2024-09-28 13:25:11, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_001203419 5649 bp mRNA linear PLN 20-OCT-2022 DEFINITION Arabidopsis thaliana dicer-like 4 (DCL4), mRNA. ACCESSION NM_001203419 VERSION NM_001203419.2 DBLINK BioProject: PRJNA116 BioSample: SAMN03081427 KEYWORDS RefSeq. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 (bases 1 to 5649) AUTHORS Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E., Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K., Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S., Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T., Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M., Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R., Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J., Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J., Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L., Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B., Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E., Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A., Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M., See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L., Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R., Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R., Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N., Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B., Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H., Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W., Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M., Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S., Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K., Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C., Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P. CONSRTM Kazusa DNA Research Institute; Cold Spring Harbor and Washington University in St Louis Sequencing Consortium; European Union Arabidopsis Genome Sequencing Consortium TITLE Sequence and analysis of chromosome 5 of the plant Arabidopsis thaliana JOURNAL Nature 408 (6814), 823-826 (2000) PUBMED 11130714 REFERENCE 2 (bases 1 to 5649) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 5649) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 4 (bases 1 to 5649) AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E. CONSRTM TAIR TITLE Direct Submission JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie Institution, 260 Panama Street, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport. This record is derived from an annotated genomic sequence (NC_003076). On Sep 12, 2016 this sequence version replaced NM_001203419.1. FEATURES Location/Qualifiers source 1..5649 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702" /chromosome="5" /ecotype="Columbia" gene 1..5649 /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="Encodes an RNase III-like enzyme that catalyzes processing of trans-acting small interfering RNA precursors in a distinct small RNA biogenesis pathway. The protein is also involved in the production of 21-nt primary siRNAs from both inverted-repeat constructs and endogenous sequences, as well as the RDR6-dependent 21-nt secondary siRNAs involved in long-range cell-to-cell signaling. It binds DRB4, a ds-RNA binding protein." /db_xref="Araport:AT5G20320" /db_xref="GeneID:832154" /db_xref="TAIR:AT5G20320" CDS 240..5306 /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="dicer-like 4 (DCL4); CONTAINS InterPro DOMAIN/s: Restriction endonuclease, type I, R subunit/Type III, Res subunit (InterPro:IPR006935), Double-stranded RNA-binding (InterPro:IPR001159), Argonaute/Dicer protein, PAZ (InterPro:IPR003100), Ribonuclease III (InterPro:IPR000999), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Dicer double-stranded RNA-binding fold (InterPro:IPR005034), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: dicer-like 2 (TAIR:AT3G03300.3)." /codon_start=1 /product="dicer-like 4" /protein_id="NP_001190348.1" /db_xref="GeneID:832154" /db_xref="TAIR:AT5G20320" /db_xref="Araport:AT5G20320" /translation="
