaacagacgccgtccgaacagattcttgaagcaattcttggtccggcaacggcacaagctcaacaaaatgctcctgtagcaccggaaggtcgacgtcctgctgaaatttacgactatctgagaattcagccgaaaaagccaccaccgactgtggaatacgttccacaacctagaaaagagcatccgccgtttattgacgaattcggacaacttattgacggagacgcttttgatcgaccagagggtactggatttgaaggaccacatagacaaccaccacaaattccacctcaacctcaacgaccgaaccaggcagctcacgattcgagacgacacgaacaacaaccacaacatcaggggcaaccacagcgaattcctgttgatcaatacggtcgtccgctagtcgacccacgttacctgaacgatccatcgcaccgcccgagttcccttgacgacgctccattctacgtggacaaatacggaaatccggtgcactttgacaaatacggtagaccaatggctccacaaaacttggaaaagcgaaagcttatcccacaagacaaaggagaaaccccatctcattccaaaaaagaaaagactcagcatccagttgctacaccgattctagcatcgccgggaggagatcaacagcagcagaagatcccgatgagaatgatccgtggggaacgaagagaaatcgaagaggaaattgcgaatagaatattatcagatatttctgaagaaggatcaattgctggttcacttgccagtttggaagattttgagattcccaaggatttccaagtagaggcatctgagccatcaacaccaactctcacaccagaagtaacaatcagagagactattccaaagccaacaccatctccaacatccccacagaaatctccagttccacaaccacaaggtctcttgattccagcaaaggtcacctactctgactcaatactcgccggactccctgcagcagataaaaaggtcctcgaagacgcggaaaacgatccatccatcccagtcggtgctccacttttccttgaaggactccacggatctgatcttacaatcgacacgacctcagcttcaggactgatcaaagtcacatccccagctatcaacctcagtccaaatccaaaatctccacgccgttccactccaggtacaaagagtccagttgtgttgagtccacgtcaagagcactcaatggaagtattgatcgcaacaaagcgaggaaaacctggattcttgccaccaggagaacttgctgaagatattgatgatgaggatgcatttatggatgacagaaagaaacaagtgaaaccaaaggatcatgatggagaaaatgatttcaaagatgagaaagaaagactggagaaggacaaaaacagaagaactgttaacttggatgatcttgataaatatcgtccaagtgcattctacaaagatgatagtgatttcggacatcctggatatgatattgatgcaactccatgggactcacattatcagattggtccagacacttatctgatggctgctcgtggagccgccttcaactcccgagtccgtaactatcgtgaggaactcttcggaatgggggctccaactgtcaaacagggattcctcggagtcagaaatcgtgacattactgttcgtgaacgtcgtcgttacactgatatcctccgcgagactacacaaggccttgagccaaaatctcatgagcaatcaacagctcttcttcaaaaagctccatcagcaacagcaattgagagaattaaggctgatattgagaaggtcacgccgtgtgccacaaagaagaatgatgatggaacctttgccccaatcttcactgcccgtctccgtgatgtgtatcttcgtaaaaaccaaccagcaattttcgaatgcgctgtttcagccagcccggctccaaaagttacttgggacttccaagggaagattctagagtctaacgacagggttacaatcgaacaagataacaatgtcgcccgtcttatccttaaccatgcagctccttacgatcttggagaatacgtgtgcactgccataaatgaatatggaacagataaatcaagttgccgactgataagtggagagactccatctcgtccaggaagacctgaagctgaactctcatctgatacggagattttcattcaatgggaagctccagaaggaccaacatatctggaaggtatcacctacagactcgaatatcgtgttgcaggaccgaatgatcatggtgacccatggatcactgtttctgaaaagattgatgatgaatctgtaattgttaaacatctatcaccacttggaatttatcaattccgagtcactgcacagaatggattcggtctagggctcccatcattgagtagcagaattgttcaaactcacggaaaaggagcaccaaagttgcaaattgatgttttgaaatccgagattcgactgaatgttgtttcaatgcctcaaaagtctacaaatcaattaggaggaatttcggaggaaagtgaagaggattcggaggcaagaacggcaaatgaagatatgaaatcaaatctgcaattgcaaactgatgatccaacaggacggttccagatcggtggtctcaagttcaagggacgtttctctgtgatccgcgacgccgtcgattccacaacagaaggtcacgcccattgcgctgtgaagattcgtcatccatcgtctgaagcgatctcagagtatgaatcgcttcgtgatggtcagcatgaaaatgttcaacgccttatcgccgcattcaataactccaatttcttgtatctattatcggaaagactctacgaagatgtgttttctcgttttgtgttcaacgattattatacagaagaacaagttgcattgacaatgagacaagtcacttcggcacttcatttcttgcatttcaaaggaattgcccatcttgatgtgaatccacacaacataatgttccaatcaaaacgtagttgggtcgtgaaactagttgattttggaagagcacaaaaagtgtcgggagctgtgaaaccagttgattttgatactaaatgggcttcaccagaattccatattccggaaactccggttaccgttcaaagtgacatgtggggtatgggagtcgtcactttctgccttctcgctggattccacccgttcacttctgaatacgaccgcgaagaggagatcaaggagaacgtgatcaatgtgaaatgtgatccaaatttgattccagtcaacgcttcccaagaatgcctttcatttgccacgtgggcgctcaaaaagtcgccagttcgccgaatgagaaccgacgaggctctttctcataagttcctttcttcagatccatcgatggttagaaggagggaatctattaaatactctgcatcaagactccgaaagcttgccgcaatgatccgccagccaacattcagccaaccaatcagcgaagagctcgagtcgaaatatggaaaataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]