GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-09-28 13:25:11, GGRNA.v2 : RefSeq release 225 (Jul, 2024)

LOCUS       NM_001203419            5649 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana dicer-like 4 (DCL4), mRNA.
ACCESSION   NM_001203419
VERSION     NM_001203419.2
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 5649)
  AUTHORS   Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E.,
            Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T.,
            Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M.,
            Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R.,
            Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J.,
            Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J.,
            Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L.,
            Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B.,
            Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E.,
            Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A.,
            Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M.,
            See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L.,
            Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R.,
            Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R.,
            Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N.,
            Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B.,
            Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H.,
            Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W.,
            Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M.,
            Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S.,
            Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K.,
            Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C.,
            Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P.
  CONSRTM   Kazusa DNA Research Institute; Cold Spring Harbor and Washington
            University in St Louis Sequencing Consortium; European Union
            Arabidopsis Genome Sequencing Consortium
  TITLE     Sequence and analysis of chromosome 5 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 823-826 (2000)
   PUBMED   11130714
REFERENCE   2  (bases 1 to 5649)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 5649)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 5649)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003076).
            
            On Sep 12, 2016 this sequence version replaced NM_001203419.1.
FEATURES             Location/Qualifiers
     source          1..5649
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="5"
                     /ecotype="Columbia"
     gene            1..5649
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="Encodes an RNase III-like enzyme that catalyzes
                     processing of trans-acting small interfering RNA
                     precursors in a distinct small RNA biogenesis pathway. The
                     protein is also involved in the production of 21-nt
                     primary siRNAs from both inverted-repeat constructs and
                     endogenous sequences, as well as the RDR6-dependent 21-nt
                     secondary siRNAs involved in long-range cell-to-cell
                     signaling. It binds DRB4, a ds-RNA binding protein."
                     /db_xref="Araport:AT5G20320"
                     /db_xref="GeneID:832154"
                     /db_xref="TAIR:AT5G20320"
     CDS             240..5306
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="dicer-like 4 (DCL4); CONTAINS InterPro DOMAIN/s:
                     Restriction endonuclease, type I, R subunit/Type III, Res
                     subunit (InterPro:IPR006935), Double-stranded RNA-binding
                     (InterPro:IPR001159), Argonaute/Dicer protein, PAZ
