2024-09-28 11:20:34, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_001025814 24703 bp mRNA linear INV 11-JUN-2024 DEFINITION Caenorhabditis elegans Muscle M-line assembly protein unc-89 (unc-89), partial mRNA. ACCESSION NM_001025814 VERSION NM_001025814.4 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 24703) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 24703) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (11-JUN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 24703) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (23-MAY-2024) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 24703) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003279). On Apr 15, 2020 this sequence version replaced NM_001025814.3. COMPLETENESS: incomplete on the 5' end. FEATURES Location/Qualifiers source 1..24703 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="I" gene <1..24703 /gene="unc-89" /locus_tag="CELE_C09D1.1" /db_xref="GeneID:171990" CDS 1..24246 /gene="unc-89" /locus_tag="CELE_C09D1.1" /standard_name="C09D1.1b" /note="Confirmed by transcript evidence" /codon_start=1 /product="Muscle M-line assembly protein unc-89" /protein_id="NP_001020985.1" /db_xref="GeneID:171990" /translation="
MASRRQKQFDRKYSSYRKFTATEDVNYSTHSSRSSYRSESLTSRTDGRGRSTSSEIIAGSESRSYPVYIAIQDYTPDKEDVEAIPLEQGQIVEVLDKKNSVRWLVRTKARPPRSGWVPGSYFETPTEFYKQRRRTREIENVSLSDEQAALVKRDQVYHELLRSEEEFVSSLRTCVDDYIKVLDDPEVPEAVKKNREELTLNIPELYNFHANVMLKGLNYYSDDPGKVGQTFVRLEKDFESHVEFYKQYADTLKLLEEPEIKRFFEGLSAKNDAGASSFVDHVKEIADRMVQYQNYFKEFVKYSARAHGSSKSIQKALELVTTIPQRVHDLEFTNNLKQHPGDTGKLGRIIRHDAFQVWEGDEPPKLRYVFLFRNKIMFTEQDASTSPPSYTHYSSIRLDKYNIRQHTTDEDTIVLQPQEPGLPSFRIKPKDFETSEYVRKAWLRDIAEEQEKYAAERDAISMTATSEMTASSVDFDMNASDQQSEFSEWSGSRKSSLFPGPEEGGPPRKKVKSPPVISPTGSSTSIYSGGSSSIDWTTTGTTLEMQGTRVTRTQYGFRTLQESSAKMCLKVTGYPLPDITWYKDDVQLHEDERHTFYSDEDGFFAMTIDPVQVTDTGRYTCMATNEYGQASTSAFFRVLKVEKEAAPPAFVTKLRDKECKEGDVIDFECEVEGWPEPELVWLVDDQPLRPSHDFRLQYDGQTAKLEIRDAQPDDTGVYTVKIQNEFGSIESKAELFVQADPDKNHVAPEFQATIEYVECDEGEEVRFKSVITGDPNPEIIWFINGKPLSESEKVKFISEDGICILTIKDVTRHFDGMVTCQGSNRLGSASCDGRLKVRVPPAPPTFNKPLEDKTVQEKSTVVFEVDVSGWPEPTLTFTLCGKELKNGEEGVEIVGHDGFYRISIPNTSMDKHDGEIVAKAQNEHGTAESRARLTVEQEEEESRSAPTFLKDIEDQTVKTGEFAVFETTVRGNPNPEVTWFINGHKMDQGSPGVKIEAHNHDHKLTIDSAQYAGTVLCRAENAVGRFETKARLVVLAPEKQKKPPKFVEILVDKTETVDNTVVFEVRVEGEPKPTVTWYLKGEELKQSDRVEIREFDGSIKISIKNIKIEDAGEIRAVATNSEGSDETKAKLTVQKKPFAPEFDLRPVSLTVEKGSEAVFSAHAFGIPLPTYEWSVNGRKVRDGQEGARVTRDESTVDGASILTIDTATYYSEVNHLTISVVAENTLGAEETGAQLTIEPKKESVVVEKQDLSSSEVQKEIAQQVKEASPEATTTITMETSLTSTKTTTMSTTEVTSTVGGVTVETKESESESATTVIGGGSGGVTEGSISVSKIEVVSKTDSQTDVREGTPKRRVSFAEEELPKEVIDSDRKKKKSPSPDKKEKSPEKTEEKPASPTKKTGEEVKSPKEKSPASPTKKEKSPAAEEVKSPTKKEKSPSSPTKKEKSPSSPTKKTGDEVKEKSPPKSPTKKEKSPEKPEDVKSPVKKEKSPDATNIVEVSSETTIEKTETTMTTEMTHESEESRTSVKKEKTPEKVDEKPKSPTKKDKSPEKSITEEIKSPVKKEKSPEKVEEKPASPTKKEKSPEKPASPTKKSENEVKSPTKKEKSPEKSVVEELKSPKEKSPEKADDKPKSPTKKEKSPEKSATEDVKSPTKKEKSPEKVEEKPTSPTKKESSPTKKTDDEVKSPTKKEKSPQTVEEKPASPTKKEKSPEKSVVEEVKSPKEKSPEKAEEKPKSPTKKEKSPEKSAAEEVKSPTKKEKSPEKSAEEKPKSPTKKESSPVKMADDEVKSPTKKEKSPEKVEEKPASPTKKEKTPEKSAAEELKSPTKKEKSPSSPTKKTGDESKEKSPEKPEEKPKSPTPKKSPPGSPKKKKSKSPEAEKPPAPKLTRDLKLQTVNKTDLAHFEVVVEHATECKWFLDGKEITTAQGVTVSKDDQFEFRCSIDTTMFGSGTVSVVASNAAGSVETKTELKVLETPKETKKPEFTDKLRDMEVTKGDTVQMDVIALHSPLYKWYQNGNLLEDGKNGVTIKNEENKSSLIIPNAQDSGKITVEASNEVGSSESSAQLTVNPPSTTPIVVDGPKSVTIKETETAEFKATISGFPAPTVKWTINEKIVEESRTITTIKTEDVYTLKISNAKIEQTGTVKVTAQNSAGQDSKQADLKVEPNVKAPKFKSQLTDKVADEGEPLRWNLELDGPSPGTEVSWLLNGQPLTKSDTVQVVDHGDGTYHVTIAEAKPEMSGTLTAKAKNAAGECETSAKVTVNGGNKKPEFVQAPQNHETTLEESVKFSAIVTGKPMPNVTWYLNNKKLIQSEEVKVKYVHETGKTSIRIQKPLMEHNGTIRVEAENVSGKVQATAQLKVDKKTEVPKFTTNMDDRQVKEGEDVKFTANVEGYPEPSVAWTLNGEPVSKHPNITVTDKDGEHTIEISAVTPEQAGELSCEATNPVGSKKRDVQLAVKKVGDAPTFAKNLEDRLITEGELTLMDAKLNIVKPKPKITWLKDGVEITSDGHYKIVEEEDGSLKLSILQTKLEDKGRITIKAESEFGVAECSASLGVVKGRPMAKPAFQSDIAPINLTEGDTLECKLLITGDPTPFVKWYIGTQLVCATEDTEISNANGVYTMKIHGVTADMTGKIKCVAYNKAGEVSTEGPLKVVAPIPVEFETSLCDATCREGDTLKLRAVLLGEPEPVVSWYVNGKKLEESQNIKIHSEKGTYTVTIKDITCDYSGQVVCEAINEYGKATSEATLLVLPRGEPPDFLEWLSNVRARTGTKVVHKVVFTGDPKPSLTWYINNKEILNSDLYTIVTDDKTSTLTINSFNPDVHVGEIICKAENDAGEVSCTANMITYTSDMFSESESEAQAEEFVGDDLTEDESLREEMHRTPTPVMAPKFITKIKDTKAKKGHSAVFECVVPDTKGVCCKWLKDGKEIELIARIRVQTRTGPEGHITQELVLDNVTPEDAGKYTCIVENTAGKDTCEATLTVIESLEKKSEKKAPEFIVALQDKTTKTSEKVVLECKVIGEPKPKVSWLHDNKTITQESITVESVEGVERVTITSSELSHQGKYTCIAENTEGTSKTEAFLTVQGEAPVFTKELQNKELSIGEKLVLSCSVKGSPQPHVDFYSFSETTKVETKITSSSRIAIEHDQTNTHWRMVISQITKEDIVSYKAIATNSIGTATSTSKITTKVEAPVFEQGLKKTSVKEKEEIKMEVKVGGSAPDVEWFKDDKPVSEDGNHEMKKNPETGVFTLVVKQAATTDAGKYTAKASNPAGTAESSAEAEVTQSLEKPTFVRELVTTEVKINETATLSVTVKGVPDPSVEWLKDGQPVQTDSSHVIAKVEGSGSYSITIKDARLEDSGKYACRATNPAGEAKTEANFAVVKNLVPPEFVEKLSPLEVKEKESTTLSVKVVGTPEPSVEWFKDDTPISIDNVHVIQKQTAVGSFSLTINDARQGDVGIYSCRARNEAGEALTTANFGIIRDSIPPEFTQKLRPLEVREQETLDLKVTVIGTPVPNVEWFKDDKPINIDNSHIFAKDEGSGHHTLTIKQARGEDVGVYTCKATNEAGEAKTTANMAVQEEIEAPLFVQGLKPYEVEQGKPAELVVRVEGKPEPEVKWFKDGVPIAIDNQHVIEKKGENGSHTLVIKDTNNADFGKYTCQATNKAGKDETVGELKIPKYSFEKQTAEEVKPLFIEPLKETFAVEGDTVVLECKVNKESHPQIKFFKNDQPVEIGQHMQLEVLEDGNIKLTIQNAKKEDVGAYRCEAVNVAGKANTNADLKIQFAAKVEEHVTDESGQLEEIGQFETVGDTASSKTDTGRGAPEFVELLRSCTVTEKQQAILKCKVKGEPRPKIKWTKEGKEVEMSARVRAEHKDDGTLTLTFDNVTQADAGEYRCEAENEYGSAWTEGPIIVTLEGAPKIDGEAPDFLQPVKPAVVTVGETAVLEGKISGKPKPSVKWYKNGEELKPSDRVKIENLDDGTQRLTVTNAKLDDMDEYRCEASNEFGDVWSDVTLTVKEPAQVAPGFFKELSAIQVKETETAKFECKVSGTKPDVKWFKDGTPLKEDKRVHFESTDDGTQRLVIEDSKTDDQGNYRIEVSNDAGVANSKVPLTVVPSETLKIKKGLTDVNVTQGTKILLSVEVEGKPKTVKWYKGTETVTSSQTTKIVQVTESEYKLEIESAEMSDTGAYRVVLSTDSFSVESSATVTVTKAAEKISLPSFKKGLADQSVPKGTPLVLEVEIEGKPKDVKWYKNGDEIKDGKVEDLGNGKYRLTIPDFQEKDVGEYSVTAANEAGEIESKAKVNVSAKPEIVSGLVPTTVKQGETATFNVKVKGPVKGVKWYKNGKEIPDAKTKDNGDGSYSLEIPNAQVEDAADYKVVVSNDAGDADSSAALTVKLADDGKDKVKPEIVSGLIPTTVKQGETATFNVKVKGPVKQVKWYKNGKEIPNAKAKDNGDGSYSLEIPNAQLDDTADYKVVVSNDAGDADSSAALTVKLPGIAIVKGLEDAEVPKGKKAVLQVETNKKPKEIKWYKNGKEITPSDKAQPGSDGDNKPQLVIPDAGDDDAAEYKVVLTDEDGNTADSSCALTVKLPAKEPKIIKGLEDQVVSIGSPIKLEIETSGSPKTVKWYKNGKELPGAAAKTIKIQKIDDNKYVLEIPSSVVEDTGDYKVEVANEAGSANSSGKITVEPKITFLKPLKDQSITEGENAEFSVETNTKPRIVKWYKNGQEIKPNSRFIIEQKTDTKYQLVIKNAVRDDADTYKIVLENTAGEAESSAQLTVKKAKAGLCKIVKGLEDQVVAKGAKMVFEVKIQGEPEDVRWLRDANVISAGANAIIEKIDDTTYRLIIPSADLKDAGEYTVEVINESGKAKSDAKGEVDEKPEIVRGLENIEIPEGDDDVFKVEVSAPVRQVKWYKNDQEIKPNSHLEAKKIGPKKYELAINRAQLDDGADYKVVLSNAAGDCDSSAALTVVKPNVLKIVDGLKDVDVEEPQPVELKVKVEGIPKVIKWYKNGQELKPDADGFKFEEKPESGEFSLTIPSSKKSDGGAYRVVLGNDKGEVYSGSVVHVKSAKSSEPTSGANFLSPLKDTEVEEGDMLTLQCTIAGEPFPEVIWEKDGVVLQKDDRITMRVALDGTATLRIRSAKKSDIGQYRVTAKNEAGSATSDCKVTVTEQGEQPSKPKFVIPLKTGAALPGDKKEFNVKVRGLPKPTLQWFLNGIPIKFDDRITLDDMADGNYCLTIRDVREEDFGTLKCIAKNENGTDETVCEFQQGAGHDDGSRDDLRYPPRFNVPLWDRRIPVGDPMFIECHVDANPTAEVEWFKDGKKIEHTAHTEIRNTVDGACRIKIIPFEESDIGVYMCVAVNELGQAETQATYQVEILEHVEEEKRREYAPKINPPLEDKTVNGGQPIRLSCKVDAIPRASVVWYKDGLPLRADSRTSIQYEEDGTATLAINDSTEEDIGAYRCVATNAHGTINTSCSVNVKVPKQEVKKEGEEPFFTKGLVDLWADRGDSFTLKCAVTGDPFPEIKWYRNGQLLRNGPRTVIETSPDGSCSLTVNESTMSDEGIYRCEAENAHGKAKTQATAHVQMALGKTEKPKMDEGKPPKFILELSDMSVSLGNVIDLECKVTGLPNPSVKWSKDGGPLIEDSRFEWSNEASKGVYQLRIKNATVHDEGTYRCVATNENGSATTKSFVRMDDGLGSGVVTASQPPRFTLKMGDVRTTEGQPLKLECKVDASPLPEMVWYKDGAIVTPSDRIQISLSPDGVATLLIPSCVYDDDGIYRVIATNPSGTAQDKGTATVKKLPRDSGARRSADRDVFDANKAPKLMEPLENIRIPEKQSFRLRCKFSGDPKPTIKWFKDGERVFPYGRLQLIESPDGVCELVVDSATRQDAGGYRCVAENTYGSARTSCDVNVIRGDRKPRDIDSSIREGKAPGFTTPLTIRRAKPGDSVTFECLPFGNPFPSIKWLKDGLELFSDEKIKMEAAADGTQRLILSDVTFLSEGYFRCVATNEHGTASTKAELVIEGDRTIGSRPLPEVNGEPEECKPRIRRGLYNMSIHEGNVVEMIVCATGIPTPTVKWYKDGQEIVGDGPDGKRVIFTDERGIHHLVIVNASPDDEGEYSLEATNKLGSAKTEGSLNIIRPRHIADADERGGMPFPPGFVRQLKNKHVFNHMPTIFDCLVVGHPAPEVEWFHNGKKIVPGGRIKIQSCGGGSHALIILDTTLEDAGEYVATAKNSHGSASSSAVLDVTVPFLDSIKFNGEIDVTPYLTEEYGFKKLNTASLPTPPDRGPFIKEVTGHYLTLSWIPTKRAPPRYPQVTYVIEIRELPEKQWSLLEYNIPEPVCKVRNLELGKSYQFRVRAENIYGISDPSPASPPSRLMAPPQPVFDRRTNKVIPLLDPYAEKALDMRYSEQYACAPWFSPGVVEKRYCAENDTLTIVLNVSGFPDPDIKWKFRGWDIDTSSPTSKCKVYTYGGSETTLAITGFSKENVGQYQCFAKNDYGDAQQNIMVDLATRPNFIQPLVNKTFSSAQPMRMDVRVDGEPFPELKWMKEWRPIVESSRIKFVQDGPYLCSLIINDPMWRDSGIYSCVAVNDAGQATTSCTVTVEAEGDYNDVELPRRRVTIESRRVRELYEISEKDEKLAAEGAPFRVKEKATGREFLAQLRPIDDALMRHVDIHNSLDHPGIVQMHRVLRDEKLALVVFDNANSTIDGLSSLAHPGVEIAEPKGVNRETCVRVFVRQLLLALKHMHDLRIAHLDLRPETILLQDDKLKLADFGQARRLLRGLITGEIKGSPEFVSPEIVRSYPLTLATDMWSTGVLTYVLLTGLSPFHGDNDNETLANVDSCQFDSSPLGNFSYDAGDFVKKLLTEIPVSRLTVDEALDHPWINDEKLKTEPLSADTLREFKYQHKWLERRVFVQQTPSEQILEAILGPATAQAQQNAPVAPEGRRPAEIYDYLRIQPKKPPPTVEYVPQPRKEHPPFIDEFGQLIDGDAFDRPEGTGFEGPHRQPPQIPPQPQRPNQAAHDSRRHEQQPQHQGQPQRIPVDQYGRPLVDPRYLNDPSHRPSSLDDAPFYVDKYGNPVHFDKYGRPMAPQNLEKRKLIPQDKGETPSHSKKEKTQHPVATPILASPGGDQQQQKIPMRMIRGERREIEEEIANRILSDISEEGSIAGSLASLEDFEIPKDFQVEASEPSTPTLTPEVTIRETIPKPTPSPTSPQKSPVPQPQGLLIPAKVTYSDSILAGLPAADKKVLEDAENDPSIPVGAPLFLEGLHGSDLTIDTTSASGLIKVTSPAINLSPNPKSPRRSTPGTKSPVVLSPRQEHSMEVLIATKRGKPGFLPPGELAEDIDDEDAFMDDRKKQVKPKDHDGENDFKDEKERLEKDKNRRTVNLDDLDKYRPSAFYKDDSDFGHPGYDIDATPWDSHYQIGPDTYLMAARGAAFNSRVRNYREELFGMGAPTVKQGFLGVRNRDITVRERRRYTDILRETTQGLEPKSHEQSTALLQKAPSATAIERIKADIEKVTPCATKKNDDGTFAPIFTARLRDVYLRKNQPAIFECAVSASPAPKVTWDFQGKILESNDRVTIEQDNNVARLILNHAAPYDLGEYVCTAINEYGTDKSSCRLISGETPSRPGRPEAELSSDTEIFIQWEAPEGPTYLEGITYRLEYRVAGPNDHGDPWITVSEKIDDESVIVKHLSPLGIYQFRVTAQNGFGLGLPSLSSRIVQTHGKGAPKLQIDVLKSEIRLNVVSMPQKSTNQLGGISEESEEDSEARTANEDMKSNLQLQTDDPTGRFQIGGLKFKGRFSVIRDAVDSTTEGHAHCAVKIRHPSSEAISEYESLRDGQHENVQRLIAAFNNSNFLYLLSERLYEDVFSRFVFNDYYTEEQVALTMRQVTSALHFLHFKGIAHLDVNPHNIMFQSKRSWVVKLVDFGRAQKVSGAVKPVDFDTKWASPEFHIPETPVTVQSDMWGMGVVTFCLLAGFHPFTSEYDREEEIKENVINVKCDPNLIPVNASQECLSFATWALKKSPVRRMRTDEALSHKFLSSDPSMVRRRESIKYSASRLRKLAAMIRQPTFSQPISEELESKYGK"
misc_feature 193..372 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Src Homology 3 domain superfamily; Region: SH3; cl17036" /db_xref="CDD:473055" misc_feature order(214..216,220..222,229..231,247..249,301..306, 352..354,358..363) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="peptide ligand binding site [polypeptide binding]; other site" /db_xref="CDD:212690" misc_feature 457..984 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Guanine nucleotide exchange factor for Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous (DH) domain. It appears that PH domains invariably occur C-terminal to RhoGEF/DH domains; Region: RhoGEF; cd00160" /db_xref="CDD:238091" misc_feature order(475..477,487..489,766..768,835..840,847..852, 856..861,868..873,880..885,892..894,970..972,982..984) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="GTPase interaction site [polypeptide binding]; other site" /db_xref="CDD:238091" misc_feature 1021..1365 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="unc89 pleckstrin homology (PH) domain; Region: PH_unc89; cd13325" /db_xref="CDD:270134" misc_feature 1693..1707 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature <1708..1914 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 1732..1746 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 1810..1824 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 1852..1869 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 1891..1902 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 1942..2211 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 1993..2007 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2032..2046 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2107..2121 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2149..2166 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2188..2199 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2242..2511 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 2293..2307 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2332..2346 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2407..2421 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2449..2466 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2488..2499 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2530..2805 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 2581..2595 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 2620..2634 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 2698..2712 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 2743..2760 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 2782..2793 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 2836..3102 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 2887..2901 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 2926..2940 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 3004..3018 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 3028..3057 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 3079..3090 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 3130..3399 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 3181..3195 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3220..3234 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3295..3309 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3337..3354 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3376..3387 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3418..3711 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 3469..3483 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 3508..3522 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 3598..3612 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 3622..3666 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 3688..3699 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature <3910..5976 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="MAEBL; Provisional; Region: PTZ00121" /db_xref="CDD:173412" misc_feature 5944..6204 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 5995..6009 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6028..6042 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6106..6120 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6142..6159 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6181..6192 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6241..6492 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6274..6288 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409406" misc_feature 6313..6327 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409406" misc_feature 6388..6402 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409406" misc_feature 6430..6447 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409406" misc_feature 6469..6480 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409406" misc_feature 6511..6786 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 6562..6576 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6604..6618 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6676..6696 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6724..6741 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6763..6774 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6805..7080 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6856..6870 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 6895..6909 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 6976..6990 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 7018..7035 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 7057..7068 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 7099..7368 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 7150..7164 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 7189..7203 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 7264..7278 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 7306..7323 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 7345..7356 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 7387..7662 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 7438..7452 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 7480..7494 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 7558..7572 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 7600..7617 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 7639..7650 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 7687..7956 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 7777..7791 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 7852..7866 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 7894..7911 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 7933..7944 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 7975..8241 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8023..8037 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 8062..8076 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 8137..8151 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 8179..8196 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 8218..8229 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 8260..8529 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 8350..8364 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8425..8439 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8470..8487 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8509..8520 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8659..8943 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8710..8724 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 8749..8763 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 8839..8853 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 8881..8898 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 8920..8931 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 8980..9246 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9031..9045 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9070..9084 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9136..9156 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9184..9201 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9223..9234 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9259..9549 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 9310..9324 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 9349..9363 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 9445..9462 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 9490..9507 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 9565..9837 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9616..9630 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 9652..9666 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 9733..9747 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 9775..9792 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 9814..9825 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 9856..10131 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9907..9921 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9946..9960 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10027..10041 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10069..10086 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10108..10119 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10150..10416 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10201..10215 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 10240..10254 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 10321..10335 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 10363..10380 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 10402..10413 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 10444..10719 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10495..10509 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10534..10548 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10615..10629 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10657..10674 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10696..10707 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10738..11013 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10789..10803 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 10828..10842 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 10909..10923 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 10951..10968 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 10990..11001 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 11056..11328 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11107..11121 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11146..11160 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11224..11238 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11266..11283 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11305..11316 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11449..11706 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11500..11514 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 11539..11553 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 11617..11631 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 11659..11676 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 11698..11709 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 11758..12030 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11809..11823 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11848..11862 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11920..11940 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11968..11985 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12007..12018 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12052..12321 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 12103..12117 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12139..12153 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12217..12231 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12259..12276 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12298..12309 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12340..12606 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 12388..12402 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12424..12438 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12544..12561 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12583..12594 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12634..12894 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 12685..12699 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 12721..12735 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 12790..12804 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 12832..12849 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 12871..12882 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 12904..13164 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 12955..12969 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 12991..13005 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 13060..13074 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 13102..13119 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 13141..13152 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 13198..13458 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 13249..13263 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 13285..13299 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 13354..13368 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 13396..13413 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 13435..13446 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 13477..13746 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 13522..13536 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 13558..13572 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 13636..13650 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 13678..13695 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 13720..13731 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 13762..14037 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 13813..13827 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 13849..13863 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 13933..13947 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 13975..13992 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 14014..14025 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 14053..14316 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 14098..14112 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 14134..14148 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 14212..14226 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 14254..14271 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 14293..14304 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 14341..14607 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 14389..14403 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14428..14439 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14503..14517 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14545..14562 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14584..14595 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14617..14886 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 14668..14682 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 14704..14718 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 14782..14796 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 14824..14841 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 14863..14874 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 14935..15180 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 14953..14967 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 14989..15003 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 15073..15087 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 15115..15132 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 15154..15165 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 15217..15483 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 15262..15276 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15301..15315 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15379..15393 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15421..15438 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15460..15471 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15511..15780 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 15562..15576 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 15601..15615 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 15679..15693 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 15721..15738 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 15766..15777 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 15829..16101 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 15880..15894 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15919..15933 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15997..16011 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16039..16056 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16078..16089 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16147..16419 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 16198..16212 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16237..16251 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16315..16329 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16357..16374 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16396..16407 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16459..16731 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 16510..16524 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16549..16563 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16627..16641 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16669..16686 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16711..16722 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16783..17052 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 16873..16887 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16948..16968 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16996..17013 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 17038..17049 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 17101..17373 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 17152..17166 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 17191..17205 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 17269..17283 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 17311..17328 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 17443..17715 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 17494..17508 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409543" misc_feature 17533..17547 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 17611..17625 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 17653..17670 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 17692..17703 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409543" misc_feature 17773..18045 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 17824..17838 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 17863..17877 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 17941..17955 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 17983..18000 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 18022..18033 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 18112..18393 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 18163..18177 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 18202..18216 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 18289..18303 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 18331..18348 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 18370..18381 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 18448..18720 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 18499..18513 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 18538..18552 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 18616..18630 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 18658..18675 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 18697..18708 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 18823..19074 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature order(18823..18825,19024..19026,19069..19071) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature <19297..19485 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 19318..19332 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409543" misc_feature 19405..19419 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409543" misc_feature 19447..19464 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409543" misc_feature 19528..19791 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="immunoglobulin-like domain of telokin and similar proteins; a member of the I-set of IgSF domains; Region: IgI_telokin-like; cd20973" /db_xref="CDD:409565" misc_feature 19528..19539 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand A [structural motif]; Region: Ig strand A" /db_xref="CDD:409565" misc_feature 19543..19554 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand A' [structural motif]; Region: Ig strand A'" /db_xref="CDD:409565" misc_feature 19564..19593 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409565" misc_feature 19606..19626 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409565" misc_feature 19633..19641 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409565" misc_feature 19657..19674 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409565" misc_feature 19681..19707 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409565" misc_feature 19729..19752 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409565" misc_feature 19759..19791 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409565" misc_feature 19858..20634 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Pseudokinase domain, first repeat, of the Giant Serine/Threonine Kinase Uncoordinated protein 89; Region: PK_Unc-89_rpt1; cd14109" /db_xref="CDD:271011" misc_feature 22582..22848 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 22633..22647 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409405" misc_feature 22672..22686 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409405" misc_feature 22747..22761 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409405" misc_feature 22789..22806 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409405" misc_feature 22828..22839 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409405" misc_feature 22861..23148 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(22861..22863,23068..23070,23113..23115) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(23116..23121,23125..23130) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 23341..24105 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Catalytic kinase domain, second repeat, of the Giant Serine/Threonine Kinase Uncoordinated protein 89; Region: STKc_Unc-89_rpt2; cd14112" /db_xref="CDD:271014" misc_feature order(23371..23385,23389..23391,23395..23397,23440..23442, 23446..23448,23518..23520,23566..23571,23575..23577, 23584..23586,23590..23592,23701..23703,23707..23709, 23713..23718,23722..23724,23758..23763,23770..23772, 23809..23820) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="active site" /db_xref="CDD:271014" misc_feature order(23371..23385,23389..23391,23395..23397,23440..23442, 23446..23448,23518..23520,23566..23571,23575..23577, 23584..23586,23713..23718,23722..23724,23758..23763) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:271014" misc_feature order(23383..23385,23584..23586,23590..23592,23701..23703, 23707..23709,23713..23715,23770..23772,23809..23820) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="polypeptide substrate binding site [polypeptide binding]; other site" /db_xref="CDD:271014" misc_feature order(23758..23796,23800..23820) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="activation loop (A-loop); other site" /db_xref="CDD:271014" ORIGIN
atggctagtcgacgccaaaagcagttcgatcggaagtacagctcctatcgaaaattcactgcaaccgaagatgtcaactacagtacccactcgtcaagatcatcctatcgatctgaatcattgacttcgagaaccgatggacgcgggcggtccacgtcatccgaaatcattgccggatcggaatcccgatcttatccagtgtacattgcgattcaagactacactcctgacaaagaagacgtggaagcgattcccttagaacaaggtcaaattgtcgaggtgctcgacaagaagaactcggttcgatggcttgttagaacaaaggcacgtccaccacgttccggttgggttccgggatcgtactttgaaactccgaccgagttttacaagcaaagaagacgaacgagagaaattgagaacgtcagtctgtctgatgaacaggcggctcttgtcaagagagaccaagtctaccatgagctgctccgttccgaagaggaattcgtctcatctcttcgaacttgcgtcgatgattacatcaaagttctcgatgatcccgaagtaccagaagccgtcaaaaagaaccgcgaagagcttactctcaacattccagagctctataatttccacgccaatgtgatgctgaaaggcctcaactattattctgacgatccgggcaaggtcggtcagacttttgtccgtcttgaaaaagactttgagagccacgtggagttctataagcagtacgcagatacactgaaattgcttgaagaacctgaaattaagagattctttgagggtctctccgcaaaaaatgacgctggagcatcctcattcgtcgaccatgtcaaagagatcgccgatcgaatggtccaatatcaaaattattttaaagagtttgtcaagtattctgcaagagcacacggttcatcaaaaagtattcaaaaggcgctggaattggtcaccactattccgcaaagagttcacgatctagaattcaccaataatttgaagcaacatccaggagatactggaaagttgggacggattatcagacatgacgctttccaagtgtgggaaggagatgagccaccgaaacttcgctacgtgttcctgttccgaaataaaataatgttcacggaacaagatgcatcgacaagtccaccaagttatacacattattcatcaattcgattggacaaatacaatatcagacaacacacgacagacgaggatactattgtccttcaacctcaggaaccgggacttccaagtttcagaatcaaaccaaaggactttgaaacttcggagtacgtgcgcaaagcctggctgagggacatcgcagaggagcaggagaaatatgctgctgaacgagatgcgatctcgatgacggcaacgtcagagatgaccgcatcctcggtcgatttcgatatgaacgcgtcggaccagcaatccgaattttcggaatggtccggctcccgaaagagcagcttgttccctggtccagaagaaggaggtccaccacgaaagaaggtaaaatcaccgccggtgatttcacctaccggctcgtccaccagtatctattcaggaggaagtagtagtattgattggacaacaactggaacgacactcgaaatgcaaggaacgcgtgtaaccagaacccaatacggtttcagaaccttgcaagaatcatcagcgaaaatgtgtctgaaagtaactggatatccattacctgatatcacatggtacaaagatgatgtacaacttcatgaagatgagagacacactttttattcggatgaagatggtttctttgcgatgaccattgatccagttcaggtgaccgacactggtcgttacacatgtatggcaacaaacgaatacggtcaggcatccacttctgcctttttccgagttttgaaagtcgaaaaagaagctgctccaccagcatttgtcacaaaactcagagacaaagaatgcaaagaaggtgatgttattgatttcgaatgtgaagttgaaggatggcctgaaccggaacttgtatggcttgtcgacgatcagccactccgaccatcccacgactttcggctgcaatatgatggacagacggcaaagctcgaaattcgtgatgctcagccggatgatactggagtctatacagtcaagattcaaaatgagttcggatcgattgaaagcaaggctgagctctttgttcaagcagatccagataagaaccatgtggctccagagttccaggcaacaattgaatatgttgagtgtgatgagggagaggaagttcgattcaagtcagttattactggagatcctaatccagaaatcatttggttcatcaatggaaaaccactgagtgaatcagaaaaagtcaagttcatctcggaagatggaatctgcatcttaacgattaaagacgtaaccaggcatttcgatggaatggttacatgtcaaggatcaaacagattgggttcagcgtcttgtgatggaaggctaaaagtcagagttccaccagcaccaccaacctttaataagccactcgaagataagacagtccaggagaagagtactgttgtgttcgaagtggatgtcagcggatggccagagccaacactaaccttcacactttgcggaaaagagttgaaaaacggtgaagaaggcgttgaaatcgtagggcacgacggtttctatcgcatttcgatcccgaacacatcgatggacaagcacgacggtgaaattgtggcaaaggctcaaaatgagcatggaaccgcggagagtagggcacggctcactgtggaacaggaggaggaggagtcgcgcagtgcgccgactttcttgaaggatattgaagatcaaaccgtaaaaaccggcgagttcgccgtcttcgagacaaccgttcgcggaaatccgaatccggaggttacttggttcatcaacgggcacaagatggatcagggcagtccgggcgtcaagatcgaggcgcacaatcacgaccataagctgactatcgactcggcacagtacgcgggcaccgtactctgcagagctgaaaatgctgttggacgattcgaaacgaaagcccgactcgttgttctggccccagaaaaacagaagaaaccaccgaaattcgtggagattcttgtcgacaaaaccgaaaccgtcgacaacacagttgtgtttgaagttcgcgttgaaggtgaaccaaaaccgactgtaacatggtatttaaaaggagaagaactcaaacaatcggatcgcgtcgagattcgagaattcgatggatcaataaaaatctcaatcaagaacatcaaaattgaagatgccggagagatcagggctgttgcgacaaactctgaaggatctgatgagacgaaggcgaaattgactgttcagaagaagccattcgctccagaatttgatttgcgaccagttagcttgacagtcgaaaagggatccgaagcagttttcagtgcacacgcttttggtattccattgccaacttatgaatggtctgtcaatggaagaaaggtgcgagatggacaggaaggggcgcgcgtaacacgtgacgagagcaccgtcgacggcgcatcgatcctgacgatcgacacggcgacatactattccgaagtgaaccatctgacaatttctgttgtcgcagaaaacacactcggagccgaagagacgggcgcccagttgacgatcgagccgaagaaggagagtgtcgtcgtcgaaaagcaagatttgtccagttcagaagtccagaaggaaatagctcagcaggtaaaagaagcttctcctgaggcaacaacaaccatcacaatggagacatcgttgacgtcaactaaaacaactacaatgtccacaactgaagtcacatcaacagttggaggagtgactgtcgagaccaaggagtcggaatcggaatccgcgacaacagtgatcggaggaggatcaggtggtgtaaccgagggaagcatcagtgttagcaagattgaggttgtctcgaagacggactcacagactgatgttagagaaggaacaccaaagagacgagtgtcgtttgctgaagaggaattgccaaaagaggttattgattcggaccgcaaaaagaagaagagtccaagcccggacaaaaaggagaagagccctgagaaaactgaggaaaagcctgctagtcctactaagaagactggtgaggaggtgaagtctccaaaggagaagagcccagcaagtccgacaaagaaggaaaagtcacctgcagcagaggaagttaaatcacctaccaaaaaggagaaatctccatcatcaccaaccaagaaggaaaagagcccatcgtctccaaccaaaaagactggggatgaggtgaaagaaaagtctccaccaaagagcccaaccaaaaaggaaaagagcccggagaaacctgaagatgtaaaatctccagttaagaaggaaaaaagcccggatgcaactaatattgttgaagtttcctctgaaacaacaattgagaaaactgaaactactatgaccactgagatgacacacgaatcggaagagtcaagaacttccgtgaaaaaggagaagactccggagaaggttgatgaaaaaccaaagagcccgacgaagaaggacaaatcaccagaaaagtctattaccgaggagatcaagtcacctgtcaaaaaagagaaatctccggagaaggtggaagagaaaccagctagtcctaccaagaaagagaagtctccagaaaaaccagcttcgccgacaaagaagtcggaaaatgaagtaaaatctccaactaaaaaagagaagagtccagagaaatctgtagttgaagagctaaaatctccaaaggaaaaatcaccagagaaggctgacgacaagccaaagagcccgacaaagaaggagaagtcacctgaaaaatcggctacggaagatgtgaaatctccaaccaaaaaagaaaaatctccagaaaaagttgaagagaagccaacgagcccaaccaaaaaagagtcctcgccaactaaaaagaccgatgatgaggtaaagtctccaaccaagaaggagaagagcccacaaaccgttgaagaaaaaccagctagcccgacaaagaaggagaagtcgccagagaaatctgtagtagaagaggtgaaatctcccaaagaaaaatctccagaaaaggctgaggagaagccaaagagtcctacaaagaaagagaagtcacctgaaaagtccgctgcggaagaagtcaaatctcctaccaaaaaagagaagtctccagaaaagtctgctgaggagaagcctaagagcccaaccaaaaaagagtcttcaccagttaaaatggcagatgatgaggtgaaatctccaaccaagaaggaaaagagccccgaaaaggttgaagaaaaacctgcgagcccaaccaagaaagaaaaaacaccagaaaagtcagctgccgaagaactcaaatctcccacgaagaaggaaaagagcccatcttcaccaaccaagaaaactggggacgaatccaaagaaaaatctccagaaaaaccagaggagaagccaaagagcccgacaccaaagaagtctccaccaggctcaccaaagaagaagaagtcaaagtcgccggaagccgaaaagcctccagcgccaaagctcactcgcgacctcaaattgcagacagtcaacaagaccgacttggcccatttcgaagttgtcgttgaacatgcaaccgagtgcaaatggttcttggatggaaaagagattacgacagcccaaggggttacggtttcaaaggacgatcaatttgaattccgttgctcaattgatacaaccatgtttggaagtggaactgtgtctgttgtggcttcaaatgctgctggttccgtggagactaagactgaattgaaggttttggaaactccaaaggaaaccaagaaaccagaattcactgacaagctcagagatatggaagtcacaaagggagatacagtacagatggacgtcatcgccctacactcgcctctatacaaatggtaccaaaatggaaatctgttggaagatggaaagaatggagttaccattaagaacgaggaaaacaaatcttcattgatcattccaaatgctcaagattctggaaagatcacagttgaagcttcgaacgaagtcggatcatctgaatcctctgctcaactgactgtcaatccaccatcaactaccccaattgttgttgatggaccaaagtcggtgactatcaaggaaacggaaactgctgagttcaaggcaacaattagcggattcccagcaccaactgtcaaatggacgattaatgaaaagatcgtagaggaatctagaactatcaccactatcaagacggaagacgtctatactttgaagatctctaatgcaaagatcgagcagactggaactgtgaaagttactgctcaaaattcagctggacaggatagcaagcaagctgaccttaaggttgaaccaaatgtgaaagctccaaagttcaagtctcagctcactgataaggttgctgatgaaggagaaccactccgttggaatcttgaattggatgggccatcacctggaactgaagtctcttggcttcttaacggacagccacttacaaagagtgatactgttcaagtagtcgatcatggagatggaacttatcatgtgacgattgcagaggccaagccagaaatgtctggaactcttacagcaaaagcaaagaacgccgcaggagagtgtgagacatcggcaaaggttactgtgaatggaggaaacaagaaaccagaatttgttcaagctccacaaaatcacgagacaactcttgaagaaagtgttaagttcagcgctattgttactggaaaaccaatgccaaatgtgacatggtatttgaacaacaagaagttgatccagagtgaggaggttaaagtgaagtatgttcatgagactggaaagacatcaatccgcattcaaaagccactcatggagcacaatggaactatccgcgttgaagctgagaatgtgtcaggaaaggttcaagccacagctcaattgaaggttgacaaaaagactgaagttccaaagttcactacgaacatggatgatcgtcaagtcaaagagggagaagatgtgaagttcactgcaaatgtggaaggataccctgaaccatctgtagcatggactttgaatggagaaccagtttctaagcatccaaacatcactgttaccgacaaggacggagagcacaccatcgaaatttccgccgtcacacccgaacaagctggagagctgtcttgcgaagcgacaaaccccgtcggatccaaaaagagagatgttcaactcgctgttaaaaaggtcggtgatgcaccaacgtttgcaaagaatctcgaagatcggttgatcaccgagggagagttgacattgatggatgctaaattaaacattgtaaaaccaaagccaaagatcacctggcttaaggatggtgttgaaattacttctgatgggcattataagattgttgaagaggaagatggatccttgaaacttagcattcttcaaactaaactggaagataagggaagaatcacgattaaagcggaaagcgaatttggcgttgcggaatgttcagcatctcttggagttgttaagggacgcccaatggccaaaccagcattccaaagtgatattgcaccaattaacctcaccgaaggagatacccttgaatgcaagcttctcatcaccggagacccaacacctttcgtcaagtggtacattggaacacaactcgtttgtgccactgaagatactgagatctctaatgccaatggagtttacactatgaagattcatggtgtgactgctgacatgactggaaagatcaagtgcgtcgcatacaataaggctggagaagtgagcaccgagggtccactcaaggttgttgcaccgattccggttgaatttgaaacatctctatgtgatgctacctgcagagaaggagatactctcaaattgagggcagtattgctcggagagccagaaccagttgtctcgtggtatgtgaacggaaagaagttggaagaatctcagaatatcaagattcattctgagaaaggaacatacacggttacaatcaaagacatcacatgcgattattctggacaagtcgtctgcgaggcaatcaacgagtatggaaaagcaacatctgaggctacattgctcgtgctgccacgtggtgaacctccagatttcttggaatggctcagcaatgttcgcgcaagaactggaaccaaggtcgtgcacaaggttgtcttcacaggagacccgaaaccaagccttacatggtacatcaataataaggagattctcaactcggatctttacaccatcgtcacagatgataaaacatcaacgttgacaatcaacagcttcaacccagatgttcatgttggagaaattatctgcaaggccgagaacgatgctggagaagtttcctgtaccgcaaacatgatcacctacacatctgacatgttcagtgaatctgaaagtgaagcccaagctgaagaatttgtcggagacgatctcactgaagatgagagtcttcgagaggaaatgcaccgtactccaactccagttatggcacccaaattcatcacaaagatcaaggataccaaagccaagaagggacactctgctgtctttgaatgcgttgttccagacaccaagggagtgtgctgcaagtggttgaaggacggaaaagagattgagctgattgccagaatccgggttcaaactagaactggaccagagggacacatcactcaagaacttgtcctcgacaacgtcactccagaagatgccggcaagtacacgtgcatcgttgagaacaccgccggaaaagatacctgtgaggcgacgctaactgtcattgaatcattggagaagaagtcggagaaaaaagctccagaattcattgttgctcttcaagataagacaacaaagacatccgagaaggttgttcttgaatgcaaagtcatcggagagccaaagccgaaagtcagctggcttcacgataataagacaattactcaagagtctatcacagttgaatcagtggaaggcgtcgaaagagtcacaatcacttcatctgaattgtctcatcaaggaaaatacacctgcattgccgagaacactgaaggaacatctaagactgaagcattcttgactgtccaaggcgaagctccagtgttcacaaaggaactgcagaacaaggagttatcaattggagagaagctcgttctctcgtgttctgtcaaaggatccccacagccgcatgtcgatttttattcgttctcggaaactacgaaggtggagacgaagatcacctcatccagtcgaatcgccattgagcatgaccagaccaatacgcattggagaatggttatcagtcaaatcacaaaagaagatattgtctcctacaaagctattgccacaaattcaattggaactgctacttcaacatcaaagatcaccacgaaggtagaggcaccagtctttgagcaaggattaaagaagacaagtgtgaaggagaaggaagaaattaagatggaagtaaaggtcggaggaagtgctccagatgttgaatggtttaaggatgacaaaccagtcagtgaagatggaaatcatgagatgaagaagaatccagaaactggagtgtttactctggttgtgaaacaagctgcaactacagatgctggaaagtataccgccaaggcttccaatccagcaggtactgctgaatcttctgcagaggctgaggtcactcaatctctcgagaaaccaactttcgtgagggaacttgtcacaactgaagtcaagatcaatgaaactgcaactttgtccgttacagtgaaaggagttccagatccgagtgttgaatggcttaaggatggacaaccagtgcaaactgattcaagtcatgtgattgctaaggttgaaggatccggaagctactcgattaccattaaggatgcgagactcgaggactctggaaagtacgcatgccgtgcaaccaatccagcaggtgaagccaaaactgaggctaactttgcagttgtcaagaacttggttccaccagaatttgttgagaaactcagtccactcgaagtgaaggagaaggaaagtaccaccttgtccgtcaaggttgtaggaacaccagaaccatctgttgaatggttcaaggatgatactccaattagtatcgacaatgttcatgtcattcagaagcagacagctgttggatccttcagtttaaccatcaatgacgcgagacagggagatgttggaatctactcttgccgtgctaggaatgaagctggggaagctcttacaacagcgaactttggaatcatcagggattctattccaccagagtttactcaaaaacttcgaccacttgaagtcagagagcaggagactcttgatttgaaagttactgtaattggaaccccagtaccaaatgttgaatggttcaaggatgataagccaatcaatattgataactcgcacatttttgcaaaggatgaaggatcaggacatcatactctcacaattaaacaagctagaggagaagatgttggagtctacacctgcaaagccaccaacgaagccggagaagccaaaaccactgcaaacatggctgttcaagaagagattgaagcaccattgtttgttcaaggcctgaaaccatacgaggtggaacaaggcaagccagctgaattggtggttcgtgtagaaggaaagccagagcctgaggttaaatggttcaaggatggagttccgattgctattgacaatcagcatgtgattgagaagaagggagagaatggatctcatactcttgtcatcaaagacaccaacaatgctgacttcggaaagtacacatgccaagctacaaacaaggctggaaaggatgaaactgttggagagctcaagattccaaagtattcattcgaaaagcaaactgctgaagaagtcaagccactgttcattgagccactaaaggaaacatttgccgttgaaggagataccgttgttcttgaatgcaaggtgaacaaggaatcacatccacaaatcaagttcttcaagaatgatcaaccagtggagattggacaacacatgcaattggaagtattggaagatggaaatatcaagctcacaattcaaaatgccaagaaagaagacgttggtgcatatcgttgcgaggctgtgaatgttgccggaaaggccaacacgaatgctgatttgaagattcaattcgctgctaaagttgaagaacatgtcaccgatgaaagtggccagcttgaggagattggacagtttgagactgtcggagatactgcatcctctaagaccgacactggacgtggagctccagaatttgtggagcttctccgttcgtgtacagttaccgagaagcaacaagcgatccttaagtgcaaggtgaaaggagagccacgaccaaagatcaagtggactaaggaaggaaaggaggtcgaaatgtcggcacgtgttcgcgctgagcacaaggatgatggaactttgacgctgacatttgataatgttactcaagccgacgccggagaatacagatgtgaggctgagaacgagtatggaagtgcatggaccgaagggccaattattgtcacattggaaggagctccaaagattgacggtgaagctccagacttcttgcaaccagtcaagccagctgttgttacagttggtgagactgcagttcttgaaggaaagatttctggaaaaccgaaaccaagtgttaaatggtacaagaatggagaagagctcaagccatccgatagagttaagattgagaatttggatgatggaactcaaagactcaccgttaccaacgctaaactcgacgatatggatgagtaccgctgtgaagcttcaaatgagtttggagatgtttggagtgacgtcactcttacagtcaaggaaccagctcaagttgctccaggattcttcaaggaactctctgctattcaggttaaggagactgaaaccgccaagtttgaatgcaaggtttcgggaactaagccagatgtgaaatggttcaaggacggaactccattgaaggaagacaaacgagtgcacttcgaatcaaccgacgatggaactcaaagacttgtcatcgaagattccaagactgatgatcaaggaaactaccgtattgaagtttccaatgatgctggagttgcgaacagcaaggttccactcacagtcgttccatcagaaaccctcaagatcaagaagggactcacagatgtaaatgttacacagggaaccaagatccttctctctgttgaagttgaaggaaaaccaaaaactgtcaaatggtacaagggaacagaaactgtcaccagctcccagaccacaaagatcgtgcaggtgaccgagtcagaatacaagttagaaatcgaaagcgctgagatgtctgatactggagcttaccgcgttgttctctctactgattcgttttctgttgagtcgtctgctacagtaactgtcaccaaggctgctgaaaagattagtcttccttcattcaagaagggactcgctgatcaatccgttccaaagggaactccattggttttggaagttgaaatcgaaggaaagccaaaagatgttaaatggtataagaatggagatgagatcaaggacgggaaggtcgaggatcttggaaacggaaaataccgactcacaattccagacttccaagagaaagatgttggagagtacagtgtcactgctgctaacgaggctggagaaattgaatcaaaggccaaggtaaacgtgagtgccaagcctgaaattgtttctgggctggtaccaactactgtgaagcaaggagaaactgccacctttaacgtcaaggtcaagggaccagtcaagggagtcaagtggtacaagaacggaaaagagattcctgatgctaaaacaaaggacaatggagatggatcctactctcttgagattccaaacgctcaagttgaagatgcagctgactataaggttgttgtctccaatgatgctggagatgctgattcttcagctgctcttaccgtcaaacttgctgacgatggaaaggataaggtgaaaccagaaattgtatcgggacttattccaactacagtgaagcaaggagaaactgccacctttaacgtcaaggtcaagggtccagtgaaacaggtcaagtggtataagaatggaaaagaaattcccaacgccaaggctaaggacaacggagatggatcctactctctggaaattccaaacgcgcaacttgatgacactgccgactacaaggttgttgtgtcgaatgatgctggagatgctgattcttcagctgctcttactgttaagcttcctggaatcgctattgttaagggacttgaagacgccgaagtgccaaagggcaagaaggctgttctccaagttgaaaccaacaagaagccaaaggaaattaaatggtataagaatggaaaggagattactccaagcgacaaggcacaacccggaagcgacggagacaacaaaccacagctggttattccagatgctggtgacgatgatgctgctgaatataaggttgtgttgactgatgaagatggaaatactgccgattcgtcatgcgccttgactgttaaattaccagcaaaagagccaaagatcatcaaaggactcgaggatcaagtggtgtcgattggatctccaattaagttggaaatcgaaacttctggatcaccgaagactgtgaaatggtacaaaaacggaaaggagcttccaggagctgccgccaagaccatcaagattcagaagatcgacgataacaagtatgttcttgagatcccatccagtgttgttgaagataccggagactacaaagtcgaagttgccaacgaggcaggatctgcaaacagcagtggaaagatcactgtggaaccaaagatcacgttcttaaagccactgaaggatcaatcgatcactgagggagaaaatgccgaattctcagttgaaaccaacaccaagccaagaattgtcaaatggtataagaatggacaagaaattaagccaaattcccgattcatcattgaacaaaagactgataccaagtatcaacttgttattaagaacgctgttcgtgatgatgcagacacctacaagattgttcttgaaaacaccgctggagaagccgaatcttctgctcaattgactgttaagaaagctaaggctggactctgcaagatcgtcaaaggtcttgaagaccaggttgttgccaagggtgccaagatggtatttgaggttaagatccaaggagagccagaggatgtcagatggcttcgtgatgcaaatgttatcagtgcaggagctaatgcaatcattgagaaaattgatgacaccacctacaggttgataattccatccgctgatttgaaggatgctggtgaatacactgtcgaagtaatcaatgagagtggaaaagccaagagtgatgcaaagggagaggttgatgagaaaccagagattgttcgaggacttgagaacatcgaaattccagagggagatgacgatgtgttcaaggttgaagtcagtgctccagtcagacaagtcaaatggtataaaaatgaccaggagatcaaaccaaacagccatttggaagccaaaaagatcggtccaaagaagtacgaacttgctatcaaccgtgctcaattggacgatggagccgactacaaggttgtgctatcgaatgctgcaggagattgtgattcttccgcggctctcactgttgtcaagccaaatgttctgaagattgtcgatggattgaaggatgttgatgttgaggaaccccaaccagttgaacttaaggtcaaggttgagggtattccaaaggttattaaatggtacaagaacggacaggagcttaagccagatgctgacggattcaaatttgaagagaaaccagaatctggagagttctctctcactatcccatcgtctaagaaatctgatgggggtgcataccgtgttgttcttggaaatgacaagggagaagtatacagtggatctgttgttcatgttaaatctgccaaatcatccgaaccaacatcaggagccaacttcctctccccactcaaggataccgaggttgaagaaggagatatgctcactcttcagtgcactattgctggagaaccattccccgaagtcatctgggagaaggatggtgttgtccttcagaaggatgatagaatcacgatgagagtcgcacttgatggtactgctaccctcagaattcgttctgccaagaagagtgacattggacaatatcgtgttactgcgaagaacgaagctggaagcgctacaagtgactgcaaggttaccgtcactgaacaaggagagcaaccatcgaagccaaagttcgttattccattgaagacgggagcagctcttccaggcgacaagaaggaattcaatgtgaaggttcgaggacttccaaagccaacattgcaatggttcttgaacggaatcccaatcaaattcgatgatagaatcaccctcgatgacatggctgatggaaactactgtcttacgattcgtgacgttcgtgaagaagacttcggaaccttgaagtgtattgcaaagaatgagaatggaacagatgaaactgtctgtgaattccaacaaggtgctggacacgatgatggatctagagacgatcttcgttatccaccaagattcaatgttccactttgggacagaagaatccctgttggtgacccaatgttcatcgagtgtcatgttgatgccaacccgaccgccgaagttgaatggttcaaggatggaaagaagatcgaacacactgcacataccgaaatcagaaacaccgttgatggagcatgtcgcatcaagatcattccattcgaggagtctgatattggagtttacatgtgcgttgctgtaaacgagttgggacaagctgaaactcaagccacataccaagttgagattttggaacatgtggaggaggagaagcgccgagaatatgctccaaagattaatccaccattggaagataaaactgtcaatggaggtcaaccaatcagattatcatgcaaggttgacgctatcccaagagcttcagtggtttggtacaaggatggacttccacttcgtgctgattctagaacctctattcaatatgaagaggatggtacagctacccttgcgatcaatgacagtaccgaggaagacattggagcataccgttgtgttgctacaaatgctcatggaacgatcaacaccagttgcagtgtgaacgtcaaggttccgaagcaggaagtcaagaaggagggagaagagccattcttcacaaagggacttgtcgatttgtgggcggatcgtggagattcgttcactttgaagtgcgcagtcaccggagatccattcccagaaatcaagtggtacagaaatggacaacttcttagaaatggaccaagaactgttattgaaacatcgccagatggttcatgttcacttactgtcaatgaatctacaatgagtgatgaaggaatctatcgatgtgaagctgaaaatgctcatggaaaggccaagactcaagctactgctcatgtgcaaatggctcttggaaagactgaaaaaccaaaaatggatgaaggaaaaccaccaaagttcattttggagctttctgatatgtcagtttctcttggaaatgttattgatttggaatgcaaggttaccggactaccaaatccatcagtcaaatggtcgaaggatggaggtccactgattgaggactccagattcgaatggtccaatgaagccagcaagggagtctatcagctcagaatcaagaacgccaccgtacatgacgagggaacttatcgctgcgttgccacaaatgagaatggaagtgctactaccaagtcatttgtaagaatggatgatggtcttggatcaggtgttgtgactgccagtcagccaccaagattcactttgaagatgggagatgttcgtacaactgaaggacaaccattaaaattggagtgtaaggttgacgctagcccacttccagagatggtttggtataaggatggagccattgttacaccatctgacagaattcaaattagtctgtcacctgatggagttgcaactcttcttatcccatcttgcgtctatgatgatgatggaatctaccgtgtaattgccaccaacccatctggaactgcccaggataagggaactgctactgttaagaaacttccaagagatagcggtgccagaaggtctgctgacagagatgtatttgatgctaacaaggcaccaaagcttatggagccactggagaatatcagaattcccgaaaagcagtcgttccgtcttcgttgcaagttcagcggagatccaaagccaacaatcaaatggttcaaggatggagaacgtgtattcccatacggacgtcttcaactcatcgagtctccagatggtgtctgtgagttggtggttgattctgccactcgtcaagatgctggaggatacagatgcgttgctgaaaacacttatggatctgctagaacatcttgcgatgttaatgttattcgcggtgatcgtaagccacgcgacattgactcgtccattcgtgaaggaaaggctccaggattcaccaccccattgacaatccgtcgtgctaagccaggagattccgtgacattcgaatgccttccattcggaaatccattcccatcaatcaagtggcttaaggatggacttgagctgttctctgatgaaaagatcaagatggaagctgctgcagatggaacccagcgactcattctttccgatgtcaccttcttgagtgaaggatacttcagatgtgtagctaccaatgagcatggaactgcttctacaaaggctgaacttgtcatcgaaggagaccgaactattggatcccgcccacttccagaagtaaacggagagcctgaagaatgcaagccaagaatccgtcgtggactgtacaacatgagtattcacgagggtaatgttgtggagatgatcgtctgtgcaactggtatcccaacgccaactgtcaagtggtacaaggatggacaggagattgtcggagatggacctgatggaaagagggtcatctttacggatgaacgaggaattcatcacttggttattgtgaatgcatctccagatgatgaaggagagtactcgttggaagcaacgaataagttgggatcagccaagaccgaaggatccttgaacattatcagaccaagacatattgcagatgctgacgagagaggaggcatgccattcccaccaggattcgtgcgtcaactaaagaacaagcacgtcttcaatcacatgccaacaatcttcgactgccttgttgtcggacacccagcccctgaagtagagtggttccacaatggaaagaagattgttccaggaggacgaatcaagattcaatcgtgtggaggaggatctcatgccctcatcattctcgatacaacccttgaagatgcaggagagtacgttgctactgcgaagaactctcatggatccgccagctcatcagcagtgcttgatgtgactgttccattcctggacagcatcaagttcaatggagagattgatgtgactccatacctcaccgaggaatatggattcaagaagcttaacaccgccagtctcccaactccaccagatcgtggaccattcatcaaggaggtcaccggacattatcttacactctcatggattccaacaaagagagctccaccacgttatccacaagtcacatatgttattgagattcgtgaacttccagagaaacaatggtctctcttggagtataacattccagagccagtatgcaaggttcgtaatttggaactcggaaagtcatatcaattccgtgttcgtgctgagaacatctatggaatctctgatccatcgccagcatctccaccatcaagactcatggctccaccacaaccagtattcgatagaagaacgaacaaagttattccacttcttgacccatatgcagaaaaagctcttgatatgagatactctgaacagtacgcgtgtgctccatggttctcaccaggagtcgttgagaagcgatactgcgccgagaacgataccctcacaattgttctgaatgtgtccggattcccggatccagatatcaaatggaagttccgtggatgggatattgacacgtcatcgccaacctctaaatgcaaagtgtacacttatggaggttccgagacaacattagccatcactggattcagcaaggagaatgttggacaatatcaatgtttcgccaagaacgattacggagatgcacaacaaaatattatggttgatcttgcaacacgaccaaacttcatccaaccactcgtgaacaagaccttctcatcagctcagccaatgagaatggacgtgagagtcgacggagaacctttcccagaattgaaatggatgaaggaatggcgcccaattgtcgagtcgtctcgcatcaagtttgttcaagacggaccttatttgtgctctttgatcattaatgatccaatgtggagagactccggaatctattcatgtgttgctgtaaatgatgccggacaagccacgacgtcgtgtactgttactgttgaagctgaaggcgactacaatgacgtcgaacttccccgtcgccgagtgacaatcgaatcgcgacgagtgcgagagctctacgaaatctctgaaaaagacgaaaagttggcggccgaaggagcaccatttcgagtcaaagaaaaagccacgggacgcgagtttttggcgcagttgagaccgatcgatgatgctctaatgcgccacgtggatatccacaattcgttggatcatccaggaattgtgcaaatgcatcgggtgcttagagatgagaaattggcattggtggtgtttgataatgcaaactcaactatcgacggcctctcaagccttgcgcaccctggcgtcgaaattgctgagccaaaaggagtcaaccgtgaaacatgtgttcgtgtctttgttcgtcaacttcttcttgctctcaagcacatgcatgatttgcgaattgcccatctagatctccgtcccgaaaccattcttcttcaagatgataagctgaaattagcagacttcggtcaagcaagacgccttctacgcggccttatcaccggagaaatcaagggatcgcccgagttcgtgagccctgaaatcgtgagaagttacccattgaccctggcaactgatatgtggagtactggagttttgacatatgtattactaaccggattgtcaccattccacggagataatgacaatgagacccttgcaaacgttgatagttgccaatttgattcgtctcctcttggcaacttctcctatgacgccggagatttcgtcaagaaactgttgaccgagattccagtctcacgtttgacagttgatgaagcattagaccatccatggattaacgatgaaaagctgaaaactgaacctttgtcagctgacacgttgagggaattcaaatatcagcataagtggctggaacgtcgcgtgttcgttcaacagacgccgtccgaacagattcttgaagcaattcttggtccggcaacggcacaagctcaacaaaatgctcctgtagcaccggaaggtcgacgtcctgctgaaatttacgactatctgagaattcagccgaaaaagccaccaccgactgtggaatacgttccacaacctagaaaagagcatccgccgtttattgacgaattcggacaacttattgacggagacgcttttgatcgaccagagggtactggatttgaaggaccacatagacaaccaccacaaattccacctcaacctcaacgaccgaaccaggcagctcacgattcgagacgacacgaacaacaaccacaacatcaggggcaaccacagcgaattcctgttgatcaatacggtcgtccgctagtcgacccacgttacctgaacgatccatcgcaccgcccgagttcccttgacgacgctccattctacgtggacaaatacggaaatccggtgcactttgacaaatacggtagaccaatggctccacaaaacttggaaaagcgaaagcttatcccacaagacaaaggagaaaccccatctcattccaaaaaagaaaagactcagcatccagttgctacaccgattctagcatcgccgggaggagatcaacagcagcagaagatcccgatgagaatgatccgtggggaacgaagagaaatcgaagaggaaattgcgaatagaatattatcagatatttctgaagaaggatcaattgctggttcacttgccagtttggaagattttgagattcccaaggatttccaagtagaggcatctgagccatcaacaccaactctcacaccagaagtaacaatcagagagactattccaaagccaacaccatctccaacatccccacagaaatctccagttccacaaccacaaggtctcttgattccagcaaaggtcacctactctgactcaatactcgccggactccctgcagcagataaaaaggtcctcgaagacgcggaaaacgatccatccatcccagtcggtgctccacttttccttgaaggactccacggatctgatcttacaatcgacacgacctcagcttcaggactgatcaaagtcacatccccagctatcaacctcagtccaaatccaaaatctccacgccgttccactccaggtacaaagagtccagttgtgttgagtccacgtcaagagcactcaatggaagtattgatcgcaacaaagcgaggaaaacctggattcttgccaccaggagaacttgctgaagatattgatgatgaggatgcatttatggatgacagaaagaaacaagtgaaaccaaaggatcatgatggagaaaatgatttcaaagatgagaaagaaagactggagaaggacaaaaacagaagaactgttaacttggatgatcttgataaatatcgtccaagtgcattctacaaagatgatagtgatttcggacatcctggatatgatattgatgcaactccatgggactcacattatcagattggtccagacacttatctgatggctgctcgtggagccgccttcaactcccgagtccgtaactatcgtgaggaactcttcggaatgggggctccaactgtcaaacagggattcctcggagtcagaaatcgtgacattactgttcgtgaacgtcgtcgttacactgatatcctccgcgagactacacaaggccttgagccaaaatctcatgagcaatcaacagctcttcttcaaaaagctccatcagcaacagcaattgagagaattaaggctgatattgagaaggtcacgccgtgtgccacaaagaagaatgatgatggaacctttgccccaatcttcactgcccgtctccgtgatgtgtatcttcgtaaaaaccaaccagcaattttcgaatgcgctgtttcagccagcccggctccaaaagttacttgggacttccaagggaagattctagagtctaacgacagggttacaatcgaacaagataacaatgtcgcccgtcttatccttaaccatgcagctccttacgatcttggagaatacgtgtgcactgccataaatgaatatggaacagataaatcaagttgccgactgataagtggagagactccatctcgtccaggaagacctgaagctgaactctcatctgatacggagattttcattcaatgggaagctccagaaggaccaacatatctggaaggtatcacctacagactcgaatatcgtgttgcaggaccgaatgatcatggtgacccatggatcactgtttctgaaaagattgatgatgaatctgtaattgttaaacatctatcaccacttggaatttatcaattccgagtcactgcacagaatggattcggtctagggctcccatcattgagtagcagaattgttcaaactcacggaaaaggagcaccaaagttgcaaattgatgttttgaaatccgagattcgactgaatgttgtttcaatgcctcaaaagtctacaaatcaattaggaggaatttcggaggaaagtgaagaggattcggaggcaagaacggcaaatgaagatatgaaatcaaatctgcaattgcaaactgatgatccaacaggacggttccagatcggtggtctcaagttcaagggacgtttctctgtgatccgcgacgccgtcgattccacaacagaaggtcacgcccattgcgctgtgaagattcgtcatccatcgtctgaagcgatctcagagtatgaatcgcttcgtgatggtcagcatgaaaatgttcaacgccttatcgccgcattcaataactccaatttcttgtatctattatcggaaagactctacgaagatgtgttttctcgttttgtgttcaacgattattatacagaagaacaagttgcattgacaatgagacaagtcacttcggcacttcatttcttgcatttcaaaggaattgcccatcttgatgtgaatccacacaacataatgttccaatcaaaacgtagttgggtcgtgaaactagttgattttggaagagcacaaaaagtgtcgggagctgtgaaaccagttgattttgatactaaatgggcttcaccagaattccatattccggaaactccggttaccgttcaaagtgacatgtggggtatgggagtcgtcactttctgccttctcgctggattccacccgttcacttctgaatacgaccgcgaagaggagatcaaggagaacgtgatcaatgtgaaatgtgatccaaatttgattccagtcaacgcttcccaagaatgcctttcatttgccacgtgggcgctcaaaaagtcgccagttcgccgaatgagaaccgacgaggctctttctcataagttcctttcttcagatccatcgatggttagaaggagggaatctattaaatactctgcatcaagactccgaaagcttgccgcaatgatccgccagccaacattcagccaaccaatcagcgaagagctcgagtcgaaatatggaaaataaatgtttcattttctttttttttaccaataattatgctttaaaatttgaatagtttaatcattttctcttttttttcgacaaactttttggatacaatctgtgcccgagattttccaaattaatagtcgaatttatcgtttctacgagtagatttttattcatttttgaacttttttttaactttaaaagccttcaacgactttttgcctattttgtgctttctgtttcccgaatctgcttaattttctcttgtgcccaaggagaaattgagtggggtgggaaacttgtgttaaatgttttttttttaatttttatttatgcaacgatgattaaattgtaattagaatagcttcatatttctattttcataactttttaatgataaccttcttccttccatttttcagaaaacaaacgaaatgtatgtatctgccgaataaagttctgaaaatttttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]