MRDEVDLSLTIPSKLLGKRDREQKNCEEEKNKNKKAKKQQKDPILLHTSAATHKFLPPPLTMPYSEIGDDLRSLDFDHADVSSDLHLTSSSSVSSFSSSSSSLFSAAGTDDPSPKMEKDPRKIARRYQVELCKKATEENVIVYLGTGCGKTHIAVMLIYELGHLVLSPKKSVCIFLAPTVALVEQQAKVIADSVNFKVAIHCGGKRIVKSHSEWEREIAANEHCFIKMECISLLIFDECHHAQQQSNHPYAEIMKVFYKSESLQRPRIFGMTASPVVGKGSFQSENLSKSINSLENLLNAKVYSVESNVQLDGFVSSPLVKVYYYRSALSDASQSTIRYENMLEDIKQRCLASLKLLIDTHQTQTLLSMKRLLKRSHDNLIYTLLNLGLWGAIQAAKIQLNSDHNVQDEPVGKNPKSKICDTYLSMAAEALSSGVAKDENASDLLSLAALKEPLFSRKLVQLIKILSVFRLEPHMKCIIFVNRIVTARTLSCILNNLELLRSWKSDFLVGLSSGLKSMSRRSMETILKRFQSKELNLLVATKVGEEGLDIQTCCLVIRYDLPETVTSFIQSRGRARMPQSEYAFLVDSGNEKEMDLIENFKVNEDRMNLEITYRSSEETCPRLDEELYKVHETGACISGGSSISLLYKYCSRLPHDEFFQPKPEFQFKPVDEFGGTICRITLPANAPISEIESSLLPSTEAAKKDACLKAVHELHNLGVLNDFLLPDSKDEIEDELSDDEFDFDNIKGEGCSRGDLYEMRVPVLFKQKWDPSTSCVNLHSYYIMFVPHPADRIYKKFGFFMKSPLPVEAETMDIDLHLAHQRSVSVKIFPSGVTEFDNDEIRLAELFQEIALKVLFERGELIPDFVPLELQDSSRTSKSTFYLLLPLCLHDGESVISVDWVTIRNCLSSPIFKTPSVLVEDIFPPSGSHLKLANGCWNIDDVKNSLVFTTYSKQFYFVADICHGRNGFSPVKESSTKSHVESIYKLYGVELKHPAQPLLRVKPLCHVRNLLHNRMQTNLEPQELDEYFIEIPPELSHLKIKGLSKDIGSSLSLLPSIMHRMENLLVAIELKHVLSASIPEIAEVSGHRVLEALTTEKCHERLSLERLEVLGDAFLKFAVSRHLFLHHDSLDEGELTRRRSNVVNNSNLCRLAIKKNLQVYIRDQALDPTQFFAFGHPCRVTCDEVASKEVHSLNRDLGILESNTGEIRCSKGHHWLYKKTIADVVEALVGAFLVDSGFKGAVKFLKWIGVNVDFESLQVQDACIASRRYLPLTTRNNLETLENQLDYKFLHKGLLVQAFIHPSYNRHGGGCYQRLEFLGDAVLDYLMTSYFFTVFPKLKPGQLTDLRSLSVNNEALANVAVSFSLKRFLFCESIYLHEVIEDYTNFLASSPLASGQSEGPRCPKVLGDLVESCLGALFLDCGFNLNHVWTMMLSFLDPVKNLSNLQISPIKELIELCQSYKWDREISATKKDGAFTVELKVTKNGCCLTVSATGRNKREGTKKAAQLMITNLKAHENITTSHPLEDVLKNGIRNEAKLIGYNEDPIDVVDLVGLDVENLNILETFGGNSERSSSYVIRRGLPQAPSKTEDRLPQKAIIKAGGPSSKTAKSLLHETCVANCWKPPHFECCEEEGPGHLKSFVYKVILEVEDAPNMTLECYGEARATKKGAAEHAAQAAIWCLKHSGFLC"
misc_feature 603..1160 /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="DEXH-box helicase domain of endoribonuclease Dicer; Region: DEXHc_dicer; cd18034" /db_xref="CDD:350792" misc_feature order(603..614,621..623,672..695,807..809,951..953, 1056..1058) /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:350792" misc_feature 1593..1997 /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="C-terminal helicase domain of the endoribonuclease Dicer; Region: SF2_C_dicer; cd18802" /db_xref="CDD:350189" misc_feature order(1683..1691,1866..1868,1923..1925,1929..1931) /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:350189" misc_feature order(1878..1880,1884..1886,1959..1961,1965..1967) /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:350189" misc_feature 2163..2432 /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="Dicer dimerization domain; Region: Dicer_dimer; pfam03368" /db_xref="CDD:460900" misc_feature 3006..3437 /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="This domain is named PAZ after the proteins Piwi Argonaut and Zwille; Region: PAZ; smart00949" /db_xref="CDD:198017" misc_feature order(3105..3107,3174..3176,3186..3188,3240..3242, 3324..3326,3330..3332) /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239207" misc_feature 3507..3980 /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="Ribonuclease III C terminal domain. This group consists of eukaryotic, bacterial and archeal ribonuclease III (RNAse III) proteins. RNAse III is a double stranded RNA-specific endonuclease. Prokaryotic RNAse III is important in post-transcriptional...; Region: RIBOc; cd00593" /db_xref="CDD:238333" misc_feature order(3552..3557,3564..3569,3576..3578,3585..3590, 3597..3602,3606..3614,3642..3644,3936..3938,3963..3965) /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238333" misc_feature order(3552..3554,3561..3563,3573..3575,3906..3908, 3915..3917) /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="active site" /db_xref="CDD:238333" misc_feature order(3561..3563,3906..3908,3915..3917) /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="metal binding site [ion binding]; metal-binding site" /db_xref="CDD:238333" misc_feature 4062..4787 /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="dsRNA-specific ribonuclease [Transcription]; Region: Rnc; COG0571" /db_xref="CDD:440336" misc_feature 5076..5288 /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="double-stranded RNA binding motif of plant Dicer-like proteins; Region: DSRM_DCL_plant; cd19869" /db_xref="CDD:380698" misc_feature order(5076..5081,5088..5093,5106..5111,5139..5153, 5157..5159,5229..5240,5247..5252) /gene="DCL4" /locus_tag="AT5G20320" /gene_synonym="ATDCL4; dicer-like 4; DICER-LIKE 4; F5O24.210; F5O24_210" /note="putative RNA binding site [nucleotide binding]; other site" /db_xref="CDD:380698" ORIGIN
caaaagatgtattttaaaatctctaaactcaataactccacaaaaattttcagaatcaatgattgtagaaacacatgatttctggttcagaatttcacacactccacccaaaaaaatacccttaaaaagttataattgtattgattagctgataaaatcaatttattggaaagaaatcctaataataacgctgtaatagaagagaagagaagagagagggagacgtgagatcgtgaattatgcgtgacgaagttgacttgagcttgaccattccctcgaagcttttggggaagcgagacagagaacaaaaaaattgtgaagaagaaaaaaacaaaaacaaaaaagctaaaaagcagcaaaaggacccaattcttcttcacactagtgctgccactcacaagtttcttcctcctcctttgaccatgccgtacagtgaaatcggcgacgatcttcgctcactcgactttgaccacgccgatgtttcttccgaccttcacctcacttcttcttcctctgtttcttcgttttcctcttcttcgtcttctttgttctccgcggctggtacggatgatccttcaccgaaaatggagaaagaccctagaaaaatcgccaggaggtatcaggtggagctgtgtaagaaagcaacggaggagaacgttattgtatatttgggtacaggttgtgggaagactcacattgcagtgatgcttatatatgagcttggtcatttggttcttagtcccaagaaaagtgtttgtatttttcttgctcccaccgtggctttggtcgaacagcaagccaaggtcatagcggactctgtcaacttcaaagttgcaatacattgtggaggcaagaggattgtgaagagccactcggagtgggagagagagattgcagcgaatgagcactgtttcatcaagatggagtgtatctcccttctaatatttgatgagtgtcaccatgctcaacaacaaagcaaccatccttatgcagaaatcatgaaggttttctataaatcggaaagtttacaacggcctcgaatatttggaatgactgcatctccagttgttggcaaagggtcttttcaatcagagaatttatcgaaaagcattaatagccttgaaaatttgctcaatgccaaggtttattcagtggaaagcaatgtccagctggatggttttgtttcatctcctttagtcaaagtatattattatcggtcagctttaagtgatgcatctcaatcgaccatcagatatgaaaacatgctggaggacatcaaacagcggtgcttggcatcacttaagctgctgattgatactcatcaaacacaaaccctcctaagtatgaaaaggcttctcaaaagatctcatgataatctcatatatactctgctgaatcttggcctctggggagcaatacaggctgctaaaatccaattgaatagtgaccataatgtacaagacgagcctgtgggaaagaatcctaagtcaaagatatgtgatacatatctttctatggctgctgaggccctctcttctggtgttgctaaagatgagaatgcatctgacctcctcagcttagcggcgttgaaggaaccattattctctagaaagctagttcaattgattaagatcctttcggtattcaggctagagccacacatgaaatgtataatatttgtcaatcggattgtgactgcaagaacattgtcatgcatactaaataacttggaactgctacggtcttggaagtctgatttccttgttggacttagttctggactgaagagcatgtcaagaaggagtatggaaacaatacttaaacggttccaatctaaagagctcaatttactggttgccactaaagttggtgaagaaggccttgatattcagacatgctgtcttgtgatccgttatgatttaccagagactgttaccagcttcatacagtccagaggtcgtgctcgaatgcctcagtctgaatatgcgtttctagtggacagcggaaacgagaaagagatggatcttattgaaaattttaaagtaaatgaagatcgaatgaatctagaaattacttacagaagctcagaggaaacttgtcctagacttgatgaggagttatacaaagttcatgagacaggagcttgtatcagtggtggaagcagcatctcccttctctataaatattgttctaggcttccacatgatgaattttttcagcccaagccagagtttcaattcaagcctgttgacgaatttggtggaactatctgtcgcataactttacctgctaatgctcctataagtgaaatcgaaagttcactactaccttcgacagaagctgctaaaaaggatgcttgtctaaaggctgtgcatgagttgcacaacttgggtgtacttaacgattttctgttgccagattccaaggatgaaattgaggacgaattgtcagatgatgaatttgattttgataacatcaaaggtgaaggctgttcacgaggtgacctgtatgagatgcgtgtaccagtcttgtttaaacaaaagtgggatccatctacaagttgtgtcaatcttcattcttactatataatgtttgtgcctcatcccgctgataggatctacaaaaagtttggtttcttcatgaagtcacctcttcccgttgaggctgagactatggatatcgatcttcaccttgctcatcaaagatctgtaagtgtaaagatttttccatcaggggtcacagaattcgacaacgatgagataagactagctgagcttttccaggagattgccctgaaggttctttttgaacggggggagctgatcccggactttgttcccttggaactgcaagactcttctagaacaagcaaatccaccttctaccttcttcttccactctgtctgcatgatggagaaagtgttatatctgtagattgggtgactatcagaaactgcttgtcatcaccaatctttaagactccatctgttttagtggaagatatatttcctccttcgggctctcatttaaagctagcaaatggctgctggaatattgatgatgtgaagaacagcttggtttttacaacctacagtaaacaattttactttgttgctgatatctgccatggaagaaatggtttcagtcctgttaaggaatctagcaccaaaagccatgtggagagcatatataagttgtatggcgtggaactcaagcatcctgcacagccactcttgcgtgtgaaaccactttgtcatgttcggaacttgcttcacaaccgaatgcagacgaatttggaaccacaagaacttgacgaatacttcatagagattcctcccgaactttctcacttaaagataaaaggattatctaaagacatcggaagctcgttatccttgttaccatcaatcatgcatcgtatggagaatttactcgtggctattgaactgaaacatgtgctgtctgcttcgatccctgagatagctgaagtttctggtcacagggtactcgaggcgctcacaacagagaaatgtcatgagcgcctttctcttgaaaggcttgaggtgcttggtgatgcattcctcaagtttgctgttagccgacacctttttctacaccatgatagtcttgatgaaggagagttgactcggagacgctctaacgttgttaacaattccaacttgtgcaggcttgcaataaaaaaaaatctgcaggtctacatccgtgatcaagcattggatcctactcagttctttgcatttggccatccatgcagagtaacctgtgacgaggtagccagtaaagaggttcattccttgaatagggatcttgggatcttggagtcaaatactggtgaaatcagatgtagcaaaggccatcattggttgtacaagaaaacaattgctgatgtggttgaggctcttgtgggagctttcttagttgacagtggcttcaaaggtgctgtgaaatttctgaagtggattggtgtaaatgttgattttgaatccttgcaagtacaagatgcttgtattgcaagcaggcgctacttgcccctcactactcgcaataatttggagacccttgaaaaccagcttgactataagttcctccacaaaggtctacttgtacaagcctttatccatccatcttacaacaggcatggaggaggctgctaccagagattggagtttcttggggatgctgttctggactacttgatgacatcctattttttcacagtcttcccgaaactgaaacctggtcaactgaccgatctaagatctctctcagtaaataatgaggcgctagcaaatgttgctgtcagtttttcgctaaagagatttctattttgcgagtccatttatcttcatgaagttatagaggattataccaatttcctggcatcttccccattggcaagtggacaatctgaaggtccaagatgcccaaaggttcttggtgacttggtagaatcctgtttgggggctcttttcctcgattgtgggttcaacttgaatcatgtctggactatgatgctatcatttctagatccggtcaaaaacttgtctaaccttcagattagtcctataaaagaactgattgaactttgccagtcttacaagtgggatcgggaaatatcagcgacgaaaaaggatggtgcttttactgttgaactaaaagtgaccaagaatggttgttgccttacagtttctgcaactggtcggaacaaaagagagggcacaaaaaaggctgcacagctgatgattacaaacctgaaggctcatgagaacataacaacctcccatccgttggaggatgttctgaagaatggcatccgaaatgaagctaaattaattggctacaatgaagatcctatagatgttgtggatcttgttgggctggacgttgaaaacctaaatatcctagaaacttttggcgggaatagtgaaagaagcagctcatacgtcatcagacgaggtctcccccaagcaccatctaaaacagaagacaggcttcctcaaaaggccatcataaaagcaggtggaccaagcagcaaaaccgcaaaatccctcttgcacgaaacatgtgttgctaactgttggaagccaccacacttcgaatgttgtgaagaggaaggaccaggccacctgaaatcattcgtctacaaggtaatcctggaagttgaagatgcgcccaatatgacattggaatgttatggtgaggctagagcaacgaagaaaggtgcagcagagcacgctgcccaagctgctatatggtgcctcaagcattctggattcctttgctgatgatctcgagcggctatatatcggttagaaatagatgttatcataggcatatataacttttaccagagctacatattagcatatatgatcgacacctacaatttctcgaaagagaaaaaaggatgtctgaaaactaaccttaaaccatagattttggagcggagagctttcggcaaaagttctcttcgattgctcttctgaatttctgaatataagtatatgtttacttgtacttgatgaacccatagcatgataggctccaaaaatatagtttactcatctctcatgcatcaaatatgttcctgtgtgatcttaattaaacaatatatgaactaagcgttaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]