                     (InterPro:IPR003100), Ribonuclease III
                     (InterPro:IPR000999), Double-stranded RNA-binding-like
                     (InterPro:IPR014720), DEAD-like helicase, N-terminal
                     (InterPro:IPR014001), DNA/RNA helicase, C-terminal
                     (InterPro:IPR001650), Dicer double-stranded RNA-binding
                     fold (InterPro:IPR005034), Helicase, superfamily 1/2,
                     ATP-binding domain (InterPro:IPR014021); BEST Arabidopsis
                     thaliana protein match is: dicer-like 2
                     (TAIR:AT3G03300.3)."
                     /codon_start=1
                     /product="dicer-like 4"
                     /protein_id="NP_001190348.1"
                     /db_xref="GeneID:832154"
                     /db_xref="TAIR:AT5G20320"
                     /db_xref="Araport:AT5G20320"
                     /translation="
MRDEVDLSLTIPSKLLGKRDREQKNCEEEKNKNKKAKKQQKDPILLHTSAATHKFLPPPLTMPYSEIGDDLRSLDFDHADVSSDLHLTSSSSVSSFSSSSSSLFSAAGTDDPSPKMEKDPRKIARRYQVELCKKATEENVIVYLGTGCGKTHIAVMLIYELGHLVLSPKKSVCIFLAPTVALVEQQAKVIADSVNFKVAIHCGGKRIVKSHSEWEREIAANEHCFIKMECISLLIFDECHHAQQQSNHPYAEIMKVFYKSESLQRPRIFGMTASPVVGKGSFQSENLSKSINSLENLLNAKVYSVESNVQLDGFVSSPLVKVYYYRSALSDASQSTIRYENMLEDIKQRCLASLKLLIDTHQTQTLLSMKRLLKRSHDNLIYTLLNLGLWGAIQAAKIQLNSDHNVQDEPVGKNPKSKICDTYLSMAAEALSSGVAKDENASDLLSLAALKEPLFSRKLVQLIKILSVFRLEPHMKCIIFVNRIVTARTLSCILNNLELLRSWKSDFLVGLSSGLKSMSRRSMETILKRFQSKELNLLVATKVGEEGLDIQTCCLVIRYDLPETVTSFIQSRGRARMPQSEYAFLVDSGNEKEMDLIENFKVNEDRMNLEITYRSSEETCPRLDEELYKVHETGACISGGSSISLLYKYCSRLPHDEFFQPKPEFQFKPVDEFGGTICRITLPANAPISEIESSLLPSTEAAKKDACLKAVHELHNLGVLNDFLLPDSKDEIEDELSDDEFDFDNIKGEGCSRGDLYEMRVPVLFKQKWDPSTSCVNLHSYYIMFVPHPADRIYKKFGFFMKSPLPVEAETMDIDLHLAHQRSVSVKIFPSGVTEFDNDEIRLAELFQEIALKVLFERGELIPDFVPLELQDSSRTSKSTFYLLLPLCLHDGESVISVDWVTIRNCLSSPIFKTPSVLVEDIFPPSGSHLKLANGCWNIDDVKNSLVFTTYSKQFYFVADICHGRNGFSPVKESSTKSHVESIYKLYGVELKHPAQPLLRVKPLCHVRNLLHNRMQTNLEPQELDEYFIEIPPELSHLKIKGLSKDIGSSLSLLPSIMHRMENLLVAIELKHVLSASIPEIAEVSGHRVLEALTTEKCHERLSLERLEVLGDAFLKFAVSRHLFLHHDSLDEGELTRRRSNVVNNSNLCRLAIKKNLQVYIRDQALDPTQFFAFGHPCRVTCDEVASKEVHSLNRDLGILESNTGEIRCSKGHHWLYKKTIADVVEALVGAFLVDSGFKGAVKFLKWIGVNVDFESLQVQDACIASRRYLPLTTRNNLETLENQLDYKFLHKGLLVQAFIHPSYNRHGGGCYQRLEFLGDAVLDYLMTSYFFTVFPKLKPGQLTDLRSLSVNNEALANVAVSFSLKRFLFCESIYLHEVIEDYTNFLASSPLASGQSEGPRCPKVLGDLVESCLGALFLDCGFNLNHVWTMMLSFLDPVKNLSNLQISPIKELIELCQSYKWDREISATKKDGAFTVELKVTKNGCCLTVSATGRNKREGTKKAAQLMITNLKAHENITTSHPLEDVLKNGIRNEAKLIGYNEDPIDVVDLVGLDVENLNILETFGGNSERSSSYVIRRGLPQAPSKTEDRLPQKAIIKAGGPSSKTAKSLLHETCVANCWKPPHFECCEEEGPGHLKSFVYKVILEVEDAPNMTLECYGEARATKKGAAEHAAQAAIWCLKHSGFLC"
     misc_feature    603..1160
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="DEXH-box helicase domain of endoribonuclease Dicer;
                     Region: DEXHc_dicer; cd18034"
                     /db_xref="CDD:350792"
     misc_feature    order(603..614,621..623,672..695,807..809,951..953,
                     1056..1058)
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350792"
     misc_feature    1593..1997
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="C-terminal helicase domain of the endoribonuclease
                     Dicer; Region: SF2_C_dicer; cd18802"
                     /db_xref="CDD:350189"
     misc_feature    order(1683..1691,1866..1868,1923..1925,1929..1931)
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:350189"
     misc_feature    order(1878..1880,1884..1886,1959..1961,1965..1967)
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350189"
     misc_feature    2163..2432
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="Dicer dimerization domain; Region: Dicer_dimer;
                     pfam03368"
                     /db_xref="CDD:460900"
     misc_feature    3006..3437
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="This domain is named PAZ after the proteins Piwi
                     Argonaut and Zwille; Region: PAZ; smart00949"
                     /db_xref="CDD:198017"
     misc_feature    order(3105..3107,3174..3176,3186..3188,3240..3242,
                     3324..3326,3330..3332)
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239207"
     misc_feature    3507..3980
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="Ribonuclease III C terminal domain. This group
                     consists of eukaryotic, bacterial and archeal ribonuclease
                     III (RNAse III) proteins. RNAse III is a double stranded
                     RNA-specific endonuclease. Prokaryotic RNAse III is
                     important in post-transcriptional...; Region: RIBOc;
                     cd00593"
                     /db_xref="CDD:238333"
     misc_feature    order(3552..3557,3564..3569,3576..3578,3585..3590,
                     3597..3602,3606..3614,3642..3644,3936..3938,3963..3965)
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(3552..3554,3561..3563,3573..3575,3906..3908,
                     3915..3917)
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="active site"
                     /db_xref="CDD:238333"
     misc_feature    order(3561..3563,3906..3908,3915..3917)
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238333"
     misc_feature    4062..4787
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="dsRNA-specific ribonuclease [Transcription];
                     Region: Rnc; COG0571"
                     /db_xref="CDD:440336"
     misc_feature    5076..5288
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="double-stranded RNA binding motif of plant
                     Dicer-like proteins; Region: DSRM_DCL_plant; cd19869"
                     /db_xref="CDD:380698"
     misc_feature    order(5076..5081,5088..5093,5106..5111,5139..5153,
                     5157..5159,5229..5240,5247..5252)
                     /gene="DCL4"
                     /locus_tag="AT5G20320"
                     /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4;
                     F5O24.210; F5O24_210"
                     /note="putative RNA binding site [nucleotide binding];
                     other site"
                     /db_xref="CDD:380698"
ORIGIN      
caaaagatgtattttaaaatctctaaactcaataactccacaaaaattttcagaatcaatgattgtagaaacacatgatttctggttcagaatttcacacactccacccaaaaaaatacccttaaaaagttataattgtattgattagctgataaaatcaatttattggaaagaaatcctaataataacgctgtaatagaagagaagagaagagagagggagacgtgagatcgtgaattatgcgtgacgaagttgacttgagcttgaccattccctcgaagcttttggggaagcgagacagagaacaaaaaaattgtgaagaagaaaaaaacaaaaacaaaaaagctaaaaagcagcaaaaggacccaattcttcttcacactagtgctgccactcacaagtttcttcctcctcctttgaccatgccgtacagtgaaatcggcgacgatcttcgctcactcgactttgaccacgccgatgtttcttccgaccttcacctcacttcttcttcctctgtttcttcgttttcctcttcttcgtcttctttgttctccgcggctggtacggatgatccttcaccgaaaatggagaaagaccctagaaaaatcgccaggaggtatcaggtggagctgtgtaagaaagcaacggaggagaacgttattgtatatttgggtacaggttgtgggaagactcacattgcagtgatgcttatatatgagcttggtcatttggttcttagtcccaagaaaagtgtttgtatttttcttgctcccaccgtggctttggtcgaacagcaagccaaggtcatagcggactctgtcaacttcaaagttgcaatacattgtggaggcaagaggattgtgaagagccactcggagtgggagagagagattgcagcgaatgagcactgtttcatcaagatggagtgtatctcccttctaatatttgatgagtgtcaccatgctcaacaacaaagcaaccatccttatgcagaaatcatgaaggttttctataaatcggaaagtttacaacggcctcgaatatttggaatgactgcatctccagttgttggcaaagggtcttttcaatcagagaatttatcgaaaagcattaatagccttgaaaatttgctcaatgccaaggtttattcagtggaaagcaatgtccagctggatggttttgtttcatctcctttagtcaaagtatattattatcggtcagctttaagtgatgcatctcaatcgaccatcagatatgaaaacatgctggaggacatcaaacagcggtgcttggcatcacttaagctgctgattgatactcatcaaacacaaaccctcctaagtatgaaaaggcttctcaaaagatctcatgataatctcatatatactctgctgaatcttggcctctggggagcaatacaggctgctaaaatccaattgaatagtgaccataatgtacaagacgagcctgtgggaaagaatcctaagtcaaagatatgtgatacatatctttctatggctgctgaggccctctcttctggtgttgctaaagatgagaatgcatctgacctcctcagcttagcggcgttgaaggaaccattattctctagaaagctagttcaattgattaagatcctttcggtattcaggctagagccacacatgaaatgtataatatttgtcaatcggattgtgactgcaagaacattgtcatgcatactaaataacttggaactgctacggtcttggaagtctgatttccttgttggacttagttctggactgaagagcatgtcaagaaggagtatggaaacaatacttaaacggttccaatctaaagagctcaatttactggttgccactaaagttggtgaagaaggccttgatattcagacatgctgtcttgtgatccgttatgatttaccagagactgttaccagcttcatacagtccagaggtcgtgctcgaatgcctcagtctgaatatgcgtttctagtggacagcggaaacgagaaagagatggatcttattgaaaattttaaagtaaatgaagatcgaatgaatctagaaattacttacagaagctcagaggaaacttgtcctagacttgatgaggagttatacaaagttcatgagacaggagcttgtatcagtggtggaagcagcatctcccttctctataaatattgttctaggcttccacatgatgaattttttcagcccaagccagagtttcaattcaagcctgttgacgaatttggtggaactatctgtcgcataactttacctgctaatgctcctataagtgaaatcgaaagttcactactaccttcgacagaagctgctaaaaaggatgcttgtctaaaggctgtgcatgagttgcacaacttgggtgtacttaacgattttctgttgccagattccaaggatgaaattgaggacgaattgtcagatgatgaatttgattttgataacatcaaaggtgaaggctgttcacgaggtgacctgtatgagatgcgtgtaccagtcttgtttaaacaaaagtgggatccatctacaagttgtgtcaatcttcattcttactatataatgtttgtgcctcatcccgctgataggatctacaaaaagtttggtttcttcatgaagtcacctcttcccgttgaggctgagactatggatatcgatcttcaccttgctcatcaaagatctgtaagtgtaaagatttttccatcaggggtcacagaattcgacaacgatgagataagactagctgagcttttccaggagattgccctgaaggttctttttgaacggggggagctgatcccggactttgttcccttggaactgcaagactcttctagaacaagcaaatccaccttctaccttcttcttccactctgtctgcatgatggagaaagtgttatatctgtagattgggtgactatcagaaactgcttgtcatcaccaatctttaagactccatctgttttagtggaagatatatttcctccttcgggctctcatttaaagctagcaaatggctgctggaatattgatgatgtgaagaacagcttggtttttacaacctacagtaaacaattttactttgttgctgatatctgccatggaagaaatggtttcagtcctgttaaggaatctagcaccaaaagccatgtggagagcatatataagttgtatggcgtggaactcaagcatcctgcacagccactcttgcgtgtgaaaccactttgtcatgttcggaacttgcttcacaaccgaatgcagacgaatttggaaccacaagaacttgacgaatacttcatagagattcctcccgaactttctcacttaaagataaaaggattatctaaagacatcggaagctcgttatccttgttaccatcaatcatgcatcgtatggagaatttactcgtggctattgaactgaaacatgtgctgtctgcttcgatccctgagatagctgaagtttctggtcacagggtactcgaggcgctcacaacagagaaatgtcatgagcgcctttctcttgaaaggcttgaggtgcttggtgatgcattcctcaagtttgctgttagccgacacctttttctacaccatgatagtcttgatgaaggagagttgactcggagacgctctaacgttgttaacaattccaacttgtgcaggcttgcaataaaaaaaaatctgcaggtctacatccgtgatcaagcattggatcctactcagttctttgcatttggccatccatgcagagtaacctgtgacgaggtagccagtaaagaggttcattccttgaatagggatcttgggatcttggagtcaaatactggtgaaatcagatgtagcaaaggccatcattggttgtacaagaaaacaattgctgatgtggttgaggctcttgtgggagctttcttagttgacagtggcttcaaaggtgctgtgaaatttctgaagtggattggtgtaaatgttgattttgaatccttgcaagtacaagatgcttgtattgcaagcaggcgctacttgcccctcactactcgcaataatttggagacccttgaaaaccagcttgactataagttcctccacaaaggtctacttgtacaagcctttatccatccatcttacaacaggcatggaggaggctgctaccagagattggagtttcttggggatgctgttctggactacttgatgacatcctattttttcacagtcttcccgaaactgaaacctggtcaactgaccgatctaagatctctctcagtaaataatgaggcgctagcaaatgttgctgtcagtttttcgctaaagagatttctattttgcgagtccatttatcttcatgaagttatagaggattataccaatttcctggcatcttccccattggcaagtggacaatctgaaggtccaagatgcccaaaggttcttggtgacttggtagaatcctgtttgggggctcttttcctcgattgtgggttcaacttgaatcatgtctggactatgatgctatcatttctagatccggtcaaaaacttgtctaaccttcagattagtcctataaaagaactgattgaactttgccagtcttacaagtgggatcgggaaatatcagcgacgaaaaaggatggtgcttttactgttgaactaaaagtgaccaagaatggttgttgccttacagtttctgcaactggtcggaacaaaagagagggcacaaaaaaggctgcacagctgatgattacaaacctgaaggctcatgagaacataacaacctcccatccgttggaggatgttctgaagaatggcatccgaaatgaagctaaattaattggctacaatgaagatcctatagatgttgtggatcttgttgggctggacgttgaaaacctaaatatcctagaaacttttggcgggaatagtgaaagaagcagctcatacgtcatcagacgaggtctcccccaagcaccatctaaaacagaagacaggcttcctcaaaaggccatcataaaagcaggtggaccaagcagcaaaaccgcaaaatccctcttgcacgaaacatgtgttgctaactgttggaagccaccacacttcgaatgttgtgaagaggaaggaccaggccacctgaaatcattcgtctacaaggtaatcctggaagttgaagatgcgcccaatatgacattggaatgttatggtgaggctagagcaacgaagaaaggtgcagcagagcacgctgcccaagctgctatatggtgcctcaagcattctggattcctttgctgatgatctcgagcggctatatatcggttagaaatagatgttatcataggcatatataacttttaccagagctacatattagcatatatgatcgacacctacaatttctcgaaagagaaaaaaggatgtctgaaaactaaccttaaaccatagattttggagcggagagctttcggcaaaagttctcttcgattgctcttctgaatttctgaatataagtatatgtttacttgtacttgatgaacccatagcatgataggctccaaaaatatagtttactcatctctcatgcatcaaatatgttcctgtgtgatcttaattaaacaatatatgaactaagcgttaